The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Altrich-VanLith, M. L.
Right arrow Articles by Engelhard, V. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Altrich-VanLith, M. L.
Right arrow Articles by Engelhard, V. H.
The Journal of Immunology, 2006, 177: 5440-5450.
Copyright © 2006 by The American Association of Immunologists, Inc.

Processing of a Class I-Restricted Epitope from Tyrosinase Requires Peptide N-Glycanase and the Cooperative Action of Endoplasmic Reticulum Aminopeptidase 1 and Cytosolic Proteases1

Michelle L. Altrich-VanLith2,*, Marina Ostankovitch*, Joy M. Polefrone{dagger}, Claudio A. Mosse3,*, Jeffrey Shabanowitz{dagger}, Donald F. Hunt{dagger},{ddagger} and Victor H. Engelhard4,*

* Carter Immunology Center and Department of Microbiology, {dagger} Department of Chemistry, and {ddagger} Department of Pathology, University of Virginia, Charlottesville, VA 22908


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Although multiple components of the class I MHC processing pathway have been elucidated, the participation of nonproteasomal cytosolic enzymes has been largely unexplored. In this study, we provide evidence for multiple cytosolic mechanisms in the generation of an HLA-A*0201-associated epitope from tyrosinase. This epitope is presented in two isoforms containing either Asn or Asp, depending on the structure of the tyrosinase precursor. We show that deamidation of Asn to Asp is dependent on glycosylation in the endoplasmic reticulum (ER), and subsequent deglycosylation by peptide-N-glycanase in the cytosol. Epitope precursors with N-terminal extensions undergo a similar process. This is linked to an inability of ER aminopeptidase 1 to efficiently remove N-terminal residues, necessitating processing by nonproteasomal peptidases in the cytosol. Our work demonstrates that processing of this tyrosinase epitope involves recycling between the ER and cytosol, and an obligatory interplay between enzymes involved in proteolysis and glycosylation/deglycosylation located in both compartments.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Multiple posttranslational modifications have been described that alter the repertoire of MHC class I peptides displayed by cells. One of these modifications involves the deamidation of Asn to Asp (1). The first epitope described to undergo this process encompassed residues 369–377 from tyrosinase (Tyr369),5 a melanocyte differentiation protein that is also a target for melanoma-reactive T cells. In melanoma cells expressing full-length tyrosinase, the deamidated (Asp-containing) form of this epitope is presented at high copy number by HLA-A*0201, whereas the Asn-containing form encoded directly by the gene is not detectable by either T cells or mass spectrometry (2, 3). Later, two additional epitopes from HIV-1 env (4) and hepatitis C E1 (5) proteins have been suggested to be deamidated, because T cells developed against cells expressing the endogenous sequences preferentially recognize synthetic peptides containing Asp in place of Asn. In addition, both Asn- and Asp-containing forms of an epitope derived from lymphocytic choriomeningitis virus (LCMV) GP1 are presented on cells infected with LCMV (6). In all four epitopes, the Asn residues in the original sequences are part of Asn-linked glycosylation sites, and it has been suggested that deamidated epitopes would arise following glycosylation in the endoplasmic reticulum (ER) and subsequent deglycosylation. A cytosolic enzyme, peptide-N-glycanase (PNGase), was recently shown to remove N-linked sugars from proteins or peptides during protein degradation (7, 8, 9). An obligatory step in this enzymatic reaction is hydrolysis, which converts Asn to Asp (10). Despite suggestive evidence (3, 5), there has not yet been a direct demonstration that a deamidated epitope is produced as a result of protein glycosylation and deglycosylation, nor has the involvement of PNGase in such a process been evaluated.

Because glycosylation occurs during translation of tyrosinase in the ER, the necessity of this process for deamidation of Tyr369 was examined by altering the site of protein expression. Consistent with the involvement of glycosylation in deamidation, we previously established that the minimal 9-mer peptide representing Tyr369 did not undergo deamidation when translated in the cytosol (3). However, cytosolic translation of a fragment encoding residues 144–378 of tyrosinase resulted in presentation of both the Asp (Tyr369(D)) and Asn (Tyr369(N)) forms of the epitope. We hypothesized that this large fragment was processed in the cytosol to give both minimal epitope and extended precursor peptides, both of which were transported by TAP. We further hypothesized that the additional length in the extended precursors prevented immediate binding to HLA-A*0201 after TAP transport, enabling the peptide to become glycosylated and to exit the ER into the cytosol for both deglycosylation and processing to the mature epitope. In the present paper, we have investigated these hypotheses directly.

In considering the hypothesis outlined above, it became of interest to understand which proteases were involved in the processing of Tyr369 epitope precursors. The proteasome has been shown to be responsible for proteolytic cleavage to generate the final C terminus of many epitopes (11, 12, 13), whereas tripeptidyl peptidase II (TPPII) has been shown to play a more limited role (14). However, the peptides that are generated by these proteases frequently contain one or more N-terminal residues beyond that of the mature epitope (11, 12, 13, 15, 16). Several aminopeptidases in the cytosol and the ER have been implicated in the removal of these N-terminal extensions. One aminopeptidase localized in the ER, ER aminopeptidase 1 (ERAP1), trims precursors to their final antigenic form in vitro, and exerts a strong influence on epitope generation in vivo (17, 18, 19, 20, 21). A second ER-localized aminopeptidase, ERAP2, is required for removal of some basic residues from some peptides (20, 21). Leucine aminopeptidase (LAP), a cytosolic aminopeptidase, can generate epitopes from precursors in vitro (13, 22), but knockout of LAP does not impact the level of SIINFEKL/H-2Kb complexes formed from a number of precursor peptides or full-length OVA (23). Bleomycin hydrolase (BH) and puromycin-sensitive aminopeptidase (PSA), which are also located in the cytosol, have also been shown to generate epitopes from precursors in in vitro degradation assays (24). However, no cytosolic aminopeptidase has been shown to be directly involved in the production of class I MHC-associated peptides in vivo. Furthermore, overexpression of TPPII, thimet oligopeptidase (TOP), LAP, BH, or PSA does not alter the presentation of two influenza nucleoprotein epitopes (25); thus, it is also consequently unclear whether cytosolic and ER-localized aminopeptidases cooperate in epitope generation. In the present paper, we have directly examined the proteolytic processes responsible for trimming of the Tyr369 epitope.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Plasmids

ICP47 (gift from N. Shastri, University of California, Berkeley, CA) was subcloned into pcDNA3.1/zeocin using the HindIII and EcoRI sites. Plasmids encoding cytosolic minigenes were generated by ligating overlapping oligonucleotides into pEGFP/Ub (gift from F. Levy, Ludwig Institute for Cancer Research, University of Lausanne, Epalinges, Switzerland) after digestion with BamHI and SacII. This plasmid links minigenes to an enhanced GFP (EGFP)-ubiquitin conjugate, and directs cleavage by an ubiquitin-specific protease and releases the minigene in the cytosol without necessitating the removal of an initiator methionine (26). Plasmids encoding minigenes targeted to the ER via the tyrosinase signal sequence were generated by ligating overlapping oligonucleotides into pEF6 (Invitrogen Life Technologies) after digestion with BamHI and KpnI. Full-length tyrosinase with a flag-tag at the C terminus, in p3XCMV (gift from R. Halaban, Yale University, New Haven, CT) has been previously described (27), and was used to generate a glycosylation-mutant tyrosinase, T373V (28). All plasmids were confirmed by sequencing.

Cell lines and transfectants

The human melanoma line DM331, which expresses HLA-A*0201 but not tyrosinase (29), was grown in RPMI 1640 supplemented with L-glutamine, HEPES, and 5% FBS/SerExtend (Irvine Scientific). DM331 was transfected with the above plasmid constructs using Fugene (Roche), and selected in medium containing 250 µg/ml zeocin (Invitrogen Life Technologies) (ICP47), 600 µg/ml G418 (Invitrogen Life Technologies) (cytosolic constructs, flag-tagged full-length tyrosinase, and T373V tyrosinase), or 10 µg/ml blasticidin (Invitrogen Life Technologies) (ER constructs and full-length tyrosinase). Clones expressing ICP47 were identified based on down-regulation of HLA-B and -C molecules detected with the B123.2 Ab. For some experiments, cells were transiently transfected. One day posttransfection, cells were trypsinized and evaluated for transfection efficiency by measuring the percentage of cells positive for EGFP and used as stimulators for T cells.

T cell activity

Tyr369(D)- and Tyr369(N)-specific T cells were generated as described previously (3) and restimulated weekly with peptide-pulsed splenocytes in RPMI 1640 supplemented with 10% FBS, 1x essential and nonessential amino acids, 10 U/ml IL-2, 15 mM HEPES, and 50 µM 2-ME (T cell medium). Presentation of Tyr369(N) and Tyr369(D) was evaluated either by intracellular cytokine staining (ICS) or ELISA. For ICS, T cells and stimulator cells were incubated at various ratios for 4 h in T cell medium containing 50 U/ml IL-2 and 10 µg/ml brefeldin A (BFA) (Sigma-Aldrich). Cells were stained with anti-CD8-PE (eBioscience), fixed and permeabilized with Cytofix/Cytoperm (BD Pharmingen), and stained with anti-IFN-{gamma}-allophycocyanin (eBioscience). Background IFN-{gamma} production was subtracted out using unstimulated parallel cultures. In some ICS assays, deamidation was quantified by as the ratio of the percentage of IFN-{gamma}+ Tyr369(D) T cells over the sum of the percentage of IFN-{gamma}+ Tyr369(D) and Tyr369(N) T cells. In these experiments, a T cell stimulator ratio was chosen such that the response was in the linear range. For ELISA, T cells and stimulator cells were incubated at various ratios for 18–24 h in T cell medium. IFN-{gamma} was measured following manufacturer’s protocol (eBiosciences).

Inhibition of epitope expression using chemical inhibitors

DM331 cells were incubated for 30 min in medium containing 10 µg/ml BFA, 50 µM Z-VAD FMK (Promega or R&D Systems), 50 µM Q-VD-OPh (R&D Systems), or 2.5 µl/ml DMSO (Sigma-Aldrich) and treated with acidic buffer to remove cell surface class I MHC molecules (30, 31). Cells were resuspended in medium containing the same inhibitors and incubated at 37°C for 5 h to allow re-expression of MHC molecules. Cells were fixed with 0.1% glutaraldehyde, and used as stimulators in an ELISA.

Inhibition of protease expression by small interfering RNA (siRNA) knockdown

DM331 cells expressing full-length tyrosinase or minigenes were transfected twice 4 h apart using Oligofectamine (Invitrogen Life Technologies) and siRNA oligonucleotides targeting human ERAP1 (AACGTAGTGATGGGACACCAT), TOP (AAAAGGUCACCCUCAAGUACC), TPPII (AAGUGGCGAUGUGAAUACUGC) (all from Dharmacon); LAP (CCCAGTCTTCTTGGAAATTCA and AAAGCTTAATTTGCCCATTAA), PSA (CTGGGAATGGTTAAACACAAA and CAGACCAATGGGTGAAGTTAA), or BH (CCAATGGGATATGCTTGTTAA and ATGCTTGTTAATATTGTTGAA) (all from Qiagen), or control nontargeting siRNA (Dharmacon). For experiments combining ERAP1 knockdown and TAP inhibition, Tyr369-encoding minigenes and siRNA were cotransfected by Nucleofection (Amaxa) using buffer V and program U-20. Blasticidin and zeocin were added after 24 h. All transfectants were used as stimulators in ELISA 3 or 4 days following transfection.

Real-time RT-PCR

RNA was extracted using TRIzol with glycogen pull-down (Invitrogen Life Technologies) from cells that had been transfected with siRNA oligonucleotides 3 days previously. Various concentrations of RNA were used in a real-time RT-PCR using the QuantiTect SYBR Green RT-PCR kit (Qiagen) and QuantiTect Primer Assays (Qiagen) for all five proteases and the housekeeping gene, GAPDH, on an ABI Prism 7000, following the manufacturer’s protocol. A ratio of GAPDH to protease mRNA was calculated by the formula 1/2DCt, where DCt is the difference in cycle count between GAPDH and the specific protease.

Immunoblotting

For tyrosinase immunoblotting, DM331 cells expressing flag-tagged full-length tyrosinase were incubated for 4 h in medium containing 1 µg/ml cycloheximide and either 50 µM Z-VAD FMK (Promega), 2 µM epoxomicin (Calbiochem), or both. For ERAP1 immunoblotting, DM331 cells transfected with siRNA oligonucleotides 4 days prior were used. Cells were lysed by repeated freeze-thaw in buffer containing protease inhibitors and centrifuged at 100,000 x g for 1 h at 4°C. For tyrosinase immunoblotting, half of each supernatant was digested with 1000 U of PNGase (New England Biolabs) according to the manufacturer’s recommendations. Boiled samples were separated on 10% SDS-PAGE gels, transferred to Immobilon-P membrane, and blocked in 5% nonfat milk in PBS with 0.05% Tween 20. Blots were probed overnight with Abs against flag (Sigma-Aldrich), ERAP1 (a gift from Dr. M. Tsujimoto, RIKEN, Wako, Japan), or calnexin (StressGen), washed, probed with HRP-conjugated secondary Abs, and developed according to the Amersham ECL protocol.

In vitro digestion with ERAP1

The 6+9N peptide HNALHIYMNGTMSQV (150 µM) and 3.5 µg/ml ERAP1 (gift from K. Rock and L. Stern, University of Massachusetts Medical School, Worcester, MA) were incubated in 50 mM Tris-HCl (pH 7.8) under argon to minimize oxidation. The reaction was terminated by adding 0.6% trifluoroacetic acid. Aliquots from each time point were loaded onto a reverse-phase C18 microcapillary HPLC column and gradient eluted at a flow rate of ~60 nl/min through a 2-µm diameter laser pulled electrospray orifice directly into a hybrid linear quadrupole ion trap Fourier transform mass spectrometer (FTMS) (Thermo Electron Corporation) adapted as in Ref. 32 . Collisional activated dissociation spectra ms were acquired in a data-dependent mode. First, a full-scan mass spectrum was obtained with the FTMS, followed by 10 ms spectra acquired in the linear trap of the top 10 most abundant mass spectrometry ions from the FTMS full scan spectrum (one microscan per spectra; precursor m/z, ±1.5 Da; 30% collision energy; 30-ms ion activation; no dynamic exclusion; repeat count of two). SEQUEST, version 27 (revision 11) (33), was used for automated peptide identification, searched through the BioWorks, version 3.2, interface. A simple peptide database corresponding to the sequence of the 15-mer was searched without enzyme restriction, with a differential modification of 16 Da for methionine oxidation. Peak areas and heights were calculated (2.5-ppm mass tolerance; 10,000 ion count minimum threshold; no smoothing) within the Bioworks 3.2 software, for manually validated peptides. Peak height values of oxidized and unoxidized forms of a peptide were summed and used to determine relative abundance in the sample set, because the relative values for height and area were equivalent under these analysis conditions.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Deamidation of Tyr369 is dependent on glycosylation and deglycosylation by PNGase

We previously established that two HLA-A*0201-restricted epitopes derived from the Tyr369 sequence were produced in vivo (2, 3). One of these, based on the genetically encoded sequence and containing an Asn at the third position, is designated Tyr369(N). The other contains an Asp at this position, and is designated Tyr369(D). The presentation of these epitopes on melanoma cells and tyrosinase transfectants was initially shown using mass spectrometry, and later using T cells specific for each epitope, analogous to those shown in Fig. 1A. As previously shown, cells expressing full-length tyrosinase presented substantial amounts of Tyr369(D), but no significant amount of Tyr369(N) (Fig. 1B). Conversely, cells transfected with a minigene encoding a cytosol-targeted minimal Tyr369(N) epitope presented only Tyr369(N) and not Tyr369(D). Thus, the location and structure of the precursor of the Tyr369 epitope determines whether it undergoes deamidation.


Figure 1
View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 1. T cells distinguish between Asn- and Asp-containing Tyr369 epitopes. DM331 cells were either pulsed with peptides (A) or transfected with either full-length tyrosinase or the cytosolic-targeted minimal epitope Tyr369(N) (B), and used as stimulators in an ICS assay with Tyr369(N)- (left panel) or Tyr369(D)- (right panel) specific T cells.

 
We previously hypothesized that the conversion of Asn to Asp in the Tyr369 epitope was due to glycosylation at Asn371 during biosynthesis, and subsequent deglycosylation by PNGase during protein degradation. This hydrolytic process results in deamidation of Asn to Asp (10). To directly examine the involvement of PNGase, we treated cells with Z-VAD FMK. This compound is a well-known inhibitor of caspases (34), but has recently been shown to block the activity of PNGase (35). We first established that Z-VAD FMK did block the deglycosylation of misfolded tyrosinase that accumulated in the cytosol after inhibition of proteasome activity with epoxomicin. Deglycosylation of 78-kDa full-length glycosylated tyrosinase by PNGase in vitro produces a band of 61 kDa (Fig. 2A), and a band at the same molecular mass was observed in cells treated with epoxomycin. Treatment of cells with Z-VAD-FMK and epoxomicin reduced the amount of this 61-kDa band by >80% (Fig. 2B). Treatment with Z-VAD FMK did not cause accumulation of either the 61-kDa tyrosinase species (Fig. 2) or other degradation intermediates (data not shown). This is consistent with what has been observed for other proteins (35), and demonstrates that glycosylated proteins are still degraded by the proteasome in treated cells.


Figure 2
View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 2. Accumulation of deglycosylated degradation intermediates is blocked by Z-VAD-FMK. A, DM331 melanoma cells expressing flag-tagged full-length tyrosinase were incubated in medium containing Z-VAD-FMK, the proteasome inhibitor epoxomicin, or both. After 4 h, cells were lysed, and one-half of the supernatant was digested with PNGase in vitro. Samples were analyzed by SDS-PAGE and immunoblotted with anti-flag Ab. The broad bands centered at ~78 kDa represent glycosylated forms of tyrosinase. The bands at ~61 kDa represent proteasome-sensitive deglycosylated tyrosinase. B, Expression of 61-kDa bands representing deglycosylated tyrosinase, normalized to that of tubulin, determined after stripping and rehybridizing with anti-tubulin Ab. Values are obtained by scanning densitometry of the bands in lanes 1 (medium), 3 (epoxo), 5 (z-vad-fmk +epoxo), and 7 (z-vad-fmk) of the blot shown in A.

 
To evaluate the requirement for PNGase in the expression of Tyr369(D), DM331 melanoma cells expressing full-length tyrosinase were briefly exposed to acidic buffer to denature cell surface class I MHC molecules and then incubated for 5 h in medium alone, to allow re-expression of class I molecules, or in medium containing Z-VAD FMK; Q-VD-OPh, an unrelated caspase inhibitor that does not block PNGase (35); or BFA, which blocks egress of newly formed class I molecules to the cell surface. These cells were then evaluated for presentation of the deamidated and nondeamidated epitopes to specific T cells. Presentation of Tyr369(D) by cells expressing full-length tyrosinase was substantially inhibited by incubation with Z-VAD FMK, whereas incubation with Q-VD-OPh had no effect (Fig. 3A, left panel). Thus, this inhibition was not due to the anti-caspase activity of Z-VAD FMK. However, Z-VAD FMK did not inhibit the presentation of Tyr369(N) in cells expressing the minigene encoding this epitope in the cytosol (Fig. 3A, right panel), demonstrating that it did not interfere with other elements of the MHC class I processing and presentation pathway. These results indicate that deglycosylation of Asn371 in the Tyr369 epitope that originates from full-length tyrosinase is responsible for its deamidation to Asp.


Figure 3
View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 3. Deamidation of Tyr369 occurs through glycosylation-dependent and -independent pathways. A, DM331 cells expressing full-length tyrosinase (left panel) or the cytosolic-targeted minimal epitope Tyr369(N) (right panel) were exposed to acidic buffer to denature cell surface class I MHC molecules, and then incubated in medium containing Z-VAD-MK, Q-VD-OPh, DMSO, or BFA. These cells were evaluated for epitope expression by incubation with Tyr369(N)- ({square}) or Tyr369(D)- ({blacksquare}) specific T cells, and quantitation of IFN-{gamma} release by ELISA. B, DM331 cells transfected with either full-length tyrosinase or T373V tyrosinase were evaluated for epitope expression by incubation with Tyr369(N)- (left panel) or Tyr369(D)- (right panel) specific T cells, and quantitation of IFN-{gamma}+ cells by ICS. C, Similar to A except cells were transfected with T373V tyrosinase and evaluated for expression of Tyr369(D). nd, Not detected.

 
To further confirm that glycosylation was a prerequisite to deamidation, we mutated the glycosylation consensus sequence of Asn371 by replacing Thr373 with a Val (T373V) (36). Synthetic peptides representing these Val-substituted epitopes bind to HLA-A*0201 with similar affinity compared with their Thr-containing counterparts (our unpublished data). Tyr369(D)-specific T cells recognized DM331 cells pulsed with the YMDGVMSQV peptide comparably to cells pulsed with the parental Tyr369(D) epitope, and showed no discernable reactivity on either peptide containing Asn371 (Fig. 1A). Likewise, Tyr369(N)-specific T cells specifically recognized DM331 cells pulsed with the YMNGVMSQV peptide, although slightly less well than they recognized cells pulsed with Tyr369(N). DM331 cells expressing T373V tyrosinase efficiently stimulated Tyr369(N)-specific T cells (Fig. 3B, right panel), demonstrating that the absence of glycosylation of Asn371 enabled presentation of an unmodified Tyr369 epitope from full-length tyrosinase. Surprisingly however, T373V transfectants also stimulated Tyr369(D)-specific T cells (Fig. 3B, left panel). This presentation was insensitive to inhibition of PNGase with Z-VAD FMK (Fig. 3C), demonstrating that it was not a result of residual glycosylation. Using mass spectrometry, we have also directly established that cells transfected with T373V tyrosinase express both YMNGVMSQV and YMDGVMSQV peptides (data not shown). Collectively, these results suggest the existence of a second pathway for deamidation of this Asn371 that is independent of glycosylation.

N-terminal extended Tyr369 epitope precursors in the cytosol undergo deglycosylation-dependent deamidation

We previously demonstrated that cells expressing a fragment comprising residues 144–378 of tyrosinase in the cytosol presented both Tyr369(D) and Tyr369(N) epitopes (3), suggesting that longer epitope precursors enabled deamidation to occur. To gain insight into the mechanism responsible, we generated minigenes encoding Tyr369 epitope precursors linked to the C-terminal end of an EGFP-ubiquitin fusion protein. These fusion proteins are rapidly and quantitatively cleaved following the ubiquitin residue by a ubiquitin-specific protease, releasing the epitope precursors into the cytosol (26). Constructs were generated that encoded precursors with extensions of either three or five N-terminal residues (3+9N and 5+9N), three or five C-terminal residues (9N+3 and 9N+5), or five residues on both ends of the mature epitope (5+9N+5). All extensions were taken from the tyrosinase sequence flanking the epitope (Table I). Expression plasmids encoding the fusion proteins were transfected into DM331, and cells expressing equivalent levels of EGFP were evaluated for epitope presentation with Tyr369(D)- and Tyr369(N)-specific T cells. Relative to cells expressing the minimal 9-mer construct (9N), cells expressing precursors with C-terminal extensions (9N+3, 9N+5, and 5+9N+5) presented Tyr369(N) very poorly, and did not present Tyr369(D) at any detectable level (Fig. 4A). These low levels of presentation may be due either to an inability of these short substrates to be processed by the proteasome or, alternatively, to inappropriate proteasomal cleavage resulting in epitope destruction. In contrast, cells expressing precursors with N-terminal extensions (3+9N and 5+9N) presented Tyr369(N) similarly to cells expressing the minimal 9N construct (Fig. 4A). Most importantly, cells expressing either the 3+9N or 5+9N constructs were recognized at a significant level by Tyr369(D)-specific T cells, whereas recognition of cells expressing 9N construct was minimal. This demonstrates that deamidation of Tyr369 derived from precursors synthesized in the cytosol is dependent on extending their N-terminal ends relative to that of the mature epitope.


View this table:
[in this window]
[in a new window]
  		Table I. Sequences of epitopes and epitope precursors

 

Figure 4
View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 4. N-terminal extended precursors synthesized in the cytosol enable deamidation through a PNGase-dependent pathway. A, DM331 cells transfected to express cytosolic-targeted epitopes or epitope precursors were evaluated for epitope expression by incubation with Tyr369(N)- (left panel) or Tyr369(D)- (right panel) specific T cells, and quantitation of IFN-{gamma}+ cells by ICS. B, DM331 cells expressing the 5+9N epitope precursor were exposed to acidic buffer to denature cell surface class I MHC molecules, and then incubated in medium containing Z-VAD-MK, Q-VD-OPh, DMSO, or BFA. These cells were then evaluated for epitope expression by incubation with Tyr369(N)- ({square}) or Tyr369(D)- ({blacksquare}) specific T cells, and quantitation of IFN-{gamma} release by ELISA. C, Deamidation was quantified as described in Materials and Methods. nd, Not detected.

 
Because of the glycosylation dependent and independent pathways defined above, it was important to determine which pathway was responsible for deamidation of these small epitope precursors. Z-VAD FMK, but not the general caspase inhibitor Q-VD-OPh, blocked presentation of Tyr369(D) by cells transfected with 5+9N (Fig. 4B, {blacksquare}). However, Z-VAD FMK did not block presentation of Tyr369(N) in the same cells (Fig. 4B, {square}). This indicates deamidation of Tyr369 from this cytosolic precursor is dependent on deglycosylation by PNGase, similar to that seen with wild-type full-length tyrosinase. This in turn suggests that these precursors enter the ER to become glycosylated, are then retrotranslocated into the cytosol for deglycosylation, and are transported into the ER a second time for binding to HLA-A*0201.

We evaluated the relative efficiency of deamidation of different epitope forms by calculating the ratio of Tyr369(D)-specific T cell reactivity to the sum of Tyr369(D)-specific and Tyr369(N)-specific T cell reactivities. This measurement can be affected by variation in T cell activity and transfection efficiency in different experiments, and its relationship to the number of relevant peptide-MHC complexes is more likely to be logarithmic than linear. Nonetheless, it provides a semiquantitative determination of the extent of deamidation, and consistent results were obtained in four independent experiments. These data showed that the relative efficiency of deamidation was similar for the 3+9N and 5+9N constructs (Fig. 4C). However, the efficiency of deamidation of either construct was substantially less than that of full-length tyrosinase.

The efficiency of Tyr369 deamidation is independent of the site of translation

The inefficiency of deamidation of cytosolic Tyr369 precursors relative to full-length tyrosinase in the ER suggested that deamidation was linked to the site of translation. Therefore, we generated minigenes encoding either the minimal epitope (ER9N) or N-terminal extended precursors (ER1+9N, ER2+9N, ER6+9N) linked to the signal sequence of tyrosinase, allowing for translation into the lumen of the ER and release of the precursor by signal peptidase. Cells expressing all of these constructs were recognized by Tyr369(N)-specific T cells comparably to one another and to cells transfected with the cytosol-directed 5+9N construct (Fig. 5A). As was seen above with the cytosolic constructs, cells expressing N-terminal extended constructs in the ER were recognized at an elevated level by Tyr369(D)-specific T cells, indicating that a fraction of these molecules had undergone deamidation. In addition, Z-VAD FMK treatment blocked presentation of Tyr369(D) in cells expressing the ER6+9N construct (Fig. 5B). This indicates deamidation of Tyr369 from ER-targeted precursors is dependent on deglycosylation by PNGase. However, the relative efficiency of deamidation of ER-targeted precursors was similar to that seen for the N-terminal extended cytosolic precursors, and still substantially less than that seen for full-length tyrosinase (Fig. 5C). Thus, translation in the ER per se is not sufficient to improve the efficiency of deamidation, suggesting that structural differences between these small epitope precursors and full-length tyrosinase exert a strong influence.


Figure 5
View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 5. N-terminal extended epitope precursors synthesized in the ER enable deamidation through a PNGase-dependent pathway. A, DM331 cells expressing ER-targeted epitopes or epitope precursors were evaluated for epitope expression by incubation with Tyr369(N)- (left panel) or Tyr369(D)- (right panel) specific T cells, and quantitation of IFN-{gamma}+ cells by ICS. B, DM331 cells expressing the ER6+9N epitope precursor were exposed to acidic buffer to denature cell surface class I MHC molecules, and then incubated in medium containing Z-VAD-MK, Q-VD-OPh, DMSO, or BFA. These cells were then evaluated for epitope expression by incubation with Tyr369(N)- ({square}) or Tyr369(D)- ({blacksquare}) specific T cells, and quantitation of IFN-{gamma} release by ELISA. C, Deamidation was quantified as described in Materials and Methods. nd, Not detected.

 
Proteases in both ER and cytosol are differentially involved in the generation of Tyr369(N)

Although the results above established that extended Tyr369 epitope precursors underwent glycosylation-dependent deamidation, they did not directly address how the N-terminal extensions enabled this process. We originally suggested that this additional length prevented immediate binding to HLA-A*0201 after TAP transport, enabling the peptide to exit the ER into the cytosol for both deglycosylation and processing to the mature epitope (3). However, the recent identification of ERAP1 and ERAP2 as important mediators of N-terminal trimming in the ER cast doubt on this model. In addition, it is generally believed that glycosylated peptides exit the ER poorly, a fact that has been used in the design of assays for TAP transport. To gain further insight into these issues, we examined the ability of Tyr369 epitope precursors to be processed in the ER alone. Minigenes encoding cytosol- or ER-targeted epitopes or precursors were transfected into DM331 cells that had been stably transfected to express ICP47, a herpes simplex viral protein that blocks TAP transport into the ER and the cells were evaluated for epitope presentation with Tyr369(N)-specific T cells. As expected, epitope presentation from the cytosol-localized 5+9N precursor was strongly inhibited by cotransfection of ICP47, reflecting TAP-dependent transport (Fig. 6A), whereas Tyr369(N) presentation in cells transfected to express the minimal 9N construct in the ER was insensitive to ICP47 (Fig. 6B). Presentation of Tyr369(D) from ER-targeted precursors with N-terminal extensions was inhibited by ICP47 regardless of the length of the extension (Fig. 6B), consistent with the idea that generation of this deamidated epitope depends on translocation from ER to cytosol for PNGase-mediated deamidation. Interestingly, however, the effect of ICP47 on presentation of the nondeamidated Tyr369(N) epitope from ER-targeted precursors was length dependent (Fig. 6A). ICP47 had little impact on epitope presentation from a precursor with a single residue N-terminal extension. However, TAP inhibition by ICP47 significantly diminished the presentation of Tyr369(N) from precursors with two and six residue extensions. This indicates that aminopeptidases in the ER are sufficient to trim short Tyr369 precursors to their final length. However, efficient presentation from longer precursors depends, at least in part, on proteases localized in the cytosol.


Figure 6
View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 6. Expression of Tyr369(N) and Tyr369(D) from ER-targeted precursors with two or more N-terminal residues requires cytosolic processing. DM331 cells were transfected with minigenes encoding cytosolic- or ER-targeted Tyr369 epitopes or epitope precursors alone or in combination with the gene encoding ICP47. Transfectants were evaluated for epitope expression by incubation with Tyr369(N)-specific T cells (A, left panel) or Tyr369(D)-specific T cells (B), and quantitation of IFN-{gamma}+ cells by ICS (A, right panel). The percentage of inhibition was quantified as follows: 1 – ((% T cells activated by ICP47-expressing stimulators/% T cells activated by stimulators not expressing ICP47) x 100).

 
The ER aminopeptidase ERAP1 is involved in the generation of Tyr369 epitopes

The ER aminopeptidase, ERAP1, has been shown to influence the presentation of a large fraction of class I MHC-associated peptide epitopes (17). To evaluate the importance of ERAP1 in the production of Tyr369(N), DM331 cells expressing cytosolic- or ER-targeted constructs were transfected with siRNA oligonucleotides for either ERAP1 or a nontargeting control, and cells were analyzed for presentation of Tyr369(N) 3–4 days later. Knockdown of ERAP1, which was confirmed by Western blot (Fig. 7A), increased the presentation of Tyr369(N) in cells transfected to express the cytosolic-targeted minimal construct (9N) (Fig. 7, B and C). This is consistent with the demonstration that ERAP1 degrades Tyr369(N) in vitro (17). Conversely, ERAP1 knockdown decreased the presentation of Tyr369(N) from the cytosolic- and ER-targeted precursors containing five or six N-terminal amino acids (Fig. 7, B and C). Additionally, ERAP1 knockdown inhibited presentation of Tyr369(D) in cells expressing full-length tyrosinase. These results, taken with the ICP47 blockade data of Fig. 6, suggest that both cytosolic proteases and ERAP1 are involved in the generation of Tyr369 epitopes from precursors containing five to six residue extensions, and that such precursors are produced from full-length tyrosinase.


Figure 7
View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 7. ERAP1 destroys or generates Tyr369 from epitopes or epitope precursors depending on subcellular localization and precursor length. A, DM331 cells were transfected with control or ERAP1 siRNA oligonucleotides, and analyzed for expression of ERAP1 and calnexin 3 days later. Cell extracts were fractionated by SDS-PAGE and immunoblotted with anti-ERAP1 Ab. The blot was then stripped and rehybridized with anti-calnexin Ab. The numbers below each lane are the magnitude of the ERAP1 band expressed as a percentage of the Calnexin band, as determined by scanning densitometry. B, DM331 cells expressing tyrosinase, cytosolic- or ER-targeted epitopes, or epitope precursors were transfected with either ERAP1 ({blacksquare}) or control ({square}) siRNAs. Transfectants were analyzed for expression of Tyr369(N) (epitope and epitope precursors) or Tyr369(D) (tyrosinase) by incubation with appropriate T cells and measurement of IFN-{gamma} release by ELISA. DM331 (C and D) or DM331.ICP47 (D) cells expressing cytosolic- or ER-targeted epitopes or epitope precursors and ERAP1 siRNA or control siRNA were analyzed for expression of Tyr369(N) ({square}) or Tyr369(D) ({blacksquare}). Epitope expression in cells transfected with ERAP1 siRNA was compared with that in cells expressing control siRNA and percentage change was calculated as follows: % change = ((ERAP1 siRNA – control siRNA)/control siRNA) x 100. Values shown are the means of data obtained in four to eight independent experiments.

 
In contrast to these longer precursors, the presentation of Tyr369(N) from ER-target precursors with shorter N-terminal extensions (ER1+9N and ER2+9N) was relatively insensitive to ERAP1 knockdown (Fig. 7, B and C). This suggested that trimming of these precursors was mediated either by another ER-resident protease, such as ERAP2, or a protease in the cytosol. To determine whether another ER-resident protease was responsible for trimming of these precursors, ERAP1 and TAP were blocked simultaneously. DM331 cells stably expressing ICP47 were cotransfected with siRNA (ERAP1 or control) and minigenes encoding ER1+9N or ER2+9N, and Tyr369(N) presentation was evaluated 3 and 4 days later. Although presentation of this epitope was insensitive to ERAP1 blockade in cells with normal TAP activity, it was strongly inhibited by ERAP1 blockade in cells with diminished TAP activity (Fig. 7D). This indicates that when Tyr369 epitope precursors with one and two residue extensions are confined to the ER, ERAP1 plays a central role in their processing. However, when ERAP1 activity is blocked, these precursors are efficiently processed in the cytosol.

The observation that epitope presentation from Tyr369 precursors with two and six residue extensions was TAP dependent suggested that cytosolic proteases were compensating for a deficiency in the trimming of these longer peptides by ERAP1. To evaluate this hypothesis, recombinant human ERAP1 was incubated in vitro with a 15-mer synthetic peptide corresponding to the ER6+9N precursor, and the degradation products were analyzed by mass spectrometry. Under the conditions used, ERAP1 degraded ~90% of this 15-mer within a period of 10 min (Fig. 8). The 14-mer, 13-mer, and 12-mer degradation products became evident as the 15-mer was degraded, but were always detected at relatively low levels. In contrast, the 11-mer accumulated substantially within 5 min and remained present at significant levels for at least 30 min. The 10-mer also accumulated to a significant extent early, but then declined coincident with the appearance of the mature 9-mer epitope. These results suggest a model in which epitope production is limited by inefficient trimming of the 11-mer peptide by ERAP1, which is compensated for by retrotranslocation and trimming in the cytosol.


Figure 8
View larger version (10K):
[in this window]
[in a new window]
  		FIGURE 8. In vitro degradation of 6+9N peptide by ERAP1 results in differential accumulation of the 2+9N precursor, but does generates Tyr369(N). HNALYMNGTMSQV and ERAP1 were incubated for various times and the degradation products were identified and quantitated by mass spectrometry.

 
Multiple cytosolic proteases (PSA, BH, TOP, LAP, and TPPII) have been implicated in the generation of MHC epitopes in vitro (37). To evaluate the in vivo relevance of their activity to the generation of Tyr369(N), cells expressing the ER6+9N precursor or full-length tyrosinase were transfected with siRNA oligonucleotides for either TOP, TPPII, LAP, PSA, BH, or a nontargeting control, and cells were analyzed for presentation of Tyr369(N) or Tyr369(D) 4 days later. Knockdown of mRNA was confirmed with real-time RT-PCR (Fig. 9A). Knockdown of TOP, TPPI, or BH did not affect the presentation of Tyr369(N) compared with control siRNA (Fig. 9B), indicating that these proteases are not involved in the generation of Tyr369(N) form ER6+9N. In contrast, knockdown of either PSA or LAP increased the presentation of Tyr369(N) from ER6+9N. This suggests that, rather than generate Tyr369(N), these proteases actually destroy the epitope. Knockdown of LAP and PSA also leads to an increase in Tyr369(D) from full-length tyrosinase (Fig. 9C). However, in contrast to what was seen with ER6+9N, knockdown of TOP and TPPII also led to an increase in presentation of Tyr369(D) from full-length tyrosinase (Fig. 9C). These results demonstrate these proteases in the cytosol destroy Tyr369 epitopes or epitope precursors before they are transported by TAP for HLA-A*0201 binding. Thus, the cytosolic protease necessary for the production of Tyr369(N) from ER6+9N remains unidentified.


Figure 9
View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 9. Nonproteasomal cytosolic proteases destroy Tyr369 from ER6+9N and full-length tyrosinase. A, Cells were transfected with either TPPII, TOP, BH, LAP, PSA ({blacksquare}), or control ({square}) siRNA oligonucleotides, and expression of the indicated protease mRNAs was quantitated as described in Materials and Methods. y-axis values represent the level of expression of the indicated protease mRNA normalized to the level of GAPDH mRNA in the same sample. B, DM331 cells expressing ER6+9N were transfected with siRNA oligonucleotides targeting TPPII, TOP, BH, LAP, PSA, or control siRNA were analyzed for expression of Tyr369(N) by ICS. Data points represent the mean of three experiments ± SEM. C, DM331 cells expressing full-length tyrosinase were transfected with siRNA oligonucleotides targeting TPPII, TOP, BH, LAP, PSA, or control siRNA were analyzed for expression of Tyr369(D) by ICS. Data points represent the mean of three experiments ± SEM.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
In this paper, we have explored the requirements for generation of a deamidated form of the Tyr369 epitope presented by HLA-A*0201. Previous data from our lab led to the hypothesis that this epitope was dependent on glycosylation of Asn371, retrotranslocation of full-length tyrosinase into the cytosol for proteolysis and deglycosylation, and finally TAP-dependent reentry into the ER for MHC binding (2, 3). Subsequent studies have suggested the existence of deamidated epitopes from other proteins and proposed similar pathways (4, 5, 38). However, direct evidence of either deamidation or a responsible mechanism has been sparse (5, 6). Here, we provide the first direct demonstration that deamidation of Tyr369 is a result of deglycosylation of Asn371 in the cytosol by PNGase. PNGase has been established to mediate the deglycosylation of several misfolded membrane proteins in concert with their degradation by the proteasome after retrotranslocation into the cytosol. Our results further link this pathway of glycoprotein degradation to epitope generation.

Given the above mechanism, a surprising result was that elimination of the glycosylation consensus sequence in the Tyr369 epitope did not completely eliminate deamidation. This suggests that a second pathway exists for deamidation. No enzymatic pathway for the deamidation of unglycosylated Asn has been described in mammals. However, spontaneous deamidation of Asn residues in aged or damaged proteins is common (39). It has also been demonstrated that spontaneous deamidation is influenced by proximal residues, and a Gly residue to the C-terminal side of the target Asn promotes this process (40). Thus, we propose that the deamidated Tyr369 epitope that arises independent of glycosylation is due to a spontaneous deamidation process. A corollary of this hypothesis is that spontaneously deamidated Asn residues should be represented in class I MHC-associated epitopes derived from a variety of proteins. Although such epitopes have not yet been described in the literature, a more systematic investigation of this hypothesis is clearly warranted. Because spontaneous deamidation is not expected to be complete, it has the potential to yield greater epitope diversity through the generation of both Asn- and Asp-containing forms of the same peptide. In this context, cells infected with LCMV present both deamidated and Asn-containing forms of a GP1-derived epitope (6). Although the presence of the Asn form indicates that the full-length protein is not efficiently glycosylated, it is not clear whether the deamidated form arises from deglycosylation or spontaneous deamidation. Conversely, it is also important to reiterate that, based on the absence of Tyr369(N), the requirement for PNGase, and the obligatory conversion of Asn to Asp during PNGase mediated deglycosylation, our evidence does not support a role for spontaneous deamidation in the generation of Tyr369(D) from normally glycosylated tyrosinase.

Our work has also established that PNGase-dependent deglycosylation to generate Tyr369(D) occurs on short epitope precursors that contain N-terminal extensions, but not on the minimal 9-mer epitope. Furthermore, the extent of deamidation is not enhanced by longer N-terminal extensions. The exact mechanism by which N-terminal extensions enable deamidation is not certain. Such precursors have a greatly diminished ability to bind to the HLA-A*0201, and will be susceptible to trimming in either ER or cytosol, glycosylation, and retrotranslocation. However, we have shown that the efficiency of trimming in the ER is clearly dependent on the length of the precursor, suggesting that this does not determine the extent of deamidation. Interestingly, glycosylation has been shown to interfere with the processing of influenza NP epitope precursors in the ER (41). Therefore, an attractive model for the processing of tyrosinase is one in which epitope precursors of different lengths are glycosylated to a similar extent, preventing their trimming and rendering the differences in their length irrelevant. This in turn renders them susceptible to retro-translocation into the cytosol for deamidation. In the context of this model, it has previously been shown that glycosylated Tyr369(N) binds to HLA-A*0201 in vivo (42). Thus, the failure of the minimal 9-mer epitope to undergo deamidation is a consequence of its immediate binding to HLA-A*0201, independent of its glycosylation state, which prevents retrotranslocation and subsequent deglycosylation by PNGase.

Whereas cells expressing full-length tyrosinase present only Tyr369(D) (2, 3), cells expressing minigenes encoding epitope precursors in either the ER or cytosol presented substantial and similar levels of Tyr369(N). This suggests that glycosylation, albeit inefficient, occurs primarily on small peptides located in the lumen of the ER after release from the translation apparatus or after TAP transport. This may be due to the short length of the peptides such that they are cleaved from the signal sequence before the glycosylation machinery recognizes the glycosylation consensus motif. The inefficient deamidation of these short precursors compared with full-length proteins is a significant result to consider in the design of vaccines based on epitopes with the potential to undergo glycosylation and/or deamidation. In a similar vein, glycosylation-dependent deamidation of short precursors after TAP transport may alter the repertoire of epitopes generated from cytosolic proteins that contain cryptic glycosylation consensus sequences.

In this paper, we have also examined the involvement of proteases localized in the ER and the cytosol in the generation of Tyr369 epitopes. The ER-localized aminopeptidase ERAP1 has been established to play an important role in N-terminal trimming of precursors for multiple epitopes (17, 18, 19). This has led to a general model of class I MHC peptide processing that involves generation of the C terminus by the proteasome in the cytosol, followed by TAP-mediated entry into the ER and ERAP1-mediated trimming (43). Here, we show that generation of Tyr369(N) and Tyr369(D) from small precursors or full-length tyrosinase is ERAP1 dependent. However, ERAP1 also diminished presentation of Tyr369(N) in cells expressing a minigene encoding the mature epitope, demonstrating that it can also destroy this epitope in vivo. Finally, we have demonstrated that the action of ERAP1 is dependent on the structure of the Tyr369 precursor, and the enzyme inefficiently removes the His at the –2 position. It is possible that this is due to the weakly basic nature of His, because it has been shown that ERAP1 inefficiently removes some other basic residues (21).

In keeping with this inefficient action of ERAP1, our results also establish that presentation of Tyr369(N) from ER-targeted precursors containing two or six N-terminal residues requires processing in the cytosol. Previous studies have suggested that several distinct cytosolically localized peptidases mediate N-terminal trimming of precursors to generate epitopes in vitro (13, 22, 24), although the in vivo relevance of cytosolic peptidases in the N-terminal trimming of epitope precursors has not previously been established. Here, we have shown that none of these previously identified proteases are involved in the generation of Tyr369 from ER-targeted precursors containing six N-terminal residues or from full-length tyrosinase. This is in agreement with the recent observation that knockout mice lacking leucine aminopeptidase do not show any significant alteration in the MHC class I processing pathway (23). Thus, the cytosolic peptidase responsible for the N-terminal trimming of these Tyr369(N) epitope precursors remains unclear.

Collectively, these data lead to a model in which precursors longer than 10 residues and localized in the ER are trimmed by ERAP1, and then retrotranslocated to the cytosol for removal of the His at the –2 position, and retransported back into the ER by TAP. It has been shown elsewhere that TAP transports the 10-mer precursor of Tyr369 much more efficiently than the mature 9-mer epitope (44). Thus, ERAP1 may act a second time on the products of cytosolic trimming. In the context of a cell expressing full-length tyrosinase, this model would also apply for any precursors longer than 10 residues that are transported by TAP after generation by the proteasome in the cytosol. This model is in keeping with a previous demonstration of the recycling of longer peptides from ER to cytosol (45), but differs in that recycling is necessary for epitope generation. It also differs from another model in which a deficiency in ERAP1 activity was compensated by the activity of ERAP2 (21). Whether this is due to a deficiency in ERAP2 expression by DM331 cells, or an inactivity of ERAP2 toward this precursor, is currently unclear.

In sum, we have provided new insights into mechanisms that generate the HLA-A*0201-associated epitope Tyr369, and that are likely to apply to a broad range of epitopes. These mechanisms involve enzymatic activities in the cytosol that provide essential roles in the generation of class I MHC-associated epitopes. As such, they should be properly considered elements of the class I MHC processing and presentation pathway.


   Acknowledgments
 
We thank Dr. Kenneth Rock for his generous gift of purified ERAP1.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by U.S. Public Health Service Grants AI20963 (to V.H.E.) and AI33993 (to D.F.H.). M.L.A.-V. was supported by American Cancer Society Grant PF-03-128-01-LIB. Back

2 Current address: IBT Reference Laboratory, 11274 Renner Boulevard, Lenexa, KS 66219. Back

3 Current address: Department of Pathology, Vanderbilt University, Nashville, TN 37212. Back

4 Address correspondence and reprint requests to Dr. Victor H. Engelhard, Carter Immunology Center, University of Virginia, Box 801386, Charlottesville, VA 22908-1386. E-mail address: vhe{at}virginia.edu Back

5 Abbreviations used in this paper: Tyr369, tyrosinase 369–377; LCMV, lymphocytic choriomeningitis virus; ER, endoplasmic reticulum; PNGase, peptide-N-glycanase; TPPII, tripeptidyl peptidase II; ERAP, ER aminopeptidase; LAP, leucine aminopeptidase; PSA, puromycin-sensitive aminopeptidase; BH, bleomycin hydrolase; TOP, thimet oligopeptidase; EGFP, enhanced GFP; ICS, intracellular cytokine staining; BFA, brefeldin A; siRNA, small interfering RNA; FTMS, Fourier transform mass spectrometer. Back

Received for publication April 24, 2006. Accepted for publication July 31, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Engelhard, V. H., A. G. Brickner, A. L. Zarling. 2002. Insights into antigen processing gained by direct analysis of the naturally processed class I MHC associated peptide repertoire. Mol. Immunol. 39: 127-137. [Medline]
  2. Skipper, J. C. A., R. C. Hendrickson, P. H. Gulden, V. Brichard, A. Van Pel, Y. Chen, J. Shabanowitz, T. Wolfel, C. L. Slingluff, T. Boon, et al 1996. An HLA-A2 restricted tyrosinase antigen on melanoma cells results from post-translational modification and suggests a novel processing pathway for membrane proteins. J. Exp. Med. 183: 527-534. [Abstract/Free Full Text]
  3. Mosse, C. A., L. Meadows, C. J. Luckey, D. J. Kittlesen, E. L. Huczko, C. L. Slingluff, Jr, J. Shabanowitz, D. F. Hunt, V. H. Engelhard. 1998. The class I antigen processing pathway for the membrane protein tyrosinase involves translation in the endoplasmic reticulum and processing in the cytosol. J. Exp. Med. 187: 37-48. [Abstract/Free Full Text]
  4. Ferris, R. L., C. Hall, N. V. Sipsas, J. T. Safrit, A. Trocha, R. A. Koup, R. P. Johnson, R. F. Siliciano. 1999. Processing of HIV-1 envelope glycoprotein for class I-restricted recognition: dependence on TAP1/2 and mechanisms for cytosolic localization. J. Immunol. 162: 1324-1332. [Abstract/Free Full Text]
  5. Selby, M., A. Erickson, C. Dong, S. Cooper, P. Parham, M. Houghton, C. M. Walker. 1999. Hepatitis C virus envelope glycoprotein E1 originates in the endoplasmic reticulum and requires cytoplasmic processing for presentation by class I MHC molecules. J. Immunol. 162: 669-676. [Abstract/Free Full Text]
  6. Hudrisier, D., J. Riond, H. Mazarguil, M. B. Oldstone, J. E. Gairin. 1999. Genetically encoded and post-translationally modified forms of a major histocompatibility complex class I-restricted antigen bearing a glycosylation motif are independently processed and co-presented to cytotoxic T lymphocytes. J. Biol. Chem. 274: 36274-36280. [Abstract/Free Full Text]
  7. Hirsch, C., D. Blom, H. L. Ploegh. 2003. A role for N-glycanase in the cytosolic turnover of glycoproteins. EMBO J. 22: 1036-1046. [Medline]
  8. Joshi, S., S. Katiyar, W. J. Lennarz. 2005. Misfolding of glycoproteins is a prerequisite for peptide: N-glycanase mediated deglycosylation. FEBS Lett. 579: 823-826. [Medline]
  9. Park, H., T. Suzuki, W. J. Lennarz. 2001. Identification of proteins that interact with mammalian peptide:N-glycanase and implicate this hydrolase in the proteasome-dependent pathway for protein degradation. Proc. Natl. Acad. Sci. USA 98: 11163-11168. [Abstract/Free Full Text]
  10. Suzuki, T., A. Seko, K. Kitajima, Y. Inoue, S. Inoue. 1993. Identification of peptide:N-glycanase activity in mammalian-derived cultured cells. Biochem. Biophys. Res. Commun. 194: 1124-1130. [Medline]
  11. Craiu, A., T. Akopian, A. Goldberg, K. L. Rock. 1997. Two distinct proteolytic processes in the generation of a major histocompatibility complex class I-presented peptide. Proc. Natl. Acad. Sci. USA 94: 10850-10855. [Abstract/Free Full Text]
  12. Stoltze, L., T. P. Dick, M. Deeg, B. Pommerl, H. G. Rammensee, H. Schild. 1998. Generation of the vesicular stomatitis virus nucleoprotein cytotoxic T lymphocyte epitope requires proteasome-dependent and -independent proteolytic activities. Eur. J. Immunol. 28: 4029-4036. [Medline]
  13. Mo, X. Y., P. Cascio, K. Lemerise, A. L. Goldberg, K. L. Rock. 1999. Distinct proteolytic processes generate the C and N termini of MHC class I-binding peptides. J. Immunol. 163: 5851-5859. [Abstract/Free Full Text]
  14. Seifert, U., C. Maranon, A. Shmueli, J. F. Desoutter, L. Wesoloski, K. Janek, P. Henklein, S. Diescher, M. Andrieu, H. de la Salle, et al 2003. An essential role for tripeptidyl peptidase in the generation of an MHC class I epitope. Nat. Immunol. 4: 375-379. [Medline]
  15. Cascio, P., C. Hilton, A. F. Kisselev, K. L. Rock, A. L. Goldberg. 2001. 26S proteasomes and immunoproteasomes produce mainly N-extended versions of an antigenic peptide. EMBO J. 20: 2357-2366. [Medline]
  16. Lucchiari-Hartz, M., P. M. van Endert, G. Lauvau, R. Maier, A. Meyerhans, D. Mann, K. Eichmann, G. Niedermann. 2000. Cytotoxic T lymphocyte epitopes of HIV-1 Nef: generation of multiple definitive major histocompatibility complex class I ligands by proteasomes. J. Exp. Med. 191: 239-252. [Abstract/Free Full Text]
  17. York, I. A., S. C. Chang, T. Saric, J. A. Keys, J. M. Favreau, A. L. Goldberg, K. L. Rock. 2002. The ER aminopeptidase ERAP1 enhances or limits antigen presentation by trimming epitopes to 8–9 residues. Nat. Immunol. 3: 1177-1184. [Medline]
  18. Serwold, T., F. Gonzalez, J. Kim, R. Jacob, N. Shastri. 2002. ERAAP customizes peptides for MHC class I molecules in the endoplasmic reticulum. Nature 419: 480-483. [Medline]
  19. Saric, T., S. C. Chang, A. Hattori, I. A. York, S. Markant, K. L. Rock, M. Tsujimoto, A. L. Goldberg. 2002. An IFN-{gamma}-induced aminopeptidase in the ER, ERAP1, trims precursors to MHC class I-presented peptides. Nat. Immunol. 3: 1169-1176. [Medline]
  20. Tanioka, T., A. Hattori, S. Masuda, Y. Nomura, H. Nakayama, S. Mizutani, M. Tsujimoto. 2003. Human leukocyte-derived arginine aminopeptidase: the third member of the oxytocinase subfamily of aminopeptidases. J. Biol. Chem. 278: 32275-32283. [Abstract/Free Full Text]
  21. Saveanu, L., O. Carroll, V. Lindo, V. M. Del, D. Lopez, Y. Lepelletier, F. Greer, L. Schomburg, D. Fruci, G. Niedermann, P. M. van Endert. 2005. Concerted peptide trimming by human ERAP1 and ERAP2 aminopeptidase complexes in the endoplasmic reticulum. Nat. Immunol. 6: 689-697. [Medline]
  22. Beninga, J., K. L. Rock, A. L. Goldberg. 1998. Interferon-{gamma} can stimulate post-proteasomal trimming of the N terminus of an antigenic peptide by inducing leucine aminopeptidase. J. Biol. Chem. 273: 18734-18742. [Abstract/Free Full Text]
  23. Towne, C. F., I. A. York, J. Neijssen, M. L. Karow, A. J. Murphy, D. M. Valenzuela, G. D. Yancopoulos, J. J. Neefjes, K. L. Rock. 2005. Leucine aminopeptidase is not essential for trimming peptides in the cytosol or generating epitopes for MHC class I antigen presentation. J. Immunol. 175: 6605-6614. [Abstract/Free Full Text]
  24. Stoltze, L., M. Schirle, G. Schwarz, C. Schroter, M. W. Thompson, L. B. Hersh, H. Kalbacher, S. Stevanovic, H. G. Rammensee, H. Schild. 2000. Two new proteases in the MHC class I processing pathway. Nat. Immunol. 1: 413-418. [Medline]
  25. Wherry, E. J., T. N. Golovina, S. E. Morrison, G. Sinnathamby, M. J. McElhaugh, D. C. Shockey, L. C. Eisenlohr. 2006. Re-evaluating the generation of a "proteasome-independent" MHC class I-restricted CD8 T cell epitope. J. Immunol. 176: 2249-2261. [Abstract/Free Full Text]
  26. Valmori, D., U. Gileadi, C. Servis, P. R. Dunbar, J. C. Cerottini, P. Romero, V. Cerundolo, F. Levy. 1999. Modulation of proteasomal activity required for the generation of a cytotoxic T lymphocyte-defined peptide derived from the tumor antigen MAGE-3. J. Exp. Med. 189: 895-906. [Abstract/Free Full Text]
  27. Halaban, R., E. Cheng, D. N. Hebert. 2002. Coexpression of wild-type tyrosinase enhances maturation of temperature-sensitive tyrosinase mutants. J. Invest. Dermatol. 119: 481-488. [Medline]
  28. Ostankovitch, M., V. Robila, V. H. Engelhard. 2005. Regulated folding of tyrosinase in the endoplasmic reticulum demonstrates that misfolded full-length proteins are efficient substrates for class I processing and presentation. J. Immunol. 174: 2544-2551. [Abstract/Free Full Text]
  29. Slingluff, C. L., T. A. Colella, L. Thompson, D. D. Graham, J. C. A. Skipper, J. A. Caldwell, L. Brinkerhoff, D. J. Kittlesen, D. H. Deacon, C. Oei, et al 2000. Melanomas with concordant loss of multiple melanocytic differentiation proteins: immune escape that may be overcome by targeting unique or undefined antigens. Cancer Immunol. Immunother. 48: 661-672. [Medline]
  30. Wang, W., S. Man, P. H. Gulden, D. F. Hunt, V. H. Engelhard. 1998. Class I-restricted alloreactive cytotoxic T lymphocytes recognize a complex array of specific MHC-associated peptides. J. Immunol. 160: 1091-1097. [Abstract/Free Full Text]
  31. Luckey, C. J., J. A. Marto, M. Partridge, E. Hall, F. M. White, J. D. Lippolis, J. Shabanowitz, D. F. Hunt, V. H. Engelhard. 2001. Differences in the expression of human class I MHC alleles and their associated peptides in the presence of proteasome inhibitors. J. Immunol. 167: 1212-1221. [Abstract/Free Full Text]
  32. Syka, J. E., J. A. Marto, D. L. Bai, S. Horning, M. W. Senko, J. C. Schwartz, B. Ueberheide, B. Garcia, S. Busby, T. Muratore, et al 2004. Novel linear quadrupole ion trap/FT mass spectrometer: performance characterization and use in the comparative analysis of histone H3 post-translational modifications. J. Proteome Res. 3: 621-626. [Medline]
  33. Eng, J. K., A. L. McCormack, J. R. Yates. 1994. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J. Am. Soc. Mass Spectrom. 5: 976-989.
  34. Garcia-Calvo, M., E. P. Peterson, B. Leiting, R. Ruel, D. W. Nicholson, N. A. Thornberry. 1998. Inhibition of human caspases by peptide-based and macromolecular inhibitors. J. Biol. Chem. 273: 32608-32613. [Abstract/Free Full Text]
  35. Misaghi, S., M. E. Pacold, D. Blom, H. L. Ploegh, G. A. Korbel. 2004. Using a small molecule inhibitor of peptide: N-glycanase to probe its role in glycoprotein turnover. Chem. Biol. 11: 1677-1687. [Medline]
  36. Bause, E.. 1984. Model studies on N-glycosylation of proteins. Biochem. Soc. Trans. 12: 514-517. [Medline]
  37. Saveanu, L., D. Fruci, P. Van Endert. 2002. Beyond the proteasome: trimming, degradation and generation of MHC class I ligands by auxiliary proteases. Mol. Immunol. 39: 203-215. [Medline]
  38. Bacik, I., H. L. Snyder, L. C. Anton, G. Russ, W. Chen, J. R. Bennink, L. Urge, L. Otvos, B. Dudkowska, L. Eisenlohr, J. W. Yewdell. 1997. Introduction of a glycosylation site into a secreted protein provides evidence for an alternative antigen processing pathway: transport of precursors of major histocompatability complex class I-restricted peptides from the endoplasmic reticulum to the cytosol. J. Exp. Med. 186: 479-487. [Abstract/Free Full Text]
  39. Weintraub, S. J., S. R. Manson. 2004. Asparagine deamidation: a regulatory hourglass. Mech. Ageing Dev. 125: 255-257. [Medline]
  40. Tyler-Cross, R., V. Schirch. 1991. Effects of amino acid sequence, buffers, and ionic strength on the rate and mechanism of deamidation of asparagine residues in small peptides. J. Biol. Chem. 266: 22549-22556. [Abstract/Free Full Text]
  41. Wood, P., T. Elliott. 1998. Glycan-regulated antigen processing of a protein in the endoplasmic reticulum can uncover cryptic cytotoxic T cell epitopes. J. Exp. Med. 188: 773-778. [Abstract/Free Full Text]
  42. Androlewicz, M. J.. 1996. An N-glycosylated tyrosinase epitope associates with newly synthesized MHC class I molecules in melanoma cells. Hum. Immunol. 51: 81-88. [Medline]
  43. Rock, K. L., I. A. York, A. L. Goldberg. 2004. Post-proteasomal antigen processing for major histocompatibility complex class I presentation. Nat. Immunol. 5: 670-677. [Medline]
  44. Wang, Y., D. S. Guttoh, M. J. Androlewicz. 1998. TAP prefers to transport melanoma antigenic peptides which are longer than the optimal T-cell epitope: evidence for further processing in the endoplasmic reticulum. Melonoma Res. 8: 345-353.
  45. Roelse, J., M. Gromme, F. Momburg, G. Hammerling, J. Neefjes. 1994. Trimming of TAP-translocated peptides in the endoplasmic reticulum and in the cytosol during recycling. J. Exp. Med. 180: 1591-1597. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
E. Kario, B. Tirosh, H. L. Ploegh, and A. Navon
N-Linked Glycosylati