|
|
||||||||


,
* Carter Immunology Center and Department of Microbiology,
Department of Chemistry, and
Department of Pathology, University of Virginia, Charlottesville, VA 22908
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Because glycosylation occurs during translation of tyrosinase in the ER, the necessity of this process for deamidation of Tyr369 was examined by altering the site of protein expression. Consistent with the involvement of glycosylation in deamidation, we previously established that the minimal 9-mer peptide representing Tyr369 did not undergo deamidation when translated in the cytosol (3). However, cytosolic translation of a fragment encoding residues 144378 of tyrosinase resulted in presentation of both the Asp (Tyr369(D)) and Asn (Tyr369(N)) forms of the epitope. We hypothesized that this large fragment was processed in the cytosol to give both minimal epitope and extended precursor peptides, both of which were transported by TAP. We further hypothesized that the additional length in the extended precursors prevented immediate binding to HLA-A*0201 after TAP transport, enabling the peptide to become glycosylated and to exit the ER into the cytosol for both deglycosylation and processing to the mature epitope. In the present paper, we have investigated these hypotheses directly.
In considering the hypothesis outlined above, it became of interest to understand which proteases were involved in the processing of Tyr369 epitope precursors. The proteasome has been shown to be responsible for proteolytic cleavage to generate the final C terminus of many epitopes (11, 12, 13), whereas tripeptidyl peptidase II (TPPII) has been shown to play a more limited role (14). However, the peptides that are generated by these proteases frequently contain one or more N-terminal residues beyond that of the mature epitope (11, 12, 13, 15, 16). Several aminopeptidases in the cytosol and the ER have been implicated in the removal of these N-terminal extensions. One aminopeptidase localized in the ER, ER aminopeptidase 1 (ERAP1), trims precursors to their final antigenic form in vitro, and exerts a strong influence on epitope generation in vivo (17, 18, 19, 20, 21). A second ER-localized aminopeptidase, ERAP2, is required for removal of some basic residues from some peptides (20, 21). Leucine aminopeptidase (LAP), a cytosolic aminopeptidase, can generate epitopes from precursors in vitro (13, 22), but knockout of LAP does not impact the level of SIINFEKL/H-2Kb complexes formed from a number of precursor peptides or full-length OVA (23). Bleomycin hydrolase (BH) and puromycin-sensitive aminopeptidase (PSA), which are also located in the cytosol, have also been shown to generate epitopes from precursors in in vitro degradation assays (24). However, no cytosolic aminopeptidase has been shown to be directly involved in the production of class I MHC-associated peptides in vivo. Furthermore, overexpression of TPPII, thimet oligopeptidase (TOP), LAP, BH, or PSA does not alter the presentation of two influenza nucleoprotein epitopes (25); thus, it is also consequently unclear whether cytosolic and ER-localized aminopeptidases cooperate in epitope generation. In the present paper, we have directly examined the proteolytic processes responsible for trimming of the Tyr369 epitope.
| Materials and Methods |
|---|
|
|
|---|
ICP47 (gift from N. Shastri, University of California, Berkeley, CA) was subcloned into pcDNA3.1/zeocin using the HindIII and EcoRI sites. Plasmids encoding cytosolic minigenes were generated by ligating overlapping oligonucleotides into pEGFP/Ub (gift from F. Levy, Ludwig Institute for Cancer Research, University of Lausanne, Epalinges, Switzerland) after digestion with BamHI and SacII. This plasmid links minigenes to an enhanced GFP (EGFP)-ubiquitin conjugate, and directs cleavage by an ubiquitin-specific protease and releases the minigene in the cytosol without necessitating the removal of an initiator methionine (26). Plasmids encoding minigenes targeted to the ER via the tyrosinase signal sequence were generated by ligating overlapping oligonucleotides into pEF6 (Invitrogen Life Technologies) after digestion with BamHI and KpnI. Full-length tyrosinase with a flag-tag at the C terminus, in p3XCMV (gift from R. Halaban, Yale University, New Haven, CT) has been previously described (27), and was used to generate a glycosylation-mutant tyrosinase, T373V (28). All plasmids were confirmed by sequencing.
Cell lines and transfectants
The human melanoma line DM331, which expresses HLA-A*0201 but not tyrosinase (29), was grown in RPMI 1640 supplemented with L-glutamine, HEPES, and 5% FBS/SerExtend (Irvine Scientific). DM331 was transfected with the above plasmid constructs using Fugene (Roche), and selected in medium containing 250 µg/ml zeocin (Invitrogen Life Technologies) (ICP47), 600 µg/ml G418 (Invitrogen Life Technologies) (cytosolic constructs, flag-tagged full-length tyrosinase, and T373V tyrosinase), or 10 µg/ml blasticidin (Invitrogen Life Technologies) (ER constructs and full-length tyrosinase). Clones expressing ICP47 were identified based on down-regulation of HLA-B and -C molecules detected with the B123.2 Ab. For some experiments, cells were transiently transfected. One day posttransfection, cells were trypsinized and evaluated for transfection efficiency by measuring the percentage of cells positive for EGFP and used as stimulators for T cells.
T cell activity
Tyr369(D)- and Tyr369(N)-specific T cells were generated as described previously (3) and restimulated weekly with peptide-pulsed splenocytes in RPMI 1640 supplemented with 10% FBS, 1x essential and nonessential amino acids, 10 U/ml IL-2, 15 mM HEPES, and 50 µM 2-ME (T cell medium). Presentation of Tyr369(N) and Tyr369(D) was evaluated either by intracellular cytokine staining (ICS) or ELISA. For ICS, T cells and stimulator cells were incubated at various ratios for 4 h in T cell medium containing 50 U/ml IL-2 and 10 µg/ml brefeldin A (BFA) (Sigma-Aldrich). Cells were stained with anti-CD8-PE (eBioscience), fixed and permeabilized with Cytofix/Cytoperm (BD Pharmingen), and stained with anti-IFN-
-allophycocyanin (eBioscience). Background IFN-
production was subtracted out using unstimulated parallel cultures. In some ICS assays, deamidation was quantified by as the ratio of the percentage of IFN-
+ Tyr369(D) T cells over the sum of the percentage of IFN-
+ Tyr369(D) and Tyr369(N) T cells. In these experiments, a T cell stimulator ratio was chosen such that the response was in the linear range. For ELISA, T cells and stimulator cells were incubated at various ratios for 1824 h in T cell medium. IFN-
was measured following manufacturers protocol (eBiosciences).
Inhibition of epitope expression using chemical inhibitors
DM331 cells were incubated for 30 min in medium containing 10 µg/ml BFA, 50 µM Z-VAD FMK (Promega or R&D Systems), 50 µM Q-VD-OPh (R&D Systems), or 2.5 µl/ml DMSO (Sigma-Aldrich) and treated with acidic buffer to remove cell surface class I MHC molecules (30, 31). Cells were resuspended in medium containing the same inhibitors and incubated at 37°C for 5 h to allow re-expression of MHC molecules. Cells were fixed with 0.1% glutaraldehyde, and used as stimulators in an ELISA.
Inhibition of protease expression by small interfering RNA (siRNA) knockdown
DM331 cells expressing full-length tyrosinase or minigenes were transfected twice 4 h apart using Oligofectamine (Invitrogen Life Technologies) and siRNA oligonucleotides targeting human ERAP1 (AACGTAGTGATGGGACACCAT), TOP (AAAAGGUCACCCUCAAGUACC), TPPII (AAGUGGCGAUGUGAAUACUGC) (all from Dharmacon); LAP (CCCAGTCTTCTTGGAAATTCA and AAAGCTTAATTTGCCCATTAA), PSA (CTGGGAATGGTTAAACACAAA and CAGACCAATGGGTGAAGTTAA), or BH (CCAATGGGATATGCTTGTTAA and ATGCTTGTTAATATTGTTGAA) (all from Qiagen), or control nontargeting siRNA (Dharmacon). For experiments combining ERAP1 knockdown and TAP inhibition, Tyr369-encoding minigenes and siRNA were cotransfected by Nucleofection (Amaxa) using buffer V and program U-20. Blasticidin and zeocin were added after 24 h. All transfectants were used as stimulators in ELISA 3 or 4 days following transfection.
Real-time RT-PCR
RNA was extracted using TRIzol with glycogen pull-down (Invitrogen Life Technologies) from cells that had been transfected with siRNA oligonucleotides 3 days previously. Various concentrations of RNA were used in a real-time RT-PCR using the QuantiTect SYBR Green RT-PCR kit (Qiagen) and QuantiTect Primer Assays (Qiagen) for all five proteases and the housekeeping gene, GAPDH, on an ABI Prism 7000, following the manufacturers protocol. A ratio of GAPDH to protease mRNA was calculated by the formula 1/2DCt, where DCt is the difference in cycle count between GAPDH and the specific protease.
Immunoblotting
For tyrosinase immunoblotting, DM331 cells expressing flag-tagged full-length tyrosinase were incubated for 4 h in medium containing 1 µg/ml cycloheximide and either 50 µM Z-VAD FMK (Promega), 2 µM epoxomicin (Calbiochem), or both. For ERAP1 immunoblotting, DM331 cells transfected with siRNA oligonucleotides 4 days prior were used. Cells were lysed by repeated freeze-thaw in buffer containing protease inhibitors and centrifuged at 100,000 x g for 1 h at 4°C. For tyrosinase immunoblotting, half of each supernatant was digested with 1000 U of PNGase (New England Biolabs) according to the manufacturers recommendations. Boiled samples were separated on 10% SDS-PAGE gels, transferred to Immobilon-P membrane, and blocked in 5% nonfat milk in PBS with 0.05% Tween 20. Blots were probed overnight with Abs against flag (Sigma-Aldrich), ERAP1 (a gift from Dr. M. Tsujimoto, RIKEN, Wako, Japan), or calnexin (StressGen), washed, probed with HRP-conjugated secondary Abs, and developed according to the Amersham ECL protocol.
In vitro digestion with ERAP1
The 6+9N peptide HNALHIYMNGTMSQV (150 µM) and 3.5 µg/ml ERAP1 (gift from K. Rock and L. Stern, University of Massachusetts Medical School, Worcester, MA) were incubated in 50 mM Tris-HCl (pH 7.8) under argon to minimize oxidation. The reaction was terminated by adding 0.6% trifluoroacetic acid. Aliquots from each time point were loaded onto a reverse-phase C18 microcapillary HPLC column and gradient eluted at a flow rate of
60 nl/min through a 2-µm diameter laser pulled electrospray orifice directly into a hybrid linear quadrupole ion trap Fourier transform mass spectrometer (FTMS) (Thermo Electron Corporation) adapted as in Ref. 32 . Collisional activated dissociation spectra ms were acquired in a data-dependent mode. First, a full-scan mass spectrum was obtained with the FTMS, followed by 10 ms spectra acquired in the linear trap of the top 10 most abundant mass spectrometry ions from the FTMS full scan spectrum (one microscan per spectra; precursor m/z, ±1.5 Da; 30% collision energy; 30-ms ion activation; no dynamic exclusion; repeat count of two). SEQUEST, version 27 (revision 11) (33), was used for automated peptide identification, searched through the BioWorks, version 3.2, interface. A simple peptide database corresponding to the sequence of the 15-mer was searched without enzyme restriction, with a differential modification of 16 Da for methionine oxidation. Peak areas and heights were calculated (2.5-ppm mass tolerance; 10,000 ion count minimum threshold; no smoothing) within the Bioworks 3.2 software, for manually validated peptides. Peak height values of oxidized and unoxidized forms of a peptide were summed and used to determine relative abundance in the sample set, because the relative values for height and area were equivalent under these analysis conditions.
| Results |
|---|
|
|
|---|
We previously established that two HLA-A*0201-restricted epitopes derived from the Tyr369 sequence were produced in vivo (2, 3). One of these, based on the genetically encoded sequence and containing an Asn at the third position, is designated Tyr369(N). The other contains an Asp at this position, and is designated Tyr369(D). The presentation of these epitopes on melanoma cells and tyrosinase transfectants was initially shown using mass spectrometry, and later using T cells specific for each epitope, analogous to those shown in Fig. 1A. As previously shown, cells expressing full-length tyrosinase presented substantial amounts of Tyr369(D), but no significant amount of Tyr369(N) (Fig. 1B). Conversely, cells transfected with a minigene encoding a cytosol-targeted minimal Tyr369(N) epitope presented only Tyr369(N) and not Tyr369(D). Thus, the location and structure of the precursor of the Tyr369 epitope determines whether it undergoes deamidation.
|
|
|
N-terminal extended Tyr369 epitope precursors in the cytosol undergo deglycosylation-dependent deamidation
We previously demonstrated that cells expressing a fragment comprising residues 144378 of tyrosinase in the cytosol presented both Tyr369(D) and Tyr369(N) epitopes (3), suggesting that longer epitope precursors enabled deamidation to occur. To gain insight into the mechanism responsible, we generated minigenes encoding Tyr369 epitope precursors linked to the C-terminal end of an EGFP-ubiquitin fusion protein. These fusion proteins are rapidly and quantitatively cleaved following the ubiquitin residue by a ubiquitin-specific protease, releasing the epitope precursors into the cytosol (26). Constructs were generated that encoded precursors with extensions of either three or five N-terminal residues (3+9N and 5+9N), three or five C-terminal residues (9N+3 and 9N+5), or five residues on both ends of the mature epitope (5+9N+5). All extensions were taken from the tyrosinase sequence flanking the epitope (Table I). Expression plasmids encoding the fusion proteins were transfected into DM331, and cells expressing equivalent levels of EGFP were evaluated for epitope presentation with Tyr369(D)- and Tyr369(N)-specific T cells. Relative to cells expressing the minimal 9-mer construct (9N), cells expressing precursors with C-terminal extensions (9N+3, 9N+5, and 5+9N+5) presented Tyr369(N) very poorly, and did not present Tyr369(D) at any detectable level (Fig. 4A). These low levels of presentation may be due either to an inability of these short substrates to be processed by the proteasome or, alternatively, to inappropriate proteasomal cleavage resulting in epitope destruction. In contrast, cells expressing precursors with N-terminal extensions (3+9N and 5+9N) presented Tyr369(N) similarly to cells expressing the minimal 9N construct (Fig. 4A). Most importantly, cells expressing either the 3+9N or 5+9N constructs were recognized at a significant level by Tyr369(D)-specific T cells, whereas recognition of cells expressing 9N construct was minimal. This demonstrates that deamidation of Tyr369 derived from precursors synthesized in the cytosol is dependent on extending their N-terminal ends relative to that of the mature epitope.
|
|
). However, Z-VAD FMK did not block presentation of Tyr369(N) in the same cells (Fig. 4B,
). This indicates deamidation of Tyr369 from this cytosolic precursor is dependent on deglycosylation by PNGase, similar to that seen with wild-type full-length tyrosinase. This in turn suggests that these precursors enter the ER to become glycosylated, are then retrotranslocated into the cytosol for deglycosylation, and are transported into the ER a second time for binding to HLA-A*0201. We evaluated the relative efficiency of deamidation of different epitope forms by calculating the ratio of Tyr369(D)-specific T cell reactivity to the sum of Tyr369(D)-specific and Tyr369(N)-specific T cell reactivities. This measurement can be affected by variation in T cell activity and transfection efficiency in different experiments, and its relationship to the number of relevant peptide-MHC complexes is more likely to be logarithmic than linear. Nonetheless, it provides a semiquantitative determination of the extent of deamidation, and consistent results were obtained in four independent experiments. These data showed that the relative efficiency of deamidation was similar for the 3+9N and 5+9N constructs (Fig. 4C). However, the efficiency of deamidation of either construct was substantially less than that of full-length tyrosinase.
The efficiency of Tyr369 deamidation is independent of the site of translation
The inefficiency of deamidation of cytosolic Tyr369 precursors relative to full-length tyrosinase in the ER suggested that deamidation was linked to the site of translation. Therefore, we generated minigenes encoding either the minimal epitope (ER9N) or N-terminal extended precursors (ER1+9N, ER2+9N, ER6+9N) linked to the signal sequence of tyrosinase, allowing for translation into the lumen of the ER and release of the precursor by signal peptidase. Cells expressing all of these constructs were recognized by Tyr369(N)-specific T cells comparably to one another and to cells transfected with the cytosol-directed 5+9N construct (Fig. 5A). As was seen above with the cytosolic constructs, cells expressing N-terminal extended constructs in the ER were recognized at an elevated level by Tyr369(D)-specific T cells, indicating that a fraction of these molecules had undergone deamidation. In addition, Z-VAD FMK treatment blocked presentation of Tyr369(D) in cells expressing the ER6+9N construct (Fig. 5B). This indicates deamidation of Tyr369 from ER-targeted precursors is dependent on deglycosylation by PNGase. However, the relative efficiency of deamidation of ER-targeted precursors was similar to that seen for the N-terminal extended cytosolic precursors, and still substantially less than that seen for full-length tyrosinase (Fig. 5C). Thus, translation in the ER per se is not sufficient to improve the efficiency of deamidation, suggesting that structural differences between these small epitope precursors and full-length tyrosinase exert a strong influence.
|
Although the results above established that extended Tyr369 epitope precursors underwent glycosylation-dependent deamidation, they did not directly address how the N-terminal extensions enabled this process. We originally suggested that this additional length prevented immediate binding to HLA-A*0201 after TAP transport, enabling the peptide to exit the ER into the cytosol for both deglycosylation and processing to the mature epitope (3). However, the recent identification of ERAP1 and ERAP2 as important mediators of N-terminal trimming in the ER cast doubt on this model. In addition, it is generally believed that glycosylated peptides exit the ER poorly, a fact that has been used in the design of assays for TAP transport. To gain further insight into these issues, we examined the ability of Tyr369 epitope precursors to be processed in the ER alone. Minigenes encoding cytosol- or ER-targeted epitopes or precursors were transfected into DM331 cells that had been stably transfected to express ICP47, a herpes simplex viral protein that blocks TAP transport into the ER and the cells were evaluated for epitope presentation with Tyr369(N)-specific T cells. As expected, epitope presentation from the cytosol-localized 5+9N precursor was strongly inhibited by cotransfection of ICP47, reflecting TAP-dependent transport (Fig. 6A), whereas Tyr369(N) presentation in cells transfected to express the minimal 9N construct in the ER was insensitive to ICP47 (Fig. 6B). Presentation of Tyr369(D) from ER-targeted precursors with N-terminal extensions was inhibited by ICP47 regardless of the length of the extension (Fig. 6B), consistent with the idea that generation of this deamidated epitope depends on translocation from ER to cytosol for PNGase-mediated deamidation. Interestingly, however, the effect of ICP47 on presentation of the nondeamidated Tyr369(N) epitope from ER-targeted precursors was length dependent (Fig. 6A). ICP47 had little impact on epitope presentation from a precursor with a single residue N-terminal extension. However, TAP inhibition by ICP47 significantly diminished the presentation of Tyr369(N) from precursors with two and six residue extensions. This indicates that aminopeptidases in the ER are sufficient to trim short Tyr369 precursors to their final length. However, efficient presentation from longer precursors depends, at least in part, on proteases localized in the cytosol.
|
The ER aminopeptidase, ERAP1, has been shown to influence the presentation of a large fraction of class I MHC-associated peptide epitopes (17). To evaluate the importance of ERAP1 in the production of Tyr369(N), DM331 cells expressing cytosolic- or ER-targeted constructs were transfected with siRNA oligonucleotides for either ERAP1 or a nontargeting control, and cells were analyzed for presentation of Tyr369(N) 34 days later. Knockdown of ERAP1, which was confirmed by Western blot (Fig. 7A), increased the presentation of Tyr369(N) in cells transfected to express the cytosolic-targeted minimal construct (9N) (Fig. 7, B and C). This is consistent with the demonstration that ERAP1 degrades Tyr369(N) in vitro (17). Conversely, ERAP1 knockdown decreased the presentation of Tyr369(N) from the cytosolic- and ER-targeted precursors containing five or six N-terminal amino acids (Fig. 7, B and C). Additionally, ERAP1 knockdown inhibited presentation of Tyr369(D) in cells expressing full-length tyrosinase. These results, taken with the ICP47 blockade data of Fig. 6, suggest that both cytosolic proteases and ERAP1 are involved in the generation of Tyr369 epitopes from precursors containing five to six residue extensions, and that such precursors are produced from full-length tyrosinase.
|
The observation that epitope presentation from Tyr369 precursors with two and six residue extensions was TAP dependent suggested that cytosolic proteases were compensating for a deficiency in the trimming of these longer peptides by ERAP1. To evaluate this hypothesis, recombinant human ERAP1 was incubated in vitro with a 15-mer synthetic peptide corresponding to the ER6+9N precursor, and the degradation products were analyzed by mass spectrometry. Under the conditions used, ERAP1 degraded
90% of this 15-mer within a period of 10 min (Fig. 8). The 14-mer, 13-mer, and 12-mer degradation products became evident as the 15-mer was degraded, but were always detected at relatively low levels. In contrast, the 11-mer accumulated substantially within 5 min and remained present at significant levels for at least 30 min. The 10-mer also accumulated to a significant extent early, but then declined coincident with the appearance of the mature 9-mer epitope. These results suggest a model in which epitope production is limited by inefficient trimming of the 11-mer peptide by ERAP1, which is compensated for by retrotranslocation and trimming in the cytosol.
|
|
| Discussion |
|---|
|
|
|---|
Given the above mechanism, a surprising result was that elimination of the glycosylation consensus sequence in the Tyr369 epitope did not completely eliminate deamidation. This suggests that a second pathway exists for deamidation. No enzymatic pathway for the deamidation of unglycosylated Asn has been described in mammals. However, spontaneous deamidation of Asn residues in aged or damaged proteins is common (39). It has also been demonstrated that spontaneous deamidation is influenced by proximal residues, and a Gly residue to the C-terminal side of the target Asn promotes this process (40). Thus, we propose that the deamidated Tyr369 epitope that arises independent of glycosylation is due to a spontaneous deamidation process. A corollary of this hypothesis is that spontaneously deamidated Asn residues should be represented in class I MHC-associated epitopes derived from a variety of proteins. Although such epitopes have not yet been described in the literature, a more systematic investigation of this hypothesis is clearly warranted. Because spontaneous deamidation is not expected to be complete, it has the potential to yield greater epitope diversity through the generation of both Asn- and Asp-containing forms of the same peptide. In this context, cells infected with LCMV present both deamidated and Asn-containing forms of a GP1-derived epitope (6). Although the presence of the Asn form indicates that the full-length protein is not efficiently glycosylated, it is not clear whether the deamidated form arises from deglycosylation or spontaneous deamidation. Conversely, it is also important to reiterate that, based on the absence of Tyr369(N), the requirement for PNGase, and the obligatory conversion of Asn to Asp during PNGase mediated deglycosylation, our evidence does not support a role for spontaneous deamidation in the generation of Tyr369(D) from normally glycosylated tyrosinase.
Our work has also established that PNGase-dependent deglycosylation to generate Tyr369(D) occurs on short epitope precursors that contain N-terminal extensions, but not on the minimal 9-mer epitope. Furthermore, the extent of deamidation is not enhanced by longer N-terminal extensions. The exact mechanism by which N-terminal extensions enable deamidation is not certain. Such precursors have a greatly diminished ability to bind to the HLA-A*0201, and will be susceptible to trimming in either ER or cytosol, glycosylation, and retrotranslocation. However, we have shown that the efficiency of trimming in the ER is clearly dependent on the length of the precursor, suggesting that this does not determine the extent of deamidation. Interestingly, glycosylation has been shown to interfere with the processing of influenza NP epitope precursors in the ER (41). Therefore, an attractive model for the processing of tyrosinase is one in which epitope precursors of different lengths are glycosylated to a similar extent, preventing their trimming and rendering the differences in their length irrelevant. This in turn renders them susceptible to retro-translocation into the cytosol for deamidation. In the context of this model, it has previously been shown that glycosylated Tyr369(N) binds to HLA-A*0201 in vivo (42). Thus, the failure of the minimal 9-mer epitope to undergo deamidation is a consequence of its immediate binding to HLA-A*0201, independent of its glycosylation state, which prevents retrotranslocation and subsequent deglycosylation by PNGase.
Whereas cells expressing full-length tyrosinase present only Tyr369(D) (2, 3), cells expressing minigenes encoding epitope precursors in either the ER or cytosol presented substantial and similar levels of Tyr369(N). This suggests that glycosylation, albeit inefficient, occurs primarily on small peptides located in the lumen of the ER after release from the translation apparatus or after TAP transport. This may be due to the short length of the peptides such that they are cleaved from the signal sequence before the glycosylation machinery recognizes the glycosylation consensus motif. The inefficient deamidation of these short precursors compared with full-length proteins is a significant result to consider in the design of vaccines based on epitopes with the potential to undergo glycosylation and/or deamidation. In a similar vein, glycosylation-dependent deamidation of short precursors after TAP transport may alter the repertoire of epitopes generated from cytosolic proteins that contain cryptic glycosylation consensus sequences.
In this paper, we have also examined the involvement of proteases localized in the ER and the cytosol in the generation of Tyr369 epitopes. The ER-localized aminopeptidase ERAP1 has been established to play an important role in N-terminal trimming of precursors for multiple epitopes (17, 18, 19). This has led to a general model of class I MHC peptide processing that involves generation of the C terminus by the proteasome in the cytosol, followed by TAP-mediated entry into the ER and ERAP1-mediated trimming (43). Here, we show that generation of Tyr369(N) and Tyr369(D) from small precursors or full-length tyrosinase is ERAP1 dependent. However, ERAP1 also diminished presentation of Tyr369(N) in cells expressing a minigene encoding the mature epitope, demonstrating that it can also destroy this epitope in vivo. Finally, we have demonstrated that the action of ERAP1 is dependent on the structure of the Tyr369 precursor, and the enzyme inefficiently removes the His at the 2 position. It is possible that this is due to the weakly basic nature of His, because it has been shown that ERAP1 inefficiently removes some other basic residues (21).
In keeping with this inefficient action of ERAP1, our results also establish that presentation of Tyr369(N) from ER-targeted precursors containing two or six N-terminal residues requires processing in the cytosol. Previous studies have suggested that several distinct cytosolically localized peptidases mediate N-terminal trimming of precursors to generate epitopes in vitro (13, 22, 24), although the in vivo relevance of cytosolic peptidases in the N-terminal trimming of epitope precursors has not previously been established. Here, we have shown that none of these previously identified proteases are involved in the generation of Tyr369 from ER-targeted precursors containing six N-terminal residues or from full-length tyrosinase. This is in agreement with the recent observation that knockout mice lacking leucine aminopeptidase do not show any significant alteration in the MHC class I processing pathway (23). Thus, the cytosolic peptidase responsible for the N-terminal trimming of these Tyr369(N) epitope precursors remains unclear.
Collectively, these data lead to a model in which precursors longer than 10 residues and localized in the ER are trimmed by ERAP1, and then retrotranslocated to the cytosol for removal of the His at the 2 position, and retransported back into the ER by TAP. It has been shown elsewhere that TAP transports the 10-mer precursor of Tyr369 much more efficiently than the mature 9-mer epitope (44). Thus, ERAP1 may act a second time on the products of cytosolic trimming. In the context of a cell expressing full-length tyrosinase, this model would also apply for any precursors longer than 10 residues that are transported by TAP after generation by the proteasome in the cytosol. This model is in keeping with a previous demonstration of the recycling of longer peptides from ER to cytosol (45), but differs in that recycling is necessary for epitope generation. It also differs from another model in which a deficiency in ERAP1 activity was compensated by the activity of ERAP2 (21). Whether this is due to a deficiency in ERAP2 expression by DM331 cells, or an inactivity of ERAP2 toward this precursor, is currently unclear.
In sum, we have provided new insights into mechanisms that generate the HLA-A*0201-associated epitope Tyr369, and that are likely to apply to a broad range of epitopes. These mechanisms involve enzymatic activities in the cytosol that provide essential roles in the generation of class I MHC-associated epitopes. As such, they should be properly considered elements of the class I MHC processing and presentation pathway.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by U.S. Public Health Service Grants AI20963 (to V.H.E.) and AI33993 (to D.F.H.). M.L.A.-V. was supported by American Cancer Society Grant PF-03-128-01-LIB. ![]()
2 Current address: IBT Reference Laboratory, 11274 Renner Boulevard, Lenexa, KS 66219. ![]()
3 Current address: Department of Pathology, Vanderbilt University, Nashville, TN 37212. ![]()
4 Address correspondence and reprint requests to Dr. Victor H. Engelhard, Carter Immunology Center, University of Virginia, Box 801386, Charlottesville, VA 22908-1386. E-mail address: vhe{at}virginia.edu ![]()
5 Abbreviations used in this paper: Tyr369, tyrosinase 369377; LCMV, lymphocytic choriomeningitis virus; ER, endoplasmic reticulum; PNGase, peptide-N-glycanase; TPPII, tripeptidyl peptidase II; ERAP, ER aminopeptidase; LAP, leucine aminopeptidase; PSA, puromycin-sensitive aminopeptidase; BH, bleomycin hydrolase; TOP, thimet oligopeptidase; EGFP, enhanced GFP; ICS, intracellular cytokine staining; BFA, brefeldin A; siRNA, small interfering RNA; FTMS, Fourier transform mass spectrometer. ![]()
Received for publication April 24, 2006. Accepted for publication July 31, 2006.
| References |
|---|
|
|
|---|
-induced aminopeptidase in the ER, ERAP1, trims precursors to MHC class I-presented peptides. Nat. Immunol. 3: 1169-1176. [Medline]
can stimulate post-proteasomal trimming of the N terminus of an antigenic peptide by inducing leucine aminopeptidase. J. Biol. Chem. 273: 18734-18742. This article has been cited by other articles:
![]() |
M. Ostankovitch, M. Altrich-VanLith, V. Robila, and V. H. Engelhard N-Glycosylation Enhances Presentation of a MHC Class I-Restricted Epitope from Tyrosinase J. Immunol., April 15, 2009; 182(8): 4830 - 4835. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kario, B. Tirosh, H. L. Ploegh, and A. Navon N-Linked Glycosylation Does Not Impair Proteasomal Degradation but Affects Class I Major Histocompatibility Complex Presentation J. Biol. Chem., January 4, 2008; 283(1): 244 - 254. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Firat, J. Huai, L. Saveanu, S. Gaedicke, P. Aichele, K. Eichmann, P. van Endert, and G. Niedermann Analysis of Direct and Cross-Presentation of Antigens in TPPII Knockout Mice1 J. Immunol., December 15, 2007; 179(12): 8137 - 8145. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |