The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yan, S. R.
Right arrow Articles by Stadnyk, A. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yan, S. R.
Right arrow Articles by Stadnyk, A. W.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
The Journal of Immunology, 2006, 177: 5604-5611.
Copyright © 2006 by The American Association of Immunologists, Inc.

Differential Pattern of Inflammatory Molecule Regulation in Intestinal Epithelial Cells Stimulated with IL-11

Sen Rong Yan2,*, Robbie R. Joseph{dagger}, Jun Wang*,{dagger} and Andrew W. Stadnyk3,*,{dagger}

* Department of Pediatrics, {dagger} Department of Microbiology and Immunology, and the Dalhousie Inflammation Group, Dalhousie University, Halifax, Nova Scotia, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
To better predict the consequences of blocking signal transduction pathways as a means of controlling intestinal inflammation, we are characterizing the pathways up-regulated by IL-1 in intestinal epithelial cells (IEC). IL-1beta induced increased mRNA levels of MIP-2, MCP-1, RANTES, inducible NO synthase (iNOS), and cyclooxygenase-2 (COX-2) in the IEC-18 cell line. IL-1beta activated NF-{kappa}B but not ERK or p38. Infecting cells with adenovirus expressing a mutated gene for I{kappa}B{alpha} (I{kappa}BAA) blocked IL-1-induced mRNA increases in MIP-2, MCP-1, and iNOS but not COX-2 or RANTES. Expression of I{kappa}BAA attenuated the IL-1-induced increase in COX-2 protein. Unexpectedly, RANTES mRNA increased, and protein was secreted by cells expressing I{kappa}BAA in the absence of IL-1. Adenovirus-expressing I{kappa}BAA, blocking protein synthesis, and IL-1beta all resulted in activation of JNK. The JNK inhibitor SP600125 prevented the RANTES increases by all three stimuli. A human enterocyte line was similarly examined, and both NF-{kappa}B and JNK regulate IL-1-induced RANTES secretion. We conclude that in IEC-18, IL-1beta-induced increases in mRNA for MIP-2, MCP-1, and iNOS are NF-{kappa}B-dependent, whereas regulation of RANTES mRNA is independent of NF-{kappa}B but is positively regulated by JNK. IL-1beta-induced mRNA increases in COX-2 mRNA are both NF-{kappa}B- and MAPK-independent but the translation of COX-2 protein is NF-{kappa}B-dependent. This pattern of signaling due to a single stimulus exposed the complexities of regulating inflammatory genes in IEC.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In addition to functioning as a barrier and absorptive organ, intestinal epithelial cells (IEC)4 play an active role in inflammatory diseases by releasing multiple cytokines and inflammatory mediators (1, 2). The constellation of IEC-derived inflammatory molecules includes interleukins, chemokines, growth factors, prostaglandins, and nitrogen radicals. Chemokines in particular contribute to the pathology by recruiting various leukocyte types into the mucosa. IEC in turn respond to the cytokines that the leukocytes make in the milieu, such as IL-1, TNF-{alpha}, IFN-{gamma}, and IL-4 during inflammatory bowel disease (IBD) (reviewed in Ref. 3). In establishing the IEC cytokine/chemokine network using the nontransformed rat IEC-18 cell line we previously reported that IL-1-stimulated CXCL2 (MIP-2) and CCL2 (MCP-1) and IL-4-stimulated MCP-1 and CCL11 (eotaxin), whereas IFN-{gamma} only stimulated MCP-1 (4). Considering the potential for different mediators to influence pathology, our aim now is to better understand the regulation of expression of multiple molecules elicited by each single cytokine stimulus. This effect is important for predicting the response of IEC to pharmacological therapies intended to block signaling pathways in efforts to reduce inflammation. In this study, we build on our earlier data and report on the signaling dependencies of IL-1beta stimulation of multiple mediators in the IEC-18 cell line.

IL-1 is a pleiotropic cytokine produced by many cell types in response to variety of stimuli. Although IL-1 consists of two agonists, IL-1{alpha} and IL-1beta, IL-1beta has been implicated in multiple aspects of inflammation, most notably the ability to induce the synthesis and release of other inflammatory mediators in vivo, including lipid mediators, reactive oxygen and nitrogen intermediates, cytokines, and chemokines (5). In addition to other evidence and our studies for stimulation of chemokines in IEC, IL-1 reportedly increases or induces expression of IL-6, COX-2, and the inducible NO synthase (iNOS) (6, 7, 8, 9). The regulatory mechanisms by which IL-1 induces these changes in IEC are still not fully understood although MAPK, NF-{kappa}B, and PI3K signaling pathways have been implicated (10, 11, 12, 13).

NF-{kappa}B, an inducible transcription factor composed of Rel A (p65) and NF-{kappa}B1 (p50) in IEC, is widely regarded as the master control over IEC inflammatory gene expression (14). The activation of NF-{kappa}B is regulated by an endogenous cytoplasmic inhibitor, I{kappa}B; in responding to certain stimuli I{kappa}B becomes phosphorylated at serine residues 32 and 36 and then selectively ubiquitinated and degraded (15). In the course of our investigations into the I{kappa}B/NF-{kappa}B pathway in IL-1-stimulated IEC, we detected differential patterns of mRNA changes in cells infected with an adenovirus expressing a mutated gene for I{kappa}B{alpha} (I{kappa}BAA) that suppresses the activation of NF-{kappa}B. We report that although the IL-1beta-induced increases of some inflammatory molecules are positively regulated by NF-{kappa}B, others are not and in fact increase despite inhibition of NF-{kappa}B. The results will need to be taken into consideration in strategies intended to dampen NF-{kappa}B activation as a means of controlling intestinal inflammation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Materials

The IEC-18 cell line and a PCR-based mycoplasma detection kit used to determine our cultures are mycoplasma free were both purchased from American Type Culture Collection. The human fetal enterocyte line HIEC, established with funding from the Medical Research Council of Canada, was generously provided by Dr. J.-F. Beaulieu, Université de Sherbrooke (Sherbrooke, Québec, Canada) (16). Cell culture polystyrene flasks and Multiwell plates were from BD Biosciences. DMEM, HEPES, L-glutamine, FBS, newborn cow serum, penicillin, streptomycin, and bovine insulin were purchased from Invitrogen Life Technologies. Rat IL-1beta and human IL-1beta were purchased from PeproTech. Nitrocellulose membrane, ECL Western blotting detection reagents, and [{gamma}-32P]ATP were purchased from Amersham Biosciences. SB203580, PD98059, and SP600125 were obtained from Calbiochem. Rabbit anti-I{kappa}B{alpha} protein and anti-phosphorylated p38 antisera and mouse anti-phosphorylated I{kappa}B{alpha} mAb were from Cell Signaling Technology. Rabbit anti-NF-{kappa}B (p65), ERK2 and p38 antisera, and a mouse anti-phosphorylated ERK1/2 mAb were obtained from Santa Cruz Biotechnology. A protein assay kit (Bradford method) and other reagents for electrophoresis were from Bio-Rad. HRP-conjugated goat anti-mouse IgG and anti-rabbit IgG Abs, cycloheximide, wortmannin, and all the other reagents were obtained from Sigma-Aldrich.

Cell culture

The IEC-18 cell line was maintained in DMEM supplemented with 10 mM HEPES, 2 mM L-glutamine, 5% heat-inactivated newborn cow serum, 50 U/ml penicillin and 50 µg/ml streptomycin, hereafter referred to as complete DMEM, at 37°C and 5% CO2. The passage and periodical mycoplasma testing were conducted as described in detail elsewhere (17).

Experiments were performed 1 wk postpassage on confluent cells (using 18~20th passage cells) in 6- or 12-well polystyrene plates. For experimental treatments the cells were replenished with fresh complete DMEM, and in some experiments, with PD98059, SB203580, SP600125, or cycloheximide, each dissolved in DMSO then incubated for 20 min at 37°C before IL-1beta addition (diluted with complete DMEM/5% FCS to a final concentration of 0.5 µg/ml unless otherwise indicated) and further incubation.

The HIEC line was cultured in DMEM (high glucose) supplemented with 4 mM L-glutamine, 20 mM HEPES, 5% FBS, and 0.2 IU/ml insulin. IL-1 treatments were conducted on confluent cultures in serum-free medium.

Adenovirus constructs and infection

Replication defective adenovirus lacking segments of the E1 and E3 regions, described in detail elsewhere (18) and kindly provided by Dr. C. Jobin, University of North Carolina (Chapel Hill, NC), encode a CMV-driven mutated I{kappa}B{alpha} resistant to degradation (Ad5I{kappa}BAA). Adenovirus 5 expressing GFP, which was confirmed by fluorescent microscopy of infected cells, was used as an infection control. Virus was replicated by infection of the E1-transformed HEK293 cells and purified from cell lysate. Titers were estimated by OD260 absorbance, and viral stocks were stored at –20°C in storage buffer (5 mM Tris-HCl (pH 8.0), 50 mM NaCl, 500 µM MgCl2, 25% glycerol). IEC-18 of near confluence were infected overnight with recombinant adenovirus at a multiplicity of infection of ~45 PFU per IEC in complete DMEM 24–48 h before use.

Preparation of cell lysates

After incubation cells were washed once with ice-cold PBS containing 1 mM DFP (diisopropyl fluorophosphate) then lysed with M2 buffer (20 mM Tris (pH 7.0), 0.5% Nonidet P-40, 250 mM NaCl, 3 mM EGTA, 3 mM EDTA, 2 mM DTT, 5 mM PMSF, 5 µg/ml leupeptin, 5 µg/ml pepstatin, 10 µg/ml aprotinin, 0.2 mM Na3VO4, 10 mM NaF, 10 µM phenylarsine oxide) (19). The lysates were clarified by centrifugation at 12,000 x g for 10 min at 4°C and assessed for protein concentration using the Bradford method (Bio-Rad). Samples were kept at –80°C before use.

Preparation of nuclear extracts

The experimental procedure of Ward et al. (20) was used with some modifications. Cells were washed once with ice-cold PBS/DFP then collected into buffer A (10 mM Tris (pH 7.8), 10 mM KCl, 1.5 mM EDTA, 0.5 mM DTT, 1 mM PMSF, 0.1 mM Na3VO4, 5 µg/ml leupeptin, 5 µg/ml pepstatin, 10 µg/ml aprotinin, 10 mM NaF, 10 µM phenylarsine oxide). Then 0.1 volume of 10% Nonidet P-40 was added and the samples vortex-mixed for 4 s followed by centrifugation at 12,000 x g for 2 min. The supernatants were aspirated, and the pellets washed once with buffer A. The nuclei were collected by centrifugation as described and the nuclear proteins were extracted with buffer B (20 mM Tris (pH 7.8), 150 mM NaCl, 50 mM KCl, 1.5 mM EDTA, 5 mM DTT and protease, and phosphatase inhibitors as in buffer A) for 1 h at 4°C. The residues of the nuclei were removed by centrifugation at 12,000 x g for 10 min at 4°C. Protein concentrations in the nuclear extracts were determined using the Bradford method.

Western blot analysis

Equal amounts of protein from the preparations were mixed with one-third volume of 4x SDS-PAGE sample buffer (62.5 mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, 100 mM 2-ME, and 0.01% bromophenol blue) and boiled for 10 min. Proteins were then separated by SDS-PAGE on 10% acrylamide gels and transferred to a nitrocellulose membrane through electrophoresis. The membranes were blocked with 5% skim milk and analyzed by Western blotting using the indicated Abs as described elsewhere (21). The same membranes were also used for blotting for the second or third proteins after the bound Abs were removed with a stripping buffer (62.5 mM Tris-HCl (pH 6.8), 2% SDS, and 100 mM 2-ME) at 55°C for 30 min followed by blocking with milk.

Immunoprecipitation and in vitro kinase assays

The MAPKs (ERK1/2 and p38) were immunoprecipitated from cell lysate proteins using Abs bound to protein A-agarose beads by rotating at 4°C for 2 h. The precipitates were intensely washed with lysis buffer and the precipitates were assessed by in vitro kinase assay using myelin basic protein or activating transcription factor-2 as substrates for ERK1/2 or p38, respectively, in the presence of [{gamma}-32P]ATP as described earlier (22).

RNA extraction and relative RT-PCR

RNA was extracted using TRIzol reagent (Invitrogen Life Technologies) following the manufacturer’s instructions. Reverse transcription and PCR were performed as previously described (17). Briefly, 1 µg of total cellular RNA from each sample was reverse transcribed using Maloney murine leukemia virus reverse transcriptase (Invitrogen Life Technologies) with 0.01 mM dNTPs and 1 µg of random hexamers (both from Pharmacia). The reverse transcriptase product was diluted 1/10 and 4 µl used for measurement of beta-actin, otherwise an equal undiluted volume was used as template for each cytokine determination. PCR mixes contained (in final concentrations) 50 mM KCl, 20 mM Tris-HCl (pH 8.4), 2.5 mM MgCl2, 0.1 µg/ml BSA, 0.2 mM dNTPs, and 2.5 pmol of each primer. Most primer sequences have been published previously, the exceptions being RANTES (all reading 5' to 3') sense ATATGGCTCGGACACCACTC, antisense CTTCTTCTCTGGGTTGGCAC; COX-2 sense GACTTTTCAGATCCTCCTGTGG, antisense CAATCAGCAGTTTCTCAGAGC; and iNOS sense TGGCTTCCTTGTTCAGCTACG, antisense CACAGAACTGAGGGTACATGC. PCR was conducted under the following cycling conditions: 93°C, 60°C, and 72°C all at 60 s for 30 or 35 cycles. Products were visualized on 1.5% agarose gels containing 5 µg/ml ethidium bromide and photographed using Polaroid 667 film.

ELISA measurements of RANTES protein concentration

Culture supernatants were recovered after overnight incubation of cells treated with IL-1 or following infection with adenovirus, some in combination with SP600125. Rat and human RANTES protein concentrations were measured using a commercial ELISA prepared to measure human RANTES (PeproTech). Recombinant human RANTES was used as the standard for quantifying HIEC culture supernatants. Considering the ELISA cross-reacts with rodent RANTES, recombinant rat RANTES (PeproTech) was used to prepare the standard curve for reading rat supernatant samples.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
IL-1beta up-regulates multiple inflammatory factors in adherent IEC-18

IL-1beta plays an important role and is commonly reported elevated in the mucosa of a number of intestinal inflammatory diseases. Not only does this cytokine prime endothelial cells with adhesion molecules and activate leukocytes but it also stimulates IEC into cytokine expression that in turn further contribute to the inflammatory pathology. The IEC-18 rat crypt-like cell line is a good model to represent normal cell function because it is not transformed and typically expresses inflammatory mediators only following stimulation. When added to adherent IEC-18, IL-1beta induced the expression of multiple genes for factors that have been strongly associated with inflammation. Shown in Fig. 1 are mRNA increases for COX-2, MCP-1, MIP-2, RANTES, and iNOS. Detection of beta-actin mRNA, which in our experience does not change in concentration in cells treated with IL-1beta, was used to demonstrate similar first strand cDNA loading between the treatment groups.


Figure 1
View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 1. IL-1beta induces mRNA increases for COX-2, MCP-1, MIP-2, iNOS, and RANTES in adherent IEC-18. Confluent IEC-18 were left unstimulated or were stimulated with IL-1beta (0.5 ng/ml) for 2 h. Cellular RNA was extracted using TRIzol reagent and analyzed by RT-PCR as described in Materials and Methods. The beta-actin product illustrates that similar levels of RNA, and in turn first strand cDNA, were used in the untreated and treated groups. This experiment was conducted three times with each experiment showing a similar pattern of results.

 
IL-1beta time- and dose-dependently activates NF-{kappa}B

Added to confluent IEC-18, IL-1beta induced a rapid and intense phosphorylation of I{kappa}B{alpha} that first appeared within a few minutes as a transient phase followed in 30 min by a second, protracted episode (Fig. 2A, left). The first phase of I{kappa}B{alpha} phosphorylation was closely followed by the degradation of the protein that resulted in a low I{kappa}B{alpha} level between 10 and 20 min. Levels of I{kappa}B{alpha} protein then increased and remained constant after exposure to IL-1beta for 1 h, despite the second phase of I{kappa}B{alpha} phosphorylation, probably due to de novo protein synthesis. Shown in Fig. 2A, right, I{kappa}B{alpha} phosphorylation was increased in response to increasing concentrations of IL-1beta as was I{kappa}B{alpha} degradation. IEC-18 responded to a concentration of IL-1beta as low as 0.02 ng/ml with detectable phosphorylation of I{kappa}B{alpha}.


Figure 2
View larger version (77K):
[in this window]
[in a new window]
 
FIGURE 2. IL-1beta time- and dose-dependently induces phosphorylation and subsequent degradation of I{kappa}B{alpha} and nuclear translocation of p65 (NF-{kappa}B) in adherent IEC-18. A, Confluent IEC-18 cells were replenished with fresh medium containing recombinant rat IL-1beta and incubated for various times (left) or with varying concentrations of IL-1beta (right) then incubated for 5 min. Cells were then washed, lysed, and 40 µg of protein per sample were analyzed by Western blotting using a mouse anti-phosphorylated I{kappa}B{alpha} mAb followed by a HRP-conjugated goat anti-mouse IgG, which in turn was detected using ECL Western Blotting Reagents. The same membrane was stripped and reblotted for I{kappa}B{alpha} protein then stripped again and probed for beta-actin. B, Confluent IEC-18 were stimulated with 0.5 ng/ml IL-1beta and harvested at different times (left) or were stimulated with different concentrations of IL-1beta (right) and were harvested after 60 min. The cells were harvested by scraping into a hypotonic buffer then treated with Nonidet P-40 to a final concentration of 1% and disrupted by vortex mixing. Nuclear proteins were analyzed by Western blot analysis for p65. The same membrane was stripped and reblotted for nuclear beta-actin. All experiments were performed a minimum of three times.

 
Shown in Fig. 2B, increased levels of nuclear NF-{kappa}B, identified in the Western blot as p65, were detected as early as 10 min after the addition of IL-1beta, and levels increased up to 2 h during IL-1beta stimulation, but returned to a basal level by 4 h. As seen in the phosphorylation and degradation of I{kappa}B{alpha}, increasing levels of nuclear p65 paralleled the increases in concentration of IL-1beta (Fig. 2B). We also detected NF-{kappa}B activation by IL-1beta using adenovirus expression of a {kappa}B-driven luciferase gene (data not shown in this study, but published elsewhere (23)).

IL-1beta-induced increases in mRNA for iNOS, MCP-1, and MIP-2 are NF-{kappa}B-dependent

To confirm the NF-{kappa}B dependency of the various mediator mRNA changes seen in Fig. 1, we infected cells with an adenovirus expressing a mutated and tagged gene for I{kappa}B{alpha}, which is resistant to phosphorylation by I{kappa}B kinase and therefore is inactive (18). The mutant protein is larger than native I{kappa}B{alpha} when detected by Western blot analysis (I{kappa}B{alpha}-Tag in Fig. 3A). Prior infection of IEC-18 with this virus but not the GFP-expressing virus almost abolished the phosphorylation/degradation of I{kappa}B{alpha} (Fig. 3A) and the nuclear translocation of p65 induced by IL-1beta (Fig. 3B). When these cells were assessed for mRNA we found that the I{kappa}BAA-expressing virus but not the GFP-expressing control virus essentially blocked the IL-1beta-induced increase in mRNA for iNOS, MCP-1, and MIP-2 (Fig. 4A). IL-1beta up-regulated mRNA levels for both RANTES and COX-2 were not suppressed by I{kappa}BAA infection. In a pattern unlike any of the other mediators, infection by I{kappa}BAA-expressing adenovirus caused a marked increase in the expression of RANTES, even greater than that induced by IL-1 alone. We noticed that the control virus infection resulted in a low but detectable RANTES mRNA increase (Fig. 4A) so we explored whether there was a dose relationship between virus infection and any RANTES mRNA increase. Indeed, higher infectious doses of GFP-expressing virus did result in increased RANTES mRNA in otherwise untreated IEC-18 (data not shown). This result was interpreted to mean that virus infection alone could contribute to increased RANTES (GFP-expressing viral infection) in an NF-{kappa}B-independent manner (I{kappa}BAA-expressing virus). The heightened RANTES mRNA levels in I{kappa}BAA-expressing virus may therefore be an effect of virus directly combined with inhibition of NF-{kappa}B in the cells.


Figure 3
View larger version (62K):
[in this window]
[in a new window]
 
FIGURE 3. Effect of adenoviral expression of I{kappa}BAA on NF-{kappa}B signaling. Confluent IEC-18 were left uninfected (control) or were infected with viruses carrying genes for I{kappa}BAA or GFP for at least 24 h before the addition of IL-1. Some cultures were then treated with IL-1beta for 30 min before cellular (A) and nuclear proteins (B) were prepared and analyzed by Western blotting for I{kappa}B{alpha} and p65 (n-NF-{kappa}B), respectively. In both cases the blots were stripped and subsequently probed for actin.

 

Figure 4
View larger version (65K):
[in this window]
[in a new window]
 
FIGURE 4. Differential effects of I{kappa}BAA on IL-1beta-induced increases in iNOS, MCP-1, MIP-2, RANTES, and COX-2 in adherent IEC-18. Confluent IEC-18 were left uninfected (control) or were infected with viruses carrying genes I{kappa}BAA or GFP at 24 h before stimulation with IL-1beta then harvested for RNA 2 h later. RT-PCR was performed (A) or 3 h later for protein detection by Western blotting (B). The filter probed for COX-2 was stripped then reblotted for actin. Experiments with higher doses of GFP-expressing virus resulted in more mRNA for RANTES only. These experiments were conducted three times, each time with a similar pattern of change.

 
Considering the COX-2 mRNA levels were increased in IL-1beta-treated cells expressing I{kappa}BAA, we thought to examine intracellular protein levels (after 3 h) and observed that the infection did prevent the expected increase in protein otherwise seen in IL-1-treated cells (Fig. 4B). This effect was not from viral infection as the GFP-expressing virus did not have the same effect on COX-2 protein levels.

IL-1beta does not activate MAPKs (ERK1/2 and p38) in IEC-18

In many cell types, including IEC, the MAPKs are involved in a broad range of cellular responses so we explored whether they had a role in IL-1beta-induced increases of these mediators in IEC-18. Adherent IEC-18 cultured in 5% FCS demonstrated high levels of ERK1/2 phosphorylation (Fig. 5A) and activity (Fig. 5B) both of which were inhibited by the MAPK kinase inhibitor PD98059. Surprisingly, the addition of IL-1beta to the cells did not cause any detectable change in the phosphorylation or activity of ERK1/2 (Fig. 5). The high constitutive activity of ERK1/2 was unaffected by infection with either I{kappa}BAA or the control GFP-expressing virus (data not shown). In contrast to ERK, only a low level of p38 phosphorylation and activity was detected in cells, but like ERK, levels remained unchanged by IL-1beta (Fig. 5). This basal level of p38 activity could be reduced by the inhibitor SB203580 (Fig. 5B), but this had no effect on IL-1beta-stimulated mediator mRNA levels (data not shown). These data suggest that the MAPKs are unlikely to be involved directly in the IL-1beta responses of IEC-18. Considering the high level of phosphorylated ERK we proceeded to examine the effects of preincubation with PD98059 on constitutive and IL-1beta-induced activation of the NF-{kappa}B pathway and COX-2 production (Fig. 4B). Shown in Fig. 6, the inhibitor had no apparent effect on I{kappa}B{alpha} phosphorylation or degradation or p65 nuclear translocation triggered by IL-1beta yet consistently resulted in lower COX-2 protein levels. In fact, the 25-min incubation in PD98059 resulted in a reduction in COX-2 protein levels below vehicle-treated control cells implying that activated ERK has a role in the regulation of constitutive COX-2 protein levels, presumably at a posttranscriptional level. Nevertheless, COX-2 protein levels were clearly increased when cells were stimulated by IL-1beta even in the presence of the ERK inhibitor (Fig. 6).


Figure 5
View larger version (63K):
[in this window]
[in a new window]
 
FIGURE 5. IL-1beta does not result in MAPK activation in adherent IEC-18. Confluent IEC-18 were left untreated (control) or were treated with 50 µM PD98059 (PD) or 1 µM SB203580 (SB) for 20 min at 37°C. Some wells were additionally stimulated with IL-1beta for a further 30 min before lysis in M2 buffer. A, Lysate proteins (10 µg of protein per sample for ERK1/2 and 40 µg/sample for p38) were analyzed by Western blot analysis. The same membranes were then stripped and reblotted for beta-actin. B, Lysate proteins (50 µg of protein per sample for ERK1/2 and 200 µg of protein per sample for p38) were immunoprecipitated with rabbit anti-ERK1/2 or anti-p38 antisera immobilized on protein A-Sepharose 4B then assayed for ERK and p38 kinase activities measured as phosphorylation of myelin basic protein (MBP) or activating transcription factor (ATF-2), respectively, in the presence of [{gamma}-32P]ATP. A second aliquot of the lysate proteins (10 µg of protein per sample) was directly analyzed by Western blotting using the rabbit anti-ERK1/2 or anti-p38 antisera.

 

Figure 6
View larger version (46K):
[in this window]
[in a new window]
 
FIGURE 6. Effect of blocking ERK activation on NF-{kappa}B signaling and COX-2 protein levels. Cells were pretreated with 50 µM PD98059 (PD) or left untreated then stimulated with IL-1beta. Cytoplasmic and nuclear lysates were prepared then probed for I{kappa}B{alpha}, COX-2, and beta-actin proteins or p65 and beta-actin proteins, respectively.

 
Further to determining the intracellular signals leading to RANTES up-regulation, activation of the IL-1R type I complex of proteins can trigger the recruitment of PI3K, which in turn acts through Akt to induce NF-{kappa}B (24). We sought to test whether there may be an NF-{kappa}B-independent role for PI3K in the up-regulation of RANTES by IL-1 by using wortmannin to inhibit PI3K activity. However applying wortmannin in a range of doses as high as 100 µM did not prevent the IL-1-induced increase in any of the mediators mRNA, suggesting this role for PI3K is not the case (data not shown).

JNK is a positive regulator of RANTES expression

The high levels of RANTES mRNA achieved using the I{kappa}BAA-expressing virus, shown in Fig. 4, led us to consider whether NF-{kappa}B is a negative regulator of RANTES expression in these cells, possibly by promoting the expression of a repressor of RANTES transcription. To address this hypothesis, we treated cells with cycloheximide to inhibit protein translation on the premise that constitutive NF-{kappa}B-mediated proteins would be interrupted and the repression of RANTES transcription released. Indeed, as shown in Fig. 7, incubation of IEC-18 in 10 µg/ml cycloheximide without any other stimulation results in increased RANTES mRNA levels. However another effect of protein translation blockade is the activation of the stress-activated protein kinase JNK (25). Activation of JNK even shows a reciprocal relationship with NF-{kappa}B in some systems (26), thus we determined whether JNK became activated in the IEC-18. Fig. 8A shows that IL-1beta, cycloheximide, and infection of cells with I{kappa}BAA-expressing virus all result in the phosphorylation of JNK isoforms. The phosphorylation and activation of JNK is not inhibited by preincubation of cells with the activity inhibitor, SP600125 (Fig. 8B). In contrast, SP600125 dose-dependently blocked the mRNA increases in RANTES induced by each of these stimuli (Fig. 9). We confirmed that the SP600125 was not lethal during the incubation period as the cells remained adherent in a monolayer (data not shown). This pattern of JNK inhibition resulting in a failure to increase RANTES mRNA levels led us to conclude that the IL-1-stimulated increase in RANTES mRNA is mediated by JNK in the IEC-18 line.


Figure 7
View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 7. Effect of cycloheximide on RANTES mRNA levels in unstimulated IEC-18. IEC-18 were incubated with 10 µg/ml cycloheximide (CHX) prepared in ethanol, or in the ethanol diluent alone then harvested for total cellular RNA at the indicated times. RT-PCR was performed to detect mRNA levels of RANTES and beta-actin. Similar results were obtained using cycloheximide concentrations as high as 20 µg/ml.

 

Figure 8
View larger version (58K):
[in this window]
[in a new window]
 
FIGURE 8. JNK is activated by multiple stimuli that result in increased RANTES levels. A, IEC-18 were incubated in the presence of IL-1beta, 10 µg/ml cycloheximide (CHX) or were infected with virus-expressing I{kappa}BAA. Cytoplasmic proteins were harvested at the indicated times and probed by Western blot using phosphorylated JNK-specific Abs or an Ab that detects JNK protein. B, Incubation of cells in the JNK activity inhibitor SP600125 did not prevent the IL-1-induced activation of JNK. Cells were incubated with SP600125 for 20 min before the addition of 10 ng/ml IL-1beta, and cell lysates were prepared 10 min after addition of IL-1beta.

 

Figure 9
View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 9. Inhibition of JNK prevents increases in RANTES mRNA levels by multiple stimuli. A, Preincubation of cells in SP600125 followed by IL-1beta stimulation dose-dependently inhibits the RANTES mRNA increase detected after 3 h of culture. B, Preincubation in SP600125 also inhibits RANTES mRNA increases due to incubation in cycloheximide (CHX). C, Infection of cells by virus-expressing I{kappa}BAA. NT, nontreated.

 
In some experiments we replaced the I{kappa}BAA-expressing adenovirus with curcumin as a pharmacological means of inhibiting NF-{kappa}B (27). The 25 µM curcumin blocked RANTES mRNA increases following IL-1 treatment but curcumin also reportedly blocks JNK activation (28), so its use was not evaluated further.

Considering the difficulty in relating changes in JNK phosphorylation and mRNA levels to a biological outcome, we measured the levels of secreted RANTES protein after overnight culture in the presence of the various stimuli and the JNK inhibitor. Fig. 10A shows the 24 h RANTES protein concentrations achieved by IEC-18 cells left untreated, treated with IL-1, or these same conditions combined with 25 µM SP600125. Fig. 10A also shows that DMSO, used as diluent for SP600125, had no direct effect or any detectable effect on IL-1-stimulated RANTES secretion. Fig. 10B shows that the I{kappa}BAA expressing adenovirus directly resulted in secretion of RANTES and that this result was prevented if cells were also incubated with SP600125 at the time of virus infection (first 24 h). IL-1 added 24 h after the virus infection was initiated had some added effect but nevertheless was largely susceptible to the JNK inhibitor. We conclude from this pattern of results that the I{kappa}BAA-expressing adenovirus infection induces JNK and that RANTES up-regulation is largely if not entirely JNK-dependent because NF-{kappa}B is inhibited in these cells.


Figure 10
View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 10. RANTES secretion is inhibited by the JNK inhibitor SP600125. A, IEC-18 were left untreated or were treated with IL-1 or DMSO, or IL-1 plus either 25 µM SP600125 (SP) or DMSO (diluent). The culture supernatants were collected 24 h later and assayed for RANTES by ELISA. B, IEC-18 were left untreated or were treated with 25 µM SP600125 before adenovirus (Ad) infection then cultured overnight and the supernatants assayed for RANTES by ELISA (first 24 h). IL-1 was added to one batch of virus-infected cells. Virus-infected cells were treated with SP600125 (SP) and cultured for an additional 24 h (second 24 h) before assaying the supernatants for RANTES by ELISA. Data represents the mean + SD of triplicate wells from a single experiment representative of three conducted. n.d., not detectable.

 
We next explored whether the effect of IL-1 that we detect on the rat IEC could be directly translated to HIEC. In our experience, freshly isolated adult human colonocytes rapidly succumb to apoptosis and are unresponsive to IL-1 or TNF-{alpha} even in short term cultures (see <www.broadmedical.org/printable_pages/Final%20Progress%20Reports/FPR_IBD-0056_stadnyk.htm>). Various transformed human colon carcinoma cell lines are available but these have serious shortcomings in representing normal cells. For example, abundant expression of the IL-1R type II, which IEC-18 only expresses following detachment, dampens the T84 cell line response to IL-1 (29). We therefore chose to use a nontransformed human fetal ileal cell line, HIEC (16). These cells secreted RANTES in the presence of IL-1 under serum-free conditions (Fig. 11). Fig. 11 further shows that 25 µM SP600125 reduced the total IL-1-stimulated and secreted RANTES by roughly half, which contrasts the observations using IEC-18. Furthermore, infection with adenovirus-expressing I{kappa}BAA did not directly stimulate RANTES secretion (data not shown) but did dampen the levels achieved using IL-1 (Fig. 11). The combination of superrepressor expression and JNK inhibitor essentially ablated RANTES secretion (Fig. 11). We interpret this pattern of results in HIEC to be the combined effect of IL-1 to activate NF-{kappa}B (reduced by the superrepressor) and JNK (further reduced in presence of superrepressor).


Figure 11
View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 11. Human enterocytes make RANTES in response to IL-1. Batches of the human fetal enterocyte line, HIEC, growing on 6-well plates were left uninfected or were infected with adenovirus expressing the I{kappa}B superrepressor for 1 h. The medium was changed and DMSO or SP600125 was added. After overnight culture, IL-1 plus DMSO or IL-1 plus 25 µM SP600125 (SP) diluted in DMSO was added to the cultures in serum-free medium, and the cell supernatants recovered after an overnight incubation for measurement of RANTES by ELISA. The final DMSO concentration in all cultures was 0.25%. One experiment of two performed is shown. n.d., not detectable.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
IL-1beta is a potent and pleiotropic proinflammatory cytokine produced by a variety of cell types in response to inflammatory stimulation. IL-1beta has been reported increased in the mucosa of patients with IBD and in intestinal tissues of animal models of colitis and therefore is believed to have a role in the development of IBD (30). Importantly, apart from its broad effects on inflammatory cells and endothelium, IL-1beta is a powerful stimulus for epithelial cells. In this study, we observed that IL-1beta up-regulates the expression of genes for a panel of inflammatory factors including COX-2, MCP-1, MIP-2, iNOS, and RANTES in IEC-18. With such broad cell targets and pleiotropic effects, inhibiting IL-1beta becomes an attractive approach to controlling inflammation.

It has been reported by multiple studies that IL-1 induces expression of various inflammatory mediators in IEC through an NF-{kappa}B-dependent manner. Our results using the I{kappa}B{alpha} superrepressor to selectively inhibit NF-{kappa}B activation and p65 nuclear localization confirm this response is the case in the IEC-18 for iNOS, MCP-1, and MIP-2. In addition, we build on this understanding by showing that IL-1-stimulated IEC-18 up-regulates RANTES and COX-2 mRNA levels by an NF-{kappa}B-independent mechanism but that COX-2 translation is NF-{kappa}B-dependent. These regulatory pathways are summarized in Fig. 12. Unstimulated adherent cell COX-2 mRNA levels appear to depend on ERK, which is phosphorylated and highly active in confluent cells cultured in complete serum. Otherwise in our experiments these mediators in IL-1-treated IEC-18 are not influenced by ERK or p38. One difference between our study and other reports using human cells is that the IEC-18 cells are nontransformed and nontumorigenic. In fact most human carcinoma lines constitutively produce a number of proinflammatory molecules including IL-1beta, IL-8, MCP-1, and the IL-1R type II (29, 31, 32), which confluent IEC-18 only make following cytokine stimulation (4) or detachment (17). Thus access to the promoter regions may be different in transformed cells vs nontransformed cells or in dividing cells vs nondividing cells or in the presence of serum.


Figure 12
View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 12. Model depicting the multiple levels of mediator regulation invoked by IL-1 stimulation of the IEC-18 cell line. Speculation is implied (arrows with ?) from the data shown in Results.

 
The putative role of COX-2 and prostaglandins influencing the establishment of inflammation-induced colon cancer has resulted in considerable interest in the regulation of this mediator in the colon and IEC. Infection of IEC-18 cells with virus-expressing I{kappa}BAA did not affect the COX-2 mRNA increase induced by IL-1 (Fig. 4A), yet blocked the IL-1 up-regulation of COX-2 protein (Fig. 4B). This outcome rules out JNK as an exclusive regulator of COX-2 mRNA up-regulation by IL-1 otherwise levels would be increased in concentration in I{kappa}BAA-expressing cells similar to RANTES. This outcome is compatible with IL-1 stabilizing COX-2 mRNA in absence of NF-{kappa}B with a consequential decline in translation, and does not rule out a role for NF-{kappa}B acting to enhance transcription of the gene. Otherwise the underlying mechanism for this pattern of changes is not yet entirely clear. Other reports indicate that it is multifactorial. For example, using the closely related IEC-6 line, investigators found that COX-2 up-regulation was p38-dependent when cells were challenged with endotoxin but that ERK was a negative regulator when cells were challenged with a stressor that induced both ERK and p38 activation (33). In the human cell line HT-29, IL-1 stimulated COX-2 was reduced following preincubations in PD98059, SB203580, SP600125, or inhibitors of NF-{kappa}B, although no single treatment ablated the increase entirely (34). Our finding that PI3K inhibition had no effect on IL-1-stimulated COX-2 mRNA levels contrasts findings of Weaver et al. (11) who demonstrated that PI3K negatively regulated both TNF- and IL-1-stimulated levels in HT-29 and Caco-2 cells. Notwithstanding the variation in results from different investigators using different cell systems, and in particular the limitations using human cells, we would predict that blockade of NF-{kappa}B will result in reduced protein levels of COX-2; however, when the agent used to suppress NF-{kappa}B is removed, there may be a surge of COX-2 translation from the increased pool of mRNA and heightened prostaglandin release, causing a rebound of the inflammation.

The multiple pathways to gene expression and possible reciprocal activation of other pathways underscores why inhibiting NF-{kappa}B alone may not have entirely anti-inflammatory effects. Evidence that this possibility may be the case was seen with p50 gene knockout mice that developed typhlocolitis due to Helicobacter hepaticus infection, in contrast to wild-type mice (35). Our results suggest RANTES may be one mediator made or potentiated during NF-{kappa}B inhibition. RANTES is a CC chemokine that binds CCR1, CCR3, CCR4, and CCR5 and is produced by a variety of cell types including epithelial cells from the airways and colon. It acts as a potent chemoattractant for monocytes, NK cells, T cells, eosinophils, basophils, and dendritic cells. Increased levels of RANTES have been found in IBD tissues and therefore this chemokine most certainly has a role in the development of intestinal inflammation (36). IL-1 greatly induced increased RANTES mRNA coincident with the activation of NF-{kappa}B, but in the course of these investigations proved to be NF-{kappa}B-independent in IEC-18. In fact cells with ectopic I{kappa}BAA protein expressed high RANTES mRNA levels with no further stimulation. As high concentrations of GFP-expressing adenovirus stimulated RANTES increases, the effect of the I{kappa}BAA adenovirus directly plus inhibition of NF-{kappa}B through the expression of the superrepressor protein likely combine to heighten JNK activation and RANTES increases in mRNA (Fig. 4) and secreted protein (Fig. 10B). The finding of a direct effect of the virus is important because of the consideration adenoviruses are getting as a biological mediator delivery system. Indeed RANTES and other chemokines have been reported by others due to virus alone, but typically viral replication is required. With respect to nonreplicating virus, the dose seems important in eliciting a chemokine response (37). In this case a high viral dose likely indirectly stimulates the cells through an IFN response, and evidence is emerging that IFN-beta impacts on JNK activation (38).

Our investigations show that the RANTES up-regulation by IL-1 in the IEC-18 is entirely JNK-dependent, as was the expression in I{kappa}BAA-expressing cells. The finding of JNK-dependent RANTES expression is similar to the regulation reported in airway smooth muscle cells also stimulated with IL-1 (39). Yet our results contrast other reports using transformed human IEC cell lines. In one report RANTES mRNA increases in HT-29 required a combination of TNF-{alpha} and IFN-{gamma}, and expression was relatively late (40). In another study using TNF-{alpha} or bacterial infection to stimulate HT-29 or Caco-2 cells, RANTES expression was again delayed by several hours (41). This delay in expression is incompatible with a direct effect of JNK or NF-{kappa}B on RANTES gene transcription in these lines and is more likely due to an indirect effect. Considering these differences between carcinoma lines and other confounders related to constitutive inflammatory cytokine expression (for example, IL-8) by carcinomas (31), we chose to use a nontransformed fetal human enterocyte line. The results obtained with HIEC differ not only from our rat cell results but also from the published data from human colon carcinomas. Our experiments indicate that the HIEC respond to IL-1 with RANTES in an NF-{kappa}B- and JNK-dependent manner. Unfortunately, limitations in our ability to culture primary human adult colonocytes remains an obstacle to improving our understanding of the biology of these cells using in vitro paradigms. We have isolated colonocytes from the normal-appearing margins of human cancer resections and observed these cells rapidly succumb to apoptosis when prepared in single cell suspension. None of the strategies in which we are aware will delay apoptosis of detached IEC-18 in culture (42) work to keep human colonocytes viable, and indeed these cells are refractory to IL-1 and TNF-{alpha}.

In summary, we observed that IL-1 induced increases in mRNA levels for COX-2, MCP-1, MIP-2, iNOS, and RANTES in adherent IEC-18. NF-{kappa}B signaling was direct and critical for MCP-1, MIP-2, and iNOS mRNA changes in these cells; however, COX-2 and RANTES were not. COX-2 protein levels were regulated by NF-{kappa}B. RANTES mRNA changes were entirely due to the activation of JNK. The multiple means by which IL-1 can lead to increased mediator expression will need to be closely considered when strategies intended to block NF-{kappa}B are used to control inflammation. Though these changes were not entirely mirrored in a nontransformed human enterocyte line, advances need to be made in sustaining healthy human primary IEC to confidently appreciate the contribution of these cells to inflammation.


    Acknowledgments
 
We thank Hana James and Karen Conrod for their excellent technical skills helping with the experiments.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This study was supported by grants from the Broad Medical Research Foundation, Inflammatory Bowel Disease grants program, and the Natural Sciences and Engineering Research Council of Canada. Back

2 Current address: Department of Anatomical Pathology, MacKenzie Building, Queen Elizabeth II Health Sciences Centre, 5788 University Avenue, Halifax B3H 1V8, Nova Scotia, Canada. Back

3 Address correspondence and reprint requests Dr. Andrew W. Stadnyk, Mucosal Immunology Research, Izaak Walton Killam Health Centre, 5850 University Avenue, Halifax B3K 3R6, Nova Scotia, Canada. E-mail address: astadnyk{at}dal.ca Back

4 Abbreviations used in this paper: IEC, intestinal epithelial cell; COX-2, cyclooxygenase-2; IBD, inflammatory bowel disease; iNOS, inducible NO synthase. Back

Received for publication June 6, 2005. Accepted for publication July 28, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Kagnoff, M. F., L. Eckmann. 1997. Epithelial cells as sensors for microbial infection. J. Clin. Invest. 100: 6-10. [Medline]
  2. Stadnyk, A. W.. 2002. Intestinal epithelial cells as a source of inflammatory cytokines and chemokines. Can. J. Gastroenterol. 16: 241-246. [Medline]
  3. Papadakis, K. A., S. R. Targan. 2000. Role of cytokines in the pathogenesis of inflammatory bowel disease. Annu. Rev. Med. 51: 289-298. [Medline]
  4. Winsor, G. L., C. C. M. Waterhouse, R. L. MacLellan, A. W. Stadnyk. 2000. Interleukin-4 and interferon-{gamma} differentially stimulate MCP-1 and eotaxin production by intestinal epithelial cells. J. Interferon Cytokine Res. 20: 299-308. [Medline]
  5. Dinarello, C. A.. 1996. Biologic basis for interleukin-1 in disease. Blood 87: 2095-2147. [Abstract/Free Full Text]
  6. Vitkus, S. J. D., S. A. Hanifin, D. W. McGee. 1998. Factors affecting Caco-2 intestinal epithelial cell interleukin- 6 secretion. In Vitro Cell. Dev. Biol. Anim. 34: 660-664. [Medline]
  7. Mascarenhas, J. O., M. E. Goodrich, H. Eichelberger, D. W. McGee. 1996. Polarized secretion of IL-6 by IEC-6 intestinal epithelial cells: differential effects of IL-1beta and TNF-{alpha}. Immunol. Invest. 25: 333-340. [Medline]
  8. Takahashi, M., M. Mutoh, Y. Shoji, Y. Kamanaka, M. Naka, T. Maruyama, T. Sugimura, K. Wakabaysahi. 2003. Transfection of K-rasAsp12 cDNA markedly elevates IL-1beta- and lipopolysaccharide-mediated inducible nitric oxide synthase expression in rat intestinal epithelial cells. Oncogene 22: 7667-7676. [Medline]
  9. Homaidan, F. R., I. Chakroun, G. S. Dbaibo, W. El-Assaad, M. E. El-Sabban. 2001. IL-1 activates two phospholipid signaling pathways in intestinal epithelial cells. Inflamm. Res. 50: 375-381. [Medline]
  10. Garat, C., W. P. Arend. 2003. Intracellular IL-1Ra type 1 inhibits IL-1-induced IL-6 and IL-8 production in Caco-2 intestinal epithelial cells through inhibition of p38 mitogen-activated protein kinase and NF-{kappa}B pathways. Cytokine 23: 31-40. [Medline]
  11. Weaver, S. A., M. P. Russo, K. L. Wright, G. Kolios, C. Jobin, D. A. F. Robertson, S. G. Ward. 2001. Regulatory role of phosphatidylinositol 3-kinase on TNF-{alpha}-induced cyclooxygenase 2 expression in colonic epithelial cells. Gastroenterology 120: 1117-1127. [Medline]
  12. Böcker, U., A. Schottelius, J. M. Watson, L. Holt, L. L. Licato, D. A. Brenner, R. B. Sartor, C. Jobin. 2000. Cellular differentiation causes a selective down-regulation of interleukin (IL)-1beta-mediated NF-{kappa}B activation and IL-8 gene expression in intestinal epithelial cells. J. Biol. Chem. 275: 12207-12213. [Abstract/Free Full Text]
  13. Parhar, K., A. Ray, U. Steinbrecher, C. Nelson, B. Salh. 2003. The p38 mitogen-activated protein kinase regulates interleukin-beta-induced IL-8 expression via an effect on the IL-8 promoter in intestinal epithelial cells. Immunology 108: 502-512. [Medline]
  14. Jobin, C., R. B. Sartor. 2000. The I{kappa}B/NF-{kappa}B system: a key determinant of mucosal inflammation and protection. Am. J. Physiol. 278: C451-C462.
  15. Chen, Z. J., L. Parent, T. Maniatis. 1996. Site-specific phophorylation of I{kappa}B{alpha} by a novel ubiquitination-dependent protein kinase activity. Cell 84: 853-862. [Medline]
  16. Perreault, N., J.-F. Beaulieu. 1998. Primary cultures of fully differentiated and pure human intestinal epithelial cells. Exp. Cell Res. 245: 34-42. [Medline]
  17. Waterhouse, C. C. M., A. W. Stadnyk. 1999. Rapid expression of IL-1beta by intestinal epithelial cells in vitro. Cell. Immunol. 193: 1-8. [Medline]
  18. Jobin, C., A. Panja, C. Hellerbrand, Y. Iimuro, J. Didonato, D. A. Brenner, R. B. Sartor. 1998. Inhibition of proinflammatory molecule production by adenovirus-mediated expression of a nuclear factor {kappa}B super-repressor in human intestinal epithelial cells. J. Immunol. 160: 410-418. [Abstract/Free Full Text]
  19. Lin, Y., A. Devin, A. Cook, M. M. Keane, M. Kelliher, S. Lipkowitz, Z. G. Liu. 2000. The death domain kinase RIP is essential for TRAIL (Apo2L)-induced activation of I{kappa}B kinase and c-Jun N-terminal kinase. Mol. Cell. Biol. 20: 6638-6645. [Abstract/Free Full Text]
  20. Ward, C., E. R. Chilvers, M. F. Lawson, J. G. Pryde, S. Fujihara, S. N. Farrow, C. Haslett, A. G. Rossi. 1999. NF-{kappa}B activation is a critical regulator of human granulocyte apoptosis in vitro. J. Biol. Chem. 274: 4309-4318. [Abstract/Free Full Text]
  21. Bonner, S., S. R. Yan, D. M. Byers, R. Bortolussi. 2001. Activation of extracellular signal-related protein kinases 1 and 2 of the mitogen-activated protein kinase family by lipopolysaccharide requires plasma in neutrophils from adults and newborns. Infect. Immun. 69: 3143-3149. [Abstract/Free Full Text]
  22. Yan, S. R., W. Al-Hertani, D. Byers, R. Bortolussi. 2002. Lipopolysaccharide-binding protein- and CD14-dependent activation of mitogen-activated protein kinase p38 by lipopolysaccharide in human neutrophils is associated with priming of respiratory burst. Infect. Immun. 70: 4068-4074. [Abstract/Free Full Text]
  23. Yan, S. R., R. R. Joseph, K. Rosen, M. J. Reginato, A. Jackson, N. Allaire, J. S. Brugge, C. Jobin, A. W. Stadnyk. 2005. Activation of NF-{kappa}B following detachment delays apoptosis in intestinal epithelial cells. Oncogene 24: 6482-6491. [Medline]
  24. Reddy, S. A. G., Y.-F. Lin, H. J. Huang, A. K. Samanta, W. S. L. Liao. 2004. The IL-1 receptor accessory protein is essential for PI 3-kinase recruitment and activation. Biochem. Biophys. Res. Commun. 316: 1022-1028. [Medline]
  25. Sah, N. K., A. Munshi, J. F. Kurland, T. J. McDonnell, B. Su, R. E. Meyn. 2003. Translation inhibitors sensitize prostate cancer cells to apoptosis induced by tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) by activating c-Jun N-terminal kinase. J. Biol. Chem. 278: 20593-20602. [Abstract/Free Full Text]
  26. Tang, G., Y. Minemoto, B. Dibling, N. H. Purcell, Z. Li, M. Karin, A. Lin. 2001. Inhibition of JNK activation through NF-{kappa}B target genes. Nature 414: 313-317. [Medline]
  27. Jobin, C., C. A. Bradham, M. P. Russo, B. Juma, A. S. Narula, D. A. Brenner, R. B. Sartor. 1999. Curcumin blocks cytokine-mediated NF-{kappa}B activation and proinflammatory gene expression by inhibiting inhibitory factor I-{kappa}B kinase activity. J. Immunol. 163: 3474-3483. [Abstract/Free Full Text]
  28. Chen, Y.-R., T.-H. Tan. 1998. Inhibition of the c-Jun N-terminal kinase (JNK) signaling pathway by curcumin. Oncogene 17: 173-178. [Medline]
  29. Stadnyk, A. W., M.-W. Yeung, S. R. Yan. 2003. Human colon carcinoma cells constitutively express and release the type II IL-1 receptor, an IL-1 antagonist. Dig. Dis. Sci. 48: 1737-1744. [Medline]
  30. Youngman, K. R., P. L. Simon, G. A. West, F. Cominelli, D. Rachmilewitz, J. S. Klein, C. Fiocchi. 1993. Localization of intestinal interleukin 1 activity and protein and gene expression to lamina propria cells. Gastroenterology 104: 749-758. [Medline]
  31. Eckmann, L., H. C. Jung, C. Schüerer-Maly, A. Panja, E. Morzycka-Wroblewska, M. F. Kagnoff. 1993. Differential cytokine expression by human intestinal epithelial cell lines: regulated expression of interleukin 8. Gastroenterology 105: 1689-1697. [Medline]
  32. Jung, H. C., L. Eckmann, S.-K. Yang, A. Panja, J. Fierer, E. Morzycka-Wroblewska, M. F. Kagnoff. 1995. A distinct array of proinflammatory cytokines is expressed in human colon epithelial cells in response to bacterial invasion. J. Clin. Invest. 95: 55-65. [Medline]
  33. Grishin, A., J. Wang, D. Hackam, F. Qureshi, J. Upperman, R. Zamora, H. R. Ford. 2004. p38 MAP kinase mediated endotoxin-induce expression of cyclooxygenase-2 in enterocytes. Surgery 136: 329-335. [Medline]
  34. Liu, W., N. Reinmuth, O. Stoeltzing, A. A. Parikh, C. Tellez, S. Williams, Y. D. Jung, F. Fan, A. Takeda, M. Akagi, et al 2003. Cyclooxygenase-2 is up-regulated by interleukin-1beta in human colorectal cancer cells via multiple signaling pathways. Cancer Res. 63: 3632-3636. [Abstract/Free Full Text]
  35. Erdman, S. E., J. G. Fox, C. A. Dangler, D. Feldman, B. H. Horwitz. 2001. Cutting edge: typhlocolitis in NF-{kappa}B-deficient mice. J. Immunol. 166: 1443-1447. [Abstract/Free Full Text]
  36. Mazzucchelli, L., C. Hauser, K. Zgraggen, H. E. Wagner, M. W. Hess, J. A. Laissue, C. Mueller. 1996. Differential in situ expression of the genes encoding the chemokines MCP-1 and RANTES in human inflammatory bowel disease. J. Pathol. 178: 201-206. [Medline]
  37. Zirger, J. M., C. Barcia, C. Liu, M. Puntel, N. Mitchell, I. Campbell, M. Castro, P. R. Lowenstein. 2006. Rapid upregulation of interferon-regulated and chemokine mRNAs upon injection of 108 international units, but not lower doses, of adenoviral vectors into the brain. J. Virol. 80: 5655-5659. [Abstract/Free Full Text]
  38. Kim, M. O., H. S. Suh, C. F. Brosnan, S. C. Lee. 2004. Regulation of RANTES/CCL5 expression in human astrocytes by interleukin-1 and interferon-beta. J. Neurochem. 90: 297-308. [Medline]
  39. Oltmanns, U., R. Issa, M. B. Sukkar, M. John, K. F. Chung. 2003. Role of c-jun N-terminal kinase in the induced release of GM-CSF, RANTES and IL-8 from human airway smooth muscle cells. Br. J. Pharmacol. 139: 1228-1234. [Medline]
  40. Warhurst, A. C., S. J. Hopkins, G. Warhurst. 1998. Interferon {gamma} induces differential upregulation of {alpha} and beta chemokine secretion in colonic epithelial cell lines. Gut 42: 208-213. [Abstract/Free Full Text]
  41. Yang, S. K., L. Eckmann, A. Panja, M. F. Kagnoff. 1997. Differential and regulated expression of C-X-C, C-C, and C-chemokines by human colon epithelial cells. Gastroenterology 113: 1214-1223. [Medline]
  42. Joseph, R. R., E. E. Yazer, Y. Hanakawa, A. W. Stadnyk. 2005. Prostaglandins and activation of AC/cAMP delay onset of anoikis in IEC-18. Apoptosis 10: 1221-1233. [Medline]



This article has been cited by other articles:


Home page
BioinformaticsHome page
J. Saez-Rodriguez, A. Goldsipe, J. Muhlich, L. G. Alexopoulos, B. Millard, D. A. Lauffenburger, and P. K. Sorger
Flexible informatics for linking experimental data to mathematical models via DataRail
Bioinformatics, March 15, 2008; 24(6): 840 - 847.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
R. A. Johnston, J. P. Mizgerd, L. Flynt, L. J. Quinton, E. S. Williams, and S. A. Shore
Type I Interleukin-1 Receptor Is Required for Pulmonary Responses to Subacute Ozone Exposure in Mice
Am. J. Respir. Cell Mol. Biol., October 1, 2007; 37(4): 477 - 484.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. Hisatsune, E. Yamasaki, M. Nakayama, D. Shirasaka, H. Kurazono, Y. Katagata, H. Inoue, J. Han, J. Sap, K. Yahiro, et al.
Helicobacter pylori VacA Enhances Prostaglandin E2 Production through Induction of Cyclooxygenase 2 Expression via a p38 Mitogen-Activated Protein Kinase/Activating Transcription Factor 2 Cascade in AZ-521 Cells
Infect. Immun., September 1, 2007; 75(9): 4472 - 4481.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yan, S. R.
Right arrow Articles by Stadnyk, A. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yan, S. R.
Right arrow Articles by Stadnyk, A. W.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS