The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gordón-Alonso, M.
Right arrow Articles by Sánchez-Madrid, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gordón-Alonso, M.
Right arrow Articles by Sánchez-Madrid, F.
The Journal of Immunology, 2006, 177: 5129-5137.
Copyright © 2006 by The American Association of Immunologists, Inc.

Tetraspanins CD9 and CD81 Modulate HIV-1-Induced Membrane Fusion1

Mónica Gordón-Alonso*, María Yañez-Mó*, Olga Barreiro*, Susana Álvarez{dagger}, M. Ángeles Muñoz-Fernández{dagger}, Agustín Valenzuela-Fernández2,* and Francisco Sánchez-Madrid3,*

* Servicio de Inmunología, Hospital Universitario de la Princesa, Universidad Autónoma de Madrid, Madrid, Spain; and {dagger} Departamento de Inmuno-Biología Molecular, Hospital General Universitario Gregorio Marañón, Madrid, Spain


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Protein organization on the membrane of target cells may modulate HIV-1 transmission. Since the tetraspanin CD81 is associated to CD4, the receptor of HIV-1 envelope protein (Env; gp120/gp41), we have explored the possibility that this molecule may modulate the initial steps of HIV-1 infection. On the other hand, CD81 belongs to the tetraspanin family, which has been described as organizers of protein microdomains on the plasma membrane. Therefore, the role of CD81 and other related tetraspanin, CD9, on the cell-to-cell fusion process mediated by HIV-1 was studied. We found that anti-tetraspanin Abs enhanced the syncytia formation induced by HIV-1 envelope proteins and viral entry in human T lymphoblasts. In addition, anti-CD81 Abs triggered its clustering in patches, where CD4 and CXCR4 were included. Moreover, the knocking down of CD81 and CD9 expression resulted in an increase in syncytia formation and viral entry. Accordingly, overexpression of CD81 and CD9 rendered cells less susceptible to Env-mediated syncytia formation. These data indicate that CD9 and CD81 have an important role in membrane fusion induced by HIV-1 envelope.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Human immunodeficiency virus type 1 expresses on its surface envelope protein complexes (Env),4 composed by subunits gp120 and gp41, that mediate viral attachment and membrane fusion. It is well known that gp120 binds to CD4, which allows its interaction with CCR5 or CXCR4, the two major coreceptors, and the subsequent unfolding of gp41 (1, 2, 3). Then, gp41 inserts its hydrophobic motif (fusion peptide) in the cell membrane, triggering virus-cell membrane fusion. HIV-1 infects preferentially macrophages, dendritic cells, and CD4+ T lymphocytes (4, 5, 6). HIV-1 induces the fusion of uninfected CD4+CXCR4/CCR5+ cells and infected cells expressing Env, resulting in the formation of giant multinucleated cells, termed syncytia. Cell-to-cell fusion represents another way of virus spreading with the advantage of being inaccessible to humoral immune response (7, 8, 9, 10). Moreover, viral strains prone to induce syncytia usually emerged simultaneously with the entry into AIDS phase (11). In addition, HIV-1-induced syncytia formation provides a suitable experimental model to study viral entry in target cells (12).

Virus-cell and cell-to-cell fusion processes are not fully understood. It is feasible that the existence of preassembled protein complexes on target cells might regulate these phenomena. Tetraspanins comprise a family of integral proteins that span the membrane 4-fold and establish specialized microdomains based on noncovalent protein-protein interactions (13). These proteins possess a highly conserved structure with a short and a large extracellular loop (LEL). The LEL domain contains critical protein-protein interaction sites that allow noncovalent association of these proteins with other tetraspanins and transmembrane proteins, such as integrins and members of the Ig superfamily (13, 14). In this regard, it has been demonstrated that tetraspanins can modulate the function of proteins associated with them such as integrins (15) or ICAM-1 and VCAM-1 (16). Disruption of tetraspanin-based membrane microdomains interferes with important cellular processes, such as signal transduction, Ag presentation, cell migration, and cellular adhesion (14, 17, 18, 19). Tetraspanins are also involved in membrane fusion events such as sperm-oocyte fusion (20), myotube formation (21), and fusion of mononuclear phagocytes (22). In addition, these molecules are implicated in viral processes such as CD63 in HIV infection (23, 24), CD81 in hepatitis C virus infection (25), CD82 in cell-to-cell human T cell leukemia virus type I (HTLV-1) spreading (26), and CD9 in feline immunodeficiency virus (FIV) and canine distemper virus spreading (27, 28).

In the present study, we addressed the possible role of CD9 and CD81 on the fusion process mediated by HIV-1 Env. Our data show that CD9 and CD81 blockade rendered target cells more susceptible to syncytia formation induced by HIV-1 Env. Accordingly, short interference RNA (siRNA) of CD9 or CD81 expression enhanced viral entry and syncytia formation, whereas CD9 and CD81 overexpression had an opposing effect.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Abs, reagents, and recombinant DNA constructs

The anti-CD4 HP2/6 mAb (IgG1) that blocks gp120/CD4 interaction has been described previously (29). The biotinylated anti-CD4, anti-CXCR4, and anti-CCR5 mAbs were purchased from BD Pharmingen. The anti-CD4 v4-PE mAb (IgG1) that does not react with the gp120 binding site was from BD Biosciences. Anti-CD9 mAbs (VJ1/20, VJ1/10, VJ1/8, and GR2110) and anti-CD147 (VJ1/9; IgG1) have been described previously (30, 31). Anti-CD81 (IgG1) mAbs 5A6 and I33.2.2 were provided by Dr. S. Levy (Stanford University, Stanford, CA) and Dr. R. Vilella (Hospital Clinic, Barcelona, Spain), respectively. The anti-CD3 OKT3 mAb was a gift from B. Alarcón (Centro de Biología Molecular, Madrid, Spain). The goat anti-mouse IgG (whole molecule) was purchased from Sigma-Aldrich. Secondary Abs Alexa488-anti-mouse IgG and Streptavidin-RhodamineRed-X were purchased from Molecular Probes. Anti-CD45 D3/9 (IgG1) mAb has been described previously (32). Anti-vimentin mAb clone VIM 13.2 was purchased from Sigma-Aldrich.

The fluorescent cell trackers Calcein-AM, Cell Tracker Orange 5-((and-6)-(4-chloromethyl-benzoyl-amino)tetramethylrhodamine)-mixed isomers (CMTMR), and Cell Tracker Blue 7-amino-4-chloromethylcoumarin (CMAC) were from Molecular Probes. The fusion inhibitor peptide T20 was from Roche Diagnostics. Recombinant human IL-2 was provided by the National Institutes of Health AIDS Research and Reference Reagent Program 2002–2003.

The wild type-CD9-GFP and wild type-CD81-GFP constructs have been described previously (16, 33). These expression vectors were transfected in CEM and HeLa P5 cells by electroporation or nucleofection, following the manufacturer’s instructions. Immunofluorescence and cell-to-cell fusion experiments were performed 24 h after transfection.

Cells and cell cultures

The human T cell line CEM 1.3 and the HIV-1 envelope (Env)-HxBc2 expressing Jurkat T cell (Jurkat HxBc2; provided by the National Institutes of Health AIDS Research and Reference Reagent Program 2002–2003) were cultured in RPMI 1640 culture medium supplemented with 10% FCS. The HeLa P5 cell clone, stably transfected with human CD4 and CCR5-GFP cDNA and an HIV-LTR-driven beta-gal reporter gene (34, 35), were provided by Dr. M. Alizon (Hôpital Cochin, Paris, France). HeLa 243 and HeLa ADA cells, also provided by Dr. M. Alizon, coexpress Tat and Env HIV-1 proteins (34, 35, 36). Env proteins of HeLa 243 and HeLa ADA cells are X4- and R5-tropic, respectively. PBMC from healthy donors were isolated by Ficoll-Hypaque gradient centrifugation and cultured for 2 days in RPMI 1640 medium supplemented with 10% FCS in the presence of PHA (5 µg/ml). Then, isolated T lymphoblasts were maintained with recombinant human IL-2 (50 U/ml) for 5 days.

Flow cytometry analysis

Cells were washed and incubated with anti-tetraspanins mAbs or biotinylated anti-CXCR4 mAb, anti-CCR5 mAb, and anti-CD4 mAb for 20 min at room temperature. After washing with PBS, cells were incubated with streptavidin-R-PE or a goat anti-mouse IgG labeled with PE (Molecular Probes) for 15 min, washed again, and analyzed by flow cytometry.

Immunofluorescence and confocal images

HeLa, CEM 1.3, or HxBc2 T cells were fixed for 3 min in 3% paraformaldehyde in PBS, and immunostained for CD9 and CD81, as described previously (30). Then, cells were visualized using a Leica DMR photomicroscope (Leica) and a Leica TCS-SP confocal microscope. The intensity color-coded image was obtained with Leica software, and fluorescence intensity histograms were generated by ImageJ from National Institutes of Health web site. In capping experiments, cells were treated with 7 µg/ml recombinant gp120 (National Institutes of Health AIDS Research and Reference Reagent Program 2002–2003) 90 min before fixation and labeling with an anti-CD4 v4-PE mAb. Double staining immunofluorescences were blocked with nonimmune mouse serum before second primary Ab. To avoid cross-talk between the different Abs used, primary Abs for staining were directly conjugated with the fluorocrome or biotin.

Western blot analysis

Cells were lysed in 1% Nonidet P-40 in PBS with protease inhibitors (Roche Diagnostics) for 30 min at 4°C. Then, cell lysates were run in 12% SDS-PAGE and immunoblotted for CD81 and vimentin.

HIV-1 Env-mediated cell-to-cell fusion assay

Double fluorescence cell fusion assay was performed as described previously (37). Briefly, CMTMR-loaded Jurkat HxBc2 cells expressing X4-tropic HIV-1 HxBc2-Env were cocultured with CEM 1.3 cells labeled with Calcein-AM. Fused cells were detected 16 h later by flow cytometry as double-stained cells. Percentage of fusion is calculated as 100 x UR/UL, where UR is the percentage of double stained cells and UL is the percentage of single stained CMTMR+ cells (see Fig. 2A). Cells were trypsinized previous to flow cytometry analysis to disrupt cellular aggregates. When indicated, cells were preincubated with the anti-CD4 HP2/6 mAb.


Figure 2
View larger version (56K):
[in this window]
[in a new window]
 
FIGURE 2. Engagement of CD81 increases syncytia formation of lymphoid cell lines. A, Target CEM 1.3 T cells or primary human T lymphoblasts were preincubated or not for 30 min at 37°C with 5 µg/ml purified anti-CD4 (HP2/6), anti-CD81 (5A6 and I.33.2.2), or anti-CD147 (VJ1/9) mAb. Then, HxBc2 T cells were added and incubated for either 7 or 14 h. Syncytia formation was quantified by flow cytometry and represented as the mean fold induction respect to no Ab ± SD of three independent experiments performed by duplicate. *, p < 0.05 compared with cells with no Ab (Student’s t test). The dot plot shows a prototype experiment, in which UR gated cells correspond to double-stained syncytia population. B, Representative phase contrast micrographs of syncytia formed at 14 h of incubation between mAb-pretreated target CEM cells and HxBc2 Env+ cells. Images were acquired with a x10 objective. Bars, 50 µm. C, T lymphoblasts untreated or treated with soluble anti-CD81 (5A6) mAb in suspension were infected with fully competent HIV-1 NL4-3. Cell-free supernatants were harvested at 24, 48, and 72 h postinfection. Virus production was measured by p24-ELISA, and it is represented as the mean fold induction respect to untreated T lymphoblasts ± SD of three independent experiments performed by triplicate. *, p < 0.05 compared with untreated T lymphoblasts (Student’s t test). D, The enhancing effect on virus production is also observed when the anti-CD81 (5A6) mAb is cross-linked by anti-mouse IgG coated to the plate, either alone or in combination with an anti-CD3 (OKT3). Fold induction of a representative experiment measured at 72 h and performed by triplicate ± SD is shown. E, Clustering of CD81 and CD4 induced by anti-CD81 5A6 mAb. CEM 1.3 cells were preincubated for 30 min with 5 µg/ml purified anti-CD45 D3/9 (used as control Ab) or anti-CD81 5A6 mAbs. Then, HxBc2 Env+ cells were added and incubated for another 3 h. After incubation, cells were fixed and stained either with FITC-anti-CD81 plus biotinylated anti-CD4 mAb (upper panel) or Alexa488-anti-mouse IgG plus biotinylated anti-CD4 mAb (lower panel). Finally, samples were stained with Streptavidin-RhodamineRed-X to detect biotinylated anti-CD4 mAb. A representative confocal section of each staining and the merged image are shown. Asterisks at DIC images depicted Env+ cells. Bars, 10 µm.

 
beta-galactosidase cell fusion assay was performed as described previously (37). Briefly, HeLa 243 or HeLa ADA cells were coincubated with HeLa P5 cells in 96-well plates at a 1:1 ratio for 16 h. Only when gp120/gp41-mediated fusion occurs, Tat protein present in the cytoplasm of HeLa Env+ cells transactivates LTR promoter at HeLa P5 nuclei. For syncytia detection, cells were fixed with 0.5% glutaraldehyde and stained with the beta-galactosidase substrate 5-bromo-4-chloro-3-indoyl-beta-D-galactopyranoside (X-Gal), as described previously (34). X-Gal blue staining allows an overview of the extent of syncytia formed. For a quantitative measurement of syncytia formation, cells in parallel experiments were washed, lysed (50 µl of lysis buffer), and beta-galactosidase enzymatic activity was evaluated by chemiluminiscence, using a kit that couples both beta-galactosidase and luciferase activity (beta-gal reporter gene assay; Roche Diagnostics).

HIV-1 entry and infection

HIV-1NL4.3 entry and infection were assayed in HeLa P5 cells as described previously (38). Briefly, HIV-1NL4.3 infection of HeLa P5 cells was conducted in 96-well plates for 5 h at 37°C. When indicated, cells were pretreated with the anti-CD4 HP2/6 mAb (10 µg/ml). Then, virus was removed by washing (PBS) and subsequent trypsination (5 min, 37°C) of infected cells. HeLa P5 cells were cultured for another 3 days before lysis and beta-galactosidase activity determination.

Human T lymphoblasts (106 cells) stimulated for 5 days with IL-2 were infected for 3 h at 37°C in 96-well plates in the presence of the different Abs in suspension or in precoated plates cross-linked by goat anti-mouse IgG (20 µg/ml), anti-CD3 (clone OKT3 at 0.5 µg/ml), and anti-CD81 (5A6 at 4 µg/ml). Then, virus was removed by washing (PBS) of infected cells. Cell-free supernatants were harvested at 24, 48, and 72 h and assayed for p24 contents by ELISA (INNOTEST HIV-1 Ag mAb; Innogenetic). Viral particles from cell-free supernatants were also quantified by COBAS Ampliprep/COBAS Amplicor HIV-1 monitor test (Roche Diagnostics), which specifically amplifies the viral gene pol.

siRNA assay

To knockdown the expression of specific tetraspanins, the RNA duplexes targeting the silencing sequences CAATTTGTGTCCCTCGGGC and CACCTTCTATGTAGGCATC (Ambion) for CD81 and ACCTTCACCGTGAAGTCCT and GAGCATCTTCGAGCAAGAAA for CD9 (16) were used. A double-stranded siRNA designed by Eurogentec, which does not pair with any eucaryotic mRNA, was used as control. siRNA was transfected in CEM 1.3 cells by electroporation or nucleofection, and HeLa P5 cells were transfected with oligofectamine (Invitrogen Life Technologies), following the manufacturer’s instructions. The kinetics of silencing were followed by FACS analysis. The highest interferences were achieved 20 h after transfection for CEM 1.3 cells and 3 days postoligotransfection for HeLa P5 cells. To enrich the tetraspanin low-expressing population, the siRNA-treated cells were negatively selected with anti-CD81 magnetic coated beads (Dynabeads M450 goat anti-mouse IgG; Dynal Biotech) for 5 min at 4°C under rotation. These cells were counted and used for the fusion assays and analyzed by flow cytometry to assess the expression of tetraspanins, CD4, CCR5, and CXCR4.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
CD81 localizes at cellular contacts during syncytia formation induced by gp120/gp41

It has been reported that CD81 is associated with CD4 (39, 40) and that provides a costimulatory signal that increases HIV-1 gene expression (41). To determine the possible role of CD81 in HIV-1-mediated cell-to-cell fusion, we first analyzed its expression in CEM1.3 cells (Fig. 1A). This T cell line expressed significant levels of CD81 but null levels of CD9. Then, the subcellular localization of CD81 and CD4 was studied in T lymphocytes exposed to HIV-1 and during syncytia formation. We found that in CEM 1.3 cells and T lymphoblasts exposed to HIV-1 virions, CD4 and CD81 were concentrated at the area of viral contact, a phenomena called capping (38, 42) (Fig. 1C and data not shown). However, CD147, a molecule expressed at comparable levels as CD81 in these cells (data not shown), remained evenly distributed. Thus, CD81 coclustered with CD4 when it is engaged by gp120. On the other hand, before the exposure to the virus, both CD4 and CD81 were uniformly distributed along the plasma membrane (Fig. 1C, upper panel). In addition, when target CEM 1.3 cells contacted with cells expressing gp120/gp41 of HIV-1 (Jurkat HxB2c cells), CD81 accumulated at the areas of intercellular contact, where membrane fusion events occur. The intensity color-coded image and the histogram revealed that the staining in the area of cell contact is brighter than the expected one for two apposed membranes (Fig. 1B). Hence, tetraspanin CD81 appeared to gather where gp120/gp41 engages with CD4 during both virus-cell attachment and syncytia formation. Since both Env+ and target cells express CD81, to confirm that tetraspanins on target cells were accumulating at cell-to-cell contacts, CEM cells were transfected with cDNAs coding for CD9-GFP and CD81-GFP and incubated with Env+ cells. The exogenous tetraspanins were also recruited toward gp120/gp41, together with CD4 (Fig. 1D), verifying that tetraspanins on the target plasma membrane localized toward Env+ cells.


Figure 1
View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 1. CD81 localizes at areas where gp120/gp41 interacts with CD4. A, CEM 1.3 T cells were stained with the anti-CD9 VJ1/20 (blue line) or the anti-CD81 I.33.2.2 (green line) mAbs or the negative control X63 (gray line) and analyzed by flow cytometry. B, Localization of CD81 during cell-to-cell fusion induced by gp120/41. Target CEM 1.3 cells were incubated for 3 h with CMAC-blue-labeled Env+ HxBc2 cells and fixed and stained with the I33.2.2 anti-CD81 mAb (green fluorescence). Corresponding merged images of DIC and CMAC staining are shown. CD81 staining is also shown in an intensity color-coded image, and the histogram analyzes fluorescence intensity along the line depicted on the image. Bar, 10 µm. C, Induction of capping of CD81 and CD4 by free HIV-1 virions. CEM 1.3 cells were incubated with HIV-1 virions for 90 min and fixed and stained with an anti-CD4 or anti-CD147 (red fluorescence) and anti-CD81 (green fluorescence) mAb. CEM 1.3 cells prior virus exposure are shown in the upper panel. Merged and DIC images are also shown. Bars, 10 µm. D, Exogenous tetraspanins are redistributed to the cell-to-cell contacts. Target CEM 1.3 cells transiently transfected with GFP, CD9-GFP, and CD81-GFP constructs were incubated for 3 h with CMAC-labeled HxBc2 cells (blue). Then, cells were fixed and stained with the HP2/6 anti-CD4 mAb (red fluorescence). Corresponding merged images of differential interference contrast (DIC) and CMAC as well as merged fluorescence images are shown. Arrows depict heterotypic cell contacts. Bars, 10 µm.

 
Anti-CD81 Abs enhance lymphocyte membrane fusion induced by HIV-1 Env

To explore the possible functional role of CD81, we analyzed syncytia formation in the presence of different mAb against this tetraspanin. We observed that 5A6 anti-CD81 mAb increased HIV-1-mediated-cell fusion and favored the formation of large syncytia between either CEM 1.3 or primary human T lymphoblasts and HxB2c cells (Fig. 2A). However, quantitative flow cytometry data did not reflect the strong enhancing effect of both 5A6 and I33.2.2 anti-CD81 mAbs on syncytia formation that can be visualized by microscopy (Fig. 2B). Indeed, these Abs induced such large syncytia in overnight incubations that these giant multinucleated cells could not enter the capillar of the flow cytometer. Therefore, analyses at shorter incubation times were conducted to obtain a quantitative measurement of anti-CD81 effect (Fig. 2A). At 7 h, there is little syncytia formation in the absence of Abs. However, when an anti-CD81 Ab is added, a great proportion of cells had already undergone membrane fusion induced by gp120/gp41. This effect was specific of CD81 binding since the presence of an isotype control Ab VJ1/9, that recognizes CD147, did not exert any significant effect (Fig. 2, A and B). As expected, syncytia formation was prevented by either a blocking anti-CD4 Ab or the fusion inhibitor peptide T-20, indicating that this process depends on CD4-gp120 interaction (Fig. 2, A and B, and data not shown). To verify that this observation was not a consequence from a possible aggregating effect of the Abs, cells were incubated simultaneously with T20 and anti-CD81 mAbs. Syncytia formation was blocked at levels comparable to negative control (anti-CD4) (data not shown). Hence, Ab engagement of CD81 facilitates syncytia formation that is dependent on CD4/gp120 interaction.

Next, the possible effect of anti-CD81 mAb (5A6) in viral entry was assayed in primary human T cells. T lymphoblasts isolated from healthy donors were infected with the X4-tropic HIV-1 NL4–3 viral strain in the presence or absence of 5A6 mAb. Cells were treated with the Abs before virus addition to target early viral entry events. Supernatants were harvested at 24, 48, and 72 h, and viral production was evaluated by both ELISA and quantitative RT-PCR. Engagement of CD81 was sufficient to increase virus production at every time point (Fig. 2C and data not shown). Likewise, an increase in virus production was observed with cross-linked Abs coated to the plate, not only when the anti-CD3 was present, but also when T lymphoblasts were incubated with 5A6 mAb either alone or combined with anti-CD3 (Fig. 2D).

On the other hand, we observed that CD81 engagement induced a significant clustering of this tetraspanin together with CD4 and CXCR4 (Fig. 2E and data not shown). This effect was observed in both conjugated and isolated cells. This preclustering might facilitate the interaction of gp120 and CD4 and CXCR4, allowing more rapid and effective membrane fusion events.

Effect of knocking-down CD81 expression on syncytia formation

Expression of CD81 in CEM target cells was specifically reduced by siRNA oligonucleotides. Interference in CEM 1.3 cells was maximal at 20 h posttransfection, and CD81 expression was decreased greatly as determined by both flow cytometry and Western blot analysis (Fig. 3, A and B). CEM 1.3 cells silenced for CD81 had similar levels of CD4 and CXCR4 than control cells (Fig. 3B). These cells showed enhanced syncytia formation with HXB2c Env+ cells. Anti-CD4 and the fusion inhibitor T20 blocked syncytia formation both in cells interfered with the negative control or anti-CD81 oligonucleotide (Fig. 3C). Remarkably, interference of CD81 expression in target cells did not affect CD4 or CD81 redistribution to cellular contacts (CD81 mainly expressed on Env+ cells) (Fig. 3D) or their capping to viral-cell synapses (data not shown). Thus, CD81 interference does not seem to alter CD4 subcellular localization to both cell-to-cell and virus-cell contacts but enhances cell-to-cell membrane fusion.


Figure 3
View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 3. Interference of CD81 in CEM target cells increases syncytia formation induced by gp120. A, CD81 knocking-down was assessed by Western blot analysis in total cell lysates with anti-CD81 5A6 mAb. Vimentin signal is shown as load control. B, CD4, CXCR4, and CD81 expression was assessed by flow cytometry in CEM 1.3 T cells transfected with the negative control siRNA or CD81 siRNA oligonucleotides. Data represent the mean fluorescence intensity with respect to negative control siRNA oligonucleotide-transfected cells ± SD in three independent experiments performed by duplicate. *, p < 0.05 compared with negative control siRNA-treated cells (Student’s t test). C, Silencing CD81-enhanced syncytia formation. Negative control siRNA- or CD81 siRNA oligonucleotide-transfected target CEM 1.3 cells were incubated for 14 h with HxBc2 Env+ cells. Syncytia formation was quantified by flow cytometry and represented as the mean fold induction with respect to negative siRNA oligonucleotide-transfected cells ± SD of three independent experiments performed by duplicate. As a control, syncytia formation was completely abrogated in the presence of 10 µg/ml purified anti-CD4 (HP2/6) or 10 nM T20. *, p < 0.05 compared with negative control siRNA-treated cells (Student’s t test). D, CD81 and CD4 localization during syncytia formation between negative control siRNA or CD81 siRNA oligonucleotides transfected CEM 1.3 T cells and CMAC blue-labeled HxBc2 T cells. After 3 h of incubation, syncytia were fixed and stained with anti-CD81 I.33.2.2 mAb and biotinylated anti-CD4 mAb. Corresponding merged images of differential interference contrast (DIC) and the blue CMAC probe are shown. Arrows depict heterotypic contacts. Bars, 10 µm.

 
Role of CD9 and CD81 in the cell fusion induced by gp120/41 in a HeLa cellular model

It has been reported that HeLa P5 target cells (which express CD4, CXCR4, and CCR5 and possess the beta-galactosidase reporter gene controlled by HIV LTR promoter) and Env+ cells (which harbor the HIV promoter transactivator Tat) constitute a highly reproducible model to analyze the preliminary steps of the membrane fusion process induced by gp120/gp41 (34, 35, 43). In addition, these HeLa clones express both CXCR4 and CCR5, thus allowing investigation of syncytia formation induced by both T- and M-tropic gp120. We found that these HeLa clones expressed comparable levels of tetraspanins CD9 and CD81 (Fig. 4A). In these cells, CD9 and CD81 were evenly distributed and redistributed to the cellular contacts between HeLa P5 cells and HeLa Env+, where CD4, CXCR4, and CCR5 were also present (Fig. 4B and data not shown). In agreement with our data with T cell lines, both anti-CD81 and anti-CD9 Abs increased syncytia formation between HeLa P5 and HeLa Env+ cells but not the isotype control Ab VJ1/9 (Fig. 4C). Furthermore, HeLa P5 target cells with a diminished expression of CD9 and CD81 (40–60% reduction induced by siRNA; Fig. 5, A and B), but normal levels of CD4, CXCR4, and CCR5 (Fig. 5C) showed increased syncytia formation (Fig. 5, D and E). CD81 silencing mainly enhanced the X4-tropic fusion system, whereas CD9 silencing exerted a higher effect in the R5-tropic fusion system. Control experiments demonstrated that syncytia formation was dependent on the interaction of CD4 and gp120/gp41 as it was completely abrogated by a blocking anti-CD4 Ab (Fig. 5, D and E). In agreement with these data, we found that HeLa P5 cells with a deficient expression of CD9 and CD81 were more susceptible to HIV-1NL4–3 viral entry (Fig. 6).


Figure 4
View larger version (66K):
[in this window]
[in a new window]
 
FIGURE 4. CD9 and CD81 localize at cell-to-cell contacts and Abs anti-CD9 and anti-CD81 increase syncytia formation in a HeLa cell model. A, HeLa P5 cells were stained with the anti-CD9 VJ1/20 (blue line) or the anti-CD81 I.33.2.2 (green line) mAbs or the negative control X63 (gray line) and analyzed by flow cytometry. B, Localization of CCR5, CD9, and CD81 in the HeLa model during syncytia formation. Target HeLa P5 cells (CCR5-GFP+) were incubated for 3 h with HeLa Env+ cells and fixed and stained with anti-CD9 (VJ1/20) or anti-CD81 (I33.2.2) mAbs. Asterisks at differential interference contrast (DIC) images depicted Env+ cells. Fluorescence intensity is analyzed along the lines depicted and shown in histograms. Bars, 10 µm. C, Enhancing effect of anti-tetraspanin Abs in syncytia formation. HeLa P5 target cells were preincubated or not for 30 min at 37°C with 10 µg/ml purified anti-CD4 (HP2/6) and 5 µg/ml anti-CD9 (VJ1/20, VJ1/10, VJ1/8, and GR2110), anti-CD81 (5A6 and I.33.2.2), or anti-CD147 (VJ1/9) mAbs. Then, HeLa Env+ ADA cells were added and incubated for 14 h. Syncytia formation was quantified by beta-galactosidase activity and represented as the mean fold induction respect to no Ab ± SD of six independent experiments performed by triplicate. *, p < 0.05 compared with cells treated with no mAb (Student’s t test).

 

Figure 5
View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 5. Effect of silencing CD9 and CD81 in syncytia formation of HeLa cells. A, HeLa P5 cells transfected with the negative siRNA control (black line) CD9 siRNA or CD81 siRNA oligonucleotides (green line) were stained with the anti-CD9 VJ1/20 or the anti-CD81 I.33.2.2 mAbs or the negative control X63 (dotted line) and analyzed by flow cytometry. B, CD9 and CD81 knocking-down was also assessed by Western blot analysis in total lysates with the anti-CD9 VJ1/20 or the anti-CD81 5A6 mAb. Vimentin signal is shown as load control. C, CD4, CXCR4, and CCR5 expression was determined by flow cytometry in HeLa P5 cells transfected with the negative siRNA control, CD9 siRNA, or CD81 siRNA oligonucleotides. Data represent the mean fluorescence intensity respect to negative siRNA control oligonucleotide-transfected cells ± SD of five independent experiments. D, X-Gal staining of syncytia formed between negative siRNA control, CD9 siRNA, or CD81 siRNA oligonucleotide-transfected HeLa P5 cells and HeLa ADA (R5-tropic) or 243 (X4-tropic) cells. After 14 h of incubation, syncytia were fixed and stained with X-gal. Representative phase contrast micrographs acquired with a x10 objective are shown. Bars, 100 µm. E, Negative siRNA control, CD9 siRNA, or CD81 siRNA oligonucleotide-transfected target HeLa P5 cells were incubated for 14 h with HeLa ADA (R5-tropic) or 243 (X4-tropic) cells. Syncytia formation was quantified by beta-galactosidase activity and represented as the mean fold induction respect to negative siRNA oligonucleotide-transfected cells ± SD of five independent experiments performed by triplicate. As a control, syncytia formation was completely abrogated in the presence of 10 µg/ml purified anti-CD4 (HP2/6). *, p < 0.05 compared with negative control siRNA-treated cells (Student’s t test).

 

Figure 6
View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 6. Effect of CD9 and CD81 knocking-down on HIV-1 entry in the HeLa model. Negative siRNA control, CD9 siRNA, or CD81 siRNA oligonucleotide-transfected HeLa P5 cells were incubated for 3 h with free HIV-1 NL4-3 virions (X4-tropic). Viral entry was quantified by beta-galactosidase activity and represented as the mean fold induction respect to negative siRNA oligonucleotide-transfected cells ± SD of three independent experiments performed by triplicate. As a control, syncytia formation was completely abrogated in the presence of 10 µg/ml purified anti-CD4 (HP2/6), and no beta-galactosidase activity was observed in cells without free HIV-1 virions. *, p < 0.05 compared with negative control siRNA-treated cells (Student’s t test).

 
On the other hand, HeLa P5 target cells overexpressing CD9-GFP or CD81-GFP formed a lower number of syncytia with HeLa Env+ cells than those transfected with GFP (Fig. 7). As in CD9 and CD81 siRNA, tetraspanin overexpression did not affect CD4, CXCR4, and CCR5 levels (data not shown). Therefore, knocking-down CD9 and CD81 expression in target cells enhances cell-to-cell membrane fusion, whereas increasing their expression reduces this phenomenon.


Figure 7
View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 7. Effect of overexpression of CD9 and CD81 on syncytia formation. Target HeLa P5 cells were transfected with GFP, CD9-GFP, or CD81-GFP and incubated with HeLa Env+ cells for 14 h. Syncytia formation was quantified by beta-galactosidase activity and represented as the mean fold induction respect to GFP-transfected cells ± SD of three independent experiments performed by triplicate. As a control, syncytia formation was completely abrogated in the presence of 10 µg/ml purified anti-CD4 (HP2/6). *, p < 0.05 compared with GFP-transfected cells (Student’s t test).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
One of the mechanisms for CD4+ T cell depletion by HIV is through the induction of short-lived syncytia (44). Given that viruses depend on their host cells to replicate and spread, surface protein distribution and intracellular activation state of target cells may affect the efficiency of infection. Tetraspanins are proteins involved in a wide range of cellular and viral processes, particularly fusion events (21, 22, 23, 24, 25, 26, 27, 28, 45). Tetraspanins may also regulate preliminary steps of viral cycle due to their function as molecular organizers of cellular membrane protein microdomains (13). In this report, we provide evidence for the involvement of CD9 and CD81 in virus-cell and cell-to-cell gp120/gp41-mediated fusion. CD81 is the major tetraspanin expressed in T cells and is constitutively associated to CD4 (39, 40). During syncytia formation, CD81 is recruited toward cell-to-cell contacts where gp120 interacts with its cell receptor and coreceptor. CD81 also relocalized in response to free HIV-1 viral particles together with CD4. The enhancing effect of knocking-down CD81 expression is more significant in the X4-tropic-mediated membrane fusion in all the experimental models tested. In the case of CD9, knockdown experiments were performed in HeLa cells because the T cell lines analyzed expressed low or null levels of this tetraspanin. However, the role of CD9 may be very important in macrophages, the main target cells for R5-tropic HIV-1, which up-regulate the expression of this tetraspanin during their differentiation (46). Therefore, the enhancing effect of CD9 or CD81 silencing is more significant depending on the viral tropism, which correlates with the in vivo expression of these tetraspanins in target cells. Accordingly, a previous report has suggested differences between the fusion mechanism triggered by CXCR4 and CCR5 (47).

Most of previous studies on the effect of tetraspanin blockade reported that anti-CD9 and anti-CD81 Abs inhibit fusion of gametes, myoblasts, virus-infected cells, and virus-induced cell-to-cell fusion (22, 27, 28, 40, 48, 49). However, in agreement with our data, it has been reported that the fusion of monocytes and alveolar macrophages is promoted by anti-CD9 and -CD81 Abs and enhanced in CD9- and CD81-null mice macrophages (22). It is very likely that the preclustering of CD81 with CD4 and CXCR4 induced by anti-CD81 Abs may facilitate the gp120/gp41-mediated membrane fusion, explaining the enhancing effect that they produced in syncytia formation. It has been reported that CD81 engagement increases HIV-1 gene expression due to the transcriptional activation of HIV-1 provirus, a late step in virus infection cycle (41). However, it is evident that this mechanism cannot account for the enhancing effect observed by us because our experimental system was designed to discriminate the virus-induced membrane fusion process from other processes triggered by HIV-1 thereafter. These authors also reported a cooperation of CD81 engagement with CD3 stimulation in virus production when the Abs were added to already infected cells (41). Nevertheless, they did not observe the enhancing effect when cells are in the presence of the anti-CD81 mAb alone. Our data show that anti-CD81 mAb induces an enhanced HIV viral production both alone and cross-linked by anti-IgG, and it therefore could be due to CD81 engagement before viral exposure.

On the other hand, the effect of these Abs cannot be linked to a possible aggregating consequence as cells were trypsinized before flow cytometer data acquisition to dissociate unspecific cellular aggregates, and the fusion inhibitor T20 is able to block the enhancing effect of the Abs. Moreover, mAbs with different aggregation properties (VJ1/20 and VJ1/10) exerted the same enhancing effect (31).

Our data show, in two different cellular models, that Env-mediated cell-to-cell membrane fusion is enhanced by silencing CD9 or CD81 expression using siRNA treatment of target cells. This effect is specific for CD9 and CD81 since we found that interference of other tetraspanin, CD151, partially inhibited Env-induced membrane fusion and had no effect in viral entry. CD151 is also recruited to cell-to-cell contacts but its expression is lower than that of CD9 and CD81 in the cellular model used (M. Gordon-Alonso and M. Yáñez-Mó, unpublished observations). In addition, another specific siRNA oligonucleotide directed against different target sequences of either CD9 or CD81 confirmed the data presented (data not shown).

CD9 and CD81 could affect HIV-1-induced membrane fusion by different pathways: indirectly, due to enhanced T cell or LFA-1 activation, or directly, organizing associated proteins on the cell membrane such as CD4 and gp120 coreceptors. In this regard, it has been described that anti-CD81 mAb activate LFA-1 (50, 51), which has been described as an enhancer of HIV-1 infection and syncytia formation (52, 53). Although we could not rule out a role for LFA-1 in this process, the enhancing effect of anti-CD81 mAb also occurs in the HeLa cell system, where there is no expression of LFA-1. In addition, the effect of CD81 engagement in CEM 1.3-HxBc2 membrane fusion is not inhibited by the LFA-1 blocking molecule, BIRT 377 (54) (M. Gordon-Alonso and M. Yáñez-Mó, unpublished observations). On the other hand, tetraspanins are involved in different signaling pathways in T cells as the activation of protein kinase C (41, 55). Accordingly, CD81 ligation by mAbs stimulates T cell activation, and it is known that activated lymphocytes are easily infected by HIV-1 (41, 50, 56). Another possibility is that CD81 alters actin organization in viral synapses through the regulation of integrin function (15). Actin remodeling is essential for the fusion process (57, 58, 59) and is required for the recruitment of membrane molecules into clusters where fusion events take place. We and others (3, 60, 61) have observed a ring of actin at viral synapses, and drugs that disrupt actin network inhibit membrane fusion. However, no difference in actin remodeling has been observed between CEM 1.3 cells interfered with the control oligonucleotide or with the CD81siRNA conjugated with HxBc2. Therefore, according to our results and previous reports, the alteration of the membrane protein microdomains, where CD4 is included, due to diminution of tetraspanin expression or by engagement with anti-tetraspanin Abs, seems to be the most likely mechanism for the effects observed. Thus, although the reduction in CD9 or CD81 expression by siRNA does not affect the level of expression of CD4 nor its subcellular localization, it may alter its association with gp120 coreceptors (CXCR4 or CCR5) or CD4 presentation to gp120 in a more subtle way. We think that given that CD81 is constitutively associated with CD4, the engagement of CD81 with Abs or its reduction of expression might disrupt CD81-CD4 associations. Under such conditions, a higher number of CD4 molecules would be available to associate with CXCR4 or CCR5, forming useful complexes for gp120/gp41-induced membrane fusion. In addition, CD4 not associated with CD81 might interact more readily with gp120 viral protein.

It is evident that the understanding of HIV-1-induced membrane fusion could yield interesting therapeutic strategies to directly block the infection and to inhibit other important transmission pathways such as viral cell-to-cell spreading. Our results show that the levels of expression of CD9 and CD81 or its engagement with Abs on target cells alters HIV-1-induced cell-to-cell fusion and HIV-1 entry. Therefore, this work provides further evidence on the relevance of target cells in HIV-1 virus transmission and supports the feasibility of therapeutic strategies directed to induce less susceptible host cells.


    Acknowledgments
 
We thank Dr. R. González-Amaro for helpful reading of the manuscript and the Servicio de Virología del Hospital Universitario de la Princesa (Madrid, Spain) for performing the quantitative pol-specific RT-PCR assays.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 F.S.-M. is supported by Ministerio de Educación y Ciencia Grant BFU2005-08435/BMC, Fundación para la Investigación y Prevención del SIDA en España (FIPSE) Grants 36289/02 and 24508/05, Lilly Foundation, and "Ayuda a la Investigación Básica 2002 de la Fundación Juan March." A.V.-F. is supported by grants from FIPSE 24508/05 and PI050995 from Fondo de Investigación Sanitaria, Instituto de Salud Carlos III, Ministerio de Sanidad y Consumo. Back

2 Current address: Departamento de Medicina Física y Farmacología, Facultad de Medicina, Universidad de La Laguna, 38071 Tenerife, Spain. Back

3 Address correspondence and reprint requests to Dr. Francisco Sánchez-Madrid. Servicio de Inmunología. Hospital Universitario de la Princesa. Diego de León 62, 28006 Madrid, Spain. E-mail address: fsanchez.hlpr{at}salud.madrid.org Back

4 Abbreviations used in this paper: Env, envelope viral protein; FIV, feline immunodeficiency virus; HTLV-1, human T cell leukemia virus type 1; LEL, large extracellular loop; siRNA, short interference RNA; X-gal, 5-bromo-4-chloro-3-indoyl-beta-D-galactopyranoside. Back

Received for publication January 12, 2006. Accepted for publication July 14, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Moore, J., A. Trkola, T. Dragic. 1997. Co-receptors for HIV-1 entry. Curr. Opin. Immunol. 9: 551-562. [Medline]
  2. Doms, R., D. Trono. 2000. The plasma membrane as a combat zone in the HIV battlefield. Genes Dev. 14: 2677-2688. [Free Full Text]
  3. Gallo, S. A., C. M. Finnegan, M. Viard, Y. Raviv, A. Dimitrov, S. S. Rawat, A. Puri, S. Durell, R. Blumenthal. 2003. The HIV Env-mediated fusion reaction. Biochim. Biophys. Acta 1614: 36-50. [Medline]
  4. Poli, G., G. Pantaleo, A. S. Fauci. 1993. Immunopathogenesis of human immunodeficiency virus infection. Clin. Infect. Dis. 17: (Suppl. 1):S224-S229. [Medline]
  5. Collman, R. G., C. F. Perno, S. M. Crowe, M. Stevenson, L. J. Montaner. 2003. HIV and cells of macrophage/dendritic lineage and other non-T cell reservoirs: new answers yield new questions. J. Leukocyte Biol. 74: 631-634. [Abstract/Free Full Text]
  6. Larsson, M.. 2005. HIV-1 and the hijacking of dendritic cells: a tug of war. Springer Semin. Immunopathol. 26: 309-328. [Medline]
  7. McCune, J.. 2001. The dynamics of CD4+ T cell depletion in HIV disease. Nature 410: 974-979. [Medline]
  8. Alimonti, J. B., T. B. Ball, K. R. Fowke. 2003. Mechanisms of CD4+ T lymphocyte cell death in human immunodeficiency virus infection and AIDS. J. Gen. Virol. 84: 1649-1661. [Abstract/Free Full Text]
  9. LaBonte, J., T. Patel, W. Hofmann, J. Sodroski. 2000. Importance of membrane fusion mediated by human inmunodeficiency virus envelope glycoproteins for lysis of primary CD4-positive T cells. J. Virol. 74: 10690-10698. [Abstract/Free Full Text]
  10. Orenstein, J. M.. 2000. In vivo cytolysis and fusion of human immunodeficiency virus type 1-infected lymphocytes in lymphoid tissue. J. Infect. Dis. 182: 338-342. [Medline]
  11. Koot, M., I. P. Keet, A. H. Vos, R. E. de Goede, M. T. Roos, R. A. Coutinho, F. Miedema, P. T. Schellekens, M. Tersmette. 1993. Prognostic value of HIV-1 syncytium-inducing phenotype for rate of CD4+ cell depletion and progression to AIDS. Ann. Intern. Med. 118: 681-688. [Abstract/Free Full Text]
  12. Ou, W., Y. Xiong, J. Silver. 2004. Quantification of virus-envelope-mediated cell fusion using a tetracycline transcriptional transactivator: fusion does not correlate with syncytium formation. Virology 324: 263-272. [Medline]
  13. Levy, S., T. Shoham. 2005. The tetraspanin web modulates immune-signalling complexes. Nat. Rev. Immunol. 5: 136-148. [Medline]
  14. Hemler, M.. 2003. Tetraspanin proteins mediate cellular penetration, invasion, and fusion events and define a novel type of membrane microdomain. Annu. Rev. Cell Dev. Biol. 19: 397-422. [Medline]
  15. Berditchevski, F.. 2001. Complexes of tetraspanins with integrins: more than meets the eye. J. Cell Sci. 114: 4143-4151. [Abstract/Free Full Text]
  16. Barreiro, O., M. Yanez-Mo, M. Sala-Valdes, M. Gutierrez-Lopez, S. Ovalle, A. Higginbottom, P. Monk, C. Cabanas, F. Sanchez-Madrid. 2005. Endothelial tetraspanin microdomains regulate leukocyte firm adhesion during extravasation. Blood 105: 2852-2861. [Abstract/Free Full Text]
  17. Yanez-Mo, M., M. Mittelbrunn, F. Sanchez-Madrid. 2001. Tetraspanins and intercellular interactions. Microcirculation 8: 153-168. [Medline]
  18. Hemler, M.. 2001. Specific tetraspanin functions. J. Cell Biol. 155: 1103-1107. [Abstract/Free Full Text]
  19. Vogt, A. B., S. Spindeldreher, H. Kropshofer. 2002. Clustering of MHC-peptide complexes prior to their engagement in the immunological synapse: lipid raft and tetraspan microdomains. Immunol. Rev. 189: 136-151. [Medline]
  20. Stein, K. K., P. Primakoff, D. Myles. 2004. Sperm-egg fusion: events at the plasma membrane. J. Cell Sci. 117: 6269-6274. [Abstract/Free Full Text]
  21. Tachibana, I., M. Hemler. 1999. Role of transmembrane 4 superfamily (TM4SF) proteins CD9 and CD81 in muscle cell fusion and myotube maintenance. J. Cell Biol. 146: 893-904. [Abstract/Free Full Text]
  22. Takeda, Y., I. Tachibana, K. Miyado, M. Kobayashi, T. Miyazaki, T. Funakoshi, H. Kimura, H. Yamane, Y. Saito, H. Goto, et al 2003. Tetraspanins CD9 and CD81 function to prevent the fusion of mononuclear phagocytes. J. Cell Biol. 161: 945-956. [Abstract/Free Full Text]
  23. von Lindern, J., D. Rojo, K. Grovit-Ferbas, C. Yeramian, C. Deng, G. Herbein, M. R. Ferguson, T. Pappas, J. Decker, A. Singh, et al 2003. Potencial role for CD63 in CCR5-mediated HIV-1 infection of macrophages. J. Virol. 77: 3624-3633. [Abstract/Free Full Text]
  24. Pelchen-Matthews, A., B. Kramer, M. Marsh. 2003. Infectious HIV-1 assembles in late endosomes in primary macrophages. J. Cell Biol. 162: 443-455. [Abstract/Free Full Text]
  25. Pileri, P., Y. Uematsu, S. Campagnoli, G. Galli, F. Falugi, R. Petracca, A. Weiner, M. Houghton, D. Rosa, G. Grandi, S. Abrignani. 1998. Binding of hepatitis C virus to CD81. Science 282: 938-941. [Abstract/Free Full Text]
  26. Pique, C., C. Lagaudriere-Gesbert, L. Delamarre, A. Rosenberg, H. Conjeaud, M. Dokhelar. 2000. Interaction of CD82 tetraspanin proteins with HTLV-1 envelope glycoproteins inhibits cell-to-cell fusion and virus transmission. Virology 276: 455-465. [Medline]
  27. de Parseval, A., D. Lerner, P. Borrow, B. Willett, J. Elder. 1997. Blocking of feline immunodeficiency virus infection by a monoclonal antibody to CD9 is via inhibition of virus release rather than interference with receptor binding. J. Virol. 71: 5742-5749. [Abstract]
  28. Schmid, E., A. Zurbriggen, U. Gassen, B. Rima, V. ter Meulen, J. Schneider-Schaulies. 2000. Antibodies to CD9, a tetraspan transmembrane protein, inhibit canine distemper virus-induced cell-cell fusion but not virus-cell fusion. J. Virol. 74: 7554-7561. [Abstract/Free Full Text]
  29. Carrera, A. C., F. Sanchez-Madrid, M. Lopez-Botet, C. Bernabeu, M. O. De Landazuri. 1987. Involvement of the CD4 molecule in a post-activation event on T cell proliferation. Eur. J. Immunol. 17: 179-186. [Medline]
  30. Yanez-Mo, M., A. Alfranca, C. Cabanas, M. Marazuela, R. Tejedor, M. A. Ursa, L. K. Ashman, M. O. de Landazuri, F. Sanchez-Madrid. 1998. Regulation of endothelial cell motility by complexes of tetraspan molecules CD81/TAPA-1 and CD151/PETA-3 with {alpha}3beta1 integrin localized at endothelial lateral junctions. J. Cell Biol. 141: 791-804. [Abstract/Free Full Text]
  31. Yanez-Mo, M., R. Tejedor, P. Rousselle, F. Sanchez -Madrid. 2001. Tetraspanins in intercellular adhesion of polarized epithelial cells: spatial and functional relationship to integrins and cadherins. J. Cell Sci. 114: 577-587. [Abstract]
  32. Pulido, R., M. Cebrian, A. Acevedo, M. O. de Landazuri, F. Sanchez-Madrid. 1988. Comparative biochemical and tissue distribution study of four distinct CD45 antigen specificities. J. Immunol. 140: 3851-3857. [Abstract]
  33. Mittelbrunn, M., M. Yanez-Mo, D. Sancho, A. Ursa, F. Sanchez-Madrid. 2002. Cutting edge: dynamic redistribution of tetraspanin CD81 at the central zone of the immune synapse in both T lymphocytes and APC. J. Immunol. 169: 6691-6695. [Abstract/Free Full Text]
  34. Pleskoff, O., C. Treboute. 1997. Identification of a chemokine receptor encoded by human cytomegalovirus as a cofactor for HIV-1 entry. Science 276: 1874-1878. [Abstract/Free Full Text]
  35. Pleskoff, O., N. Sol, B. Labrosse, M. Alizon. 1997. Human immunodeficiency virus strains differ in their ability to infect CD4+ cells expressing the rat homolog of CXCR-4 (fusin). J. Virol. 71: 3259-3262. [Abstract]
  36. Schwartz, O., M. Alizon. 1994. Impairment of T cell receptor-dependent stimulation in CD4+ lymphocytes after contact with membrane-bound HIV-1 envelope glycoprotein. Virology 198: 360-365. [Medline]
  37. Valenzuela-Fernandez, A., J. Blanco, B. Krust, R. Franco, A. G. Hovanessian. 1997. Neutralizing antibodies against the V3 loop of human immunodeficiency virus type 1 gp120 block the CD4-dependent and -independent binding of virus to cells. J. Virol. 71: 8289-8298. [Abstract]
  38. Valenzuela-Fernandez, A., S. Alvarez, M. Gordon-Alonso, M. Barrero, A. Ursa, J. R. Cabrero, G. Fernandez, S. Naranjo-Suarez, M. Yanez-Mo, J. M. Serrador, et al 2005. Histone deacetylase 6 regulates human immunodeficiency virus type 1 infection. Mol. Biol. Cell 16: 5445-5454. [Abstract/Free Full Text]
  39. Imai, T., M. Kakizaki, M. Nishimura, O. Yoshie. 1995. Molecular analyses of the association of CD4 with two members of the transmembrane 4 superfamily, CD81 and CD82. J. Immunol. 155: 1229-1239. [Abstract]
  40. Imai, T., O. Yoshie. 1993. C33 antigen and M38 antigen recognized by monoclonal antibodies inhibitory to syncytium formation by human T cell leukemia virus type 1 are both members of the transmembrane 4 superfamily and associate with each other and with CD4 or CD8 in T cells. J. Immunol. 151: 6470-6481. [Abstract]
  41. Tardif, M. R., M. J. Tremblay. 2005. Tetraspanin CD81 provides a costimulatory signal resulting in increased human immunodeficiency virus type 1 gene expression in primary CD4+ T lymphocytes through NF-{kappa}B, NFAT, and AP-1 transduction pathways. J. Virol. 79: 4316-4328. [Abstract/Free Full Text]
  42. Dianzani, U., M. Bragardo, D. Buonfiglio, V. Redoglia, A. Funaro, P. Portoles, J. Rojo, F. Malavasi, A. Pileri. 1995. Modulation of CD4 lateral interaction with lymphocyte surface molecules induced by HIV-1 gp120. Eur. J. Immunol. 25: 1306-1311. [Medline]
  43. Chen, S., S. Lee, C. Chuang, V. Raj. 1999. Trans-dominant interference with human immunodeficiency virus type 1 replication and transmission in CD4+ cells by an envelope double mutant. J. Virol. 73: 8290-8302. [Abstract/Free Full Text]
  44. Andreau, K., J. L. Perfettini, M. Castedo, D. Metivier, V. Scott, G. Pierron, G. Kroemer. 2004. Contagious apoptosis facilitated by the HIV-1 envelope: fusion-induced cell-to-cell transmission of a lethal signal. J. Cell Sci. 117: 5643-5653. [Abstract/Free Full Text]
  45. Le Naour, F., E. Rubinstein, C. Jasmin, M. Prenant, C. Boucheix. 2000. Severely reduced female fertility in CD9-deficient mice. Science 287: 319-321. [Abstract/Free Full Text]
  46. Ouchi, N., S. Kihara, S. Yamashita, S. Higashiyama, T. Nakagawa, I. Shimomura, T. Funahashi, K. Kameda-Takemura, S. Kawata, N. Taniguchi, Y. Matsuzawa. 1997. Role of membrane-anchored heparin-binding epidermal growth factor-like growth factor and CD9 on macrophages. Biochem. J. 328: (Pt. 3):923-928. [Medline]
  47. Merat, R., H. Raoul, T. Leste-Lasserre, P. Sonigo, G. Pancino. 1999. Variable constraints on the principal immunodominant domain of the transmembrane glycoprotein of human immunodeficiency virus type 1. J. Virol. 73: 5698-5706. [Abstract/Free Full Text]
  48. Chen, M. S., K. S. Tung, S. A. Coonrod, Y. Takahashi, D. Bigler, A. Chang, Y. Yamashita, P. W. Kincade, J. C. Herr, J. M. White. 1999. Role of the integrin-associated protein CD9 in binding between sperm ADAM 2 and the egg integrin {alpha}6beta1: implications for murine fertilization. Proc. Natl. Acad. Sci. USA 96: 11830-11835. [Abstract/Free Full Text]
  49. Willett, B., M. Hosie, A. Shaw, J. Neil. 1997. Inhibition of feline immunodeficiency virus infection by CD9 antibody operates after virus entry and is independent of virus tropism. J. Gen. Virol. 78: (Pt. 3):611-618. [Abstract]
  50. Todd, S. C., S. G. Lipps, L. Crisa, D. R. Salomon, C. D. Tsoukas. 1996. CD81 expressed on human thymocytes mediates integrin activation and interleukin 2-dependent proliferation. J. Exp. Med. 184: 2055-2060. [Abstract/Free Full Text]
  51. VanCompernolle, S. E., S. Levy, S. C. Todd. 2001. Anti-CD81 activates LFA-1 on T cells and promotes T cell-B cell collaboration. Eur. J. Immunol. 31: 823-831. [Medline]
  52. Hioe, C. E., P. C. Chien, Jr, C. Lu, T. A. Springer, X. H. Wang, J. Bandres, M. Tuen. 2001. LFA-1 expression on target cells promotes human immunodeficiency virus type 1 infection and transmission. J. Virol. 75: 1077-1082. [Abstract/Free Full Text]
  53. Fortin, J. F., B. Barbeau, H. Hedman, E. Lundgren, M. J. Tremblay. 1999. Role of the leukocyte function antigen-1 conformational state in the process of human immunodeficiency virus type 1-mediated syncytium formation and virus infection. Virology 257: 228-238. [Medline]
  54. Kelly, T. A., D. D. Jeanfavre, D. W. McNeil, J. R. Woska, Jr, P. L. Reilly, E. A. Mainolfi, K. M. Kishimoto, G. H. Nabozny, R. Zinter, B. J. Bormann, R. Rothlein. 1999. Cutting edge: a small molecule antagonist of LFA-1-mediated cell adhesion. J. Immunol. 163: 5173-5177. [Abstract/Free Full Text]
  55. Maecker, H. T.. 2003. Human CD81 directly enhances Th1 and Th2 cell activation, but preferentially induces proliferation of Th2 cells upon long-term stimulation. BMC Immunol. 4: 1[Medline]
  56. Virelizier, J. L.. 1989. Cellular activation and human immunodeficiency virus infection. Curr. Opin. Immunol. 2: 409-413. [Medline]
  57. Jolly, C., K. Kashefi, M. Hollinshead, Q. Sattentau. 2004. HIV-1 cell to cell transfer across an Env-induced, actin-dependent synapse. J. Exp. Med. 199: 283-293. [Abstract/Free Full Text]
  58. Eitzen, G.. 2003. Actin remodeling to facilitate membrane fusion. Biochim. Biophys. Acta 1641: 175-181. [Medline]
  59. Pontow, S. E., N. V. Heyden, S. Wei, L. Ratner. 2004. Actin cytoskeletal reorganizations and coreceptor-mediated activation of rac during human immunodeficiency virus-induced cell fusion. J. Virol. 78: 7138-7147. [Abstract/Free Full Text]
  60. Sylwester, A., D. Wessels, S. A. Anderson, R. Q. Warren, D. C. Shutt, R. C. Kennedy, D. R. Soll. 1993. HIV-induced syncytia of a T cell line form single giant pseudopods and are motile. J. Cell Sci. 106: (Pt. 3):941-953. [Abstract]
  61. Iyengar, S., J. Hildreth, D. Schwartz. 1998. Actin-dependent receptor colocalization required for human immunodeficiency virus entry into host cells. J. Virol. 72: 5251-5255. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Cell Sci.Home page
M. Barrero-Villar, J. R. Cabrero, M. Gordon-Alonso, J. Barroso-Gonzalez, S. Alvarez-Losada, M. A. Munoz-Fernandez, F. Sanchez-Madrid, and A. Valenzuela-Fernandez
Moesin is required for HIV-1-induced CD4-CXCR4 interaction, F-actin redistribution, membrane fusion and viral infection in lymphocytes
J. Cell Sci., January 1, 2009; 122(1): 103 - 113.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Arduise, T. Abache, L. Li, M. Billard, A. Chabanon, A. Ludwig, P. Mauduit, C. Boucheix, E. Rubinstein, and F. Le Naour
Tetraspanins Regulate ADAM10-Mediated Cleavage of TNF-{alpha} and Epidermal Growth Factor
J. Immunol., November 15, 2008; 181(10): 7002 - 7013.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
O. Barreiro, M. Zamai, M. Yanez-Mo, E. Tejera, P. Lopez-Romero, P. N. Monk, E. Gratton, V. R. Caiolfa, and F. Sanchez-Madrid
Endothelial adhesion receptors are recruited to adherent leukocytes by inclusion in preformed tetraspanin nanoplatforms
J. Cell Biol., November 3, 2008; 183(3): 527 - 542.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
C. Espenel, E. Margeat, P. Dosset, C. Arduise, C. Le Grimellec, C. A. Royer, C. Boucheix, E. Rubinstein, and P.-E. Milhiet
Single-molecule analysis of CD9 dynamics and partitioning reveals multiple modes of interaction in the tetraspanin web
J. Cell Biol., August 25, 2008; 182(4): 765 - 776.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. M. Segura, A. Garnier, M. R. Di Falco, G. Whissell, A. Meneses-Acosta, N. Arcand, and A. Kamen
Identification of Host Proteins Associated with Retroviral Vector Particles by Proteomic Analysis of Highly Purified Vector Preparations
J. Virol., February 1, 2008; 82(3): 1107 - 1117.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. Sato, J. Aoki, N. Misawa, E. Daikoku, K. Sano, Y. Tanaka, and Y. Koyanagi
Modulation of Human Immunodeficiency Virus Type 1 Infectivity through Incorporation of Tetraspanin Proteins
J. Virol., January 15, 2008; 82(2): 1021 - 1033.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. E. Griffiths, K. J. Heesom, and D. J. Anstee
Normal prion protein trafficking in cultured human erythroblasts
Blood, December 15, 2007; 110(13): 4518 - 4525.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Khurana, D. N. Krementsov, A. de Parseval, J. H. Elder, M. Foti, and M. Thali
Human Immunodeficiency Virus Type 1 and Influenza Virus Exit via Different Membrane Microdomains
J. Virol., November 15, 2007; 81(22): 12630 - 12640.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. Jolly and Q. J. Sattentau
Human Immunodeficiency Virus Type 1 Assembly, Budding, and Cell-Cell Spread in T Cells Take Place in Tetraspanin-Enriched Plasma Membrane Domains
J. Virol., August 1, 2007; 81(15): 7873 - 7884.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gordón-Alonso, M.
Right arrow Articles by Sánchez-Madrid, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gordón-Alonso, M.
Right arrow Articles by Sánchez-Madrid, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS