|
|
||||||||


* Servicio de Inmunología, Hospital Universitario de la Princesa, Universidad Autónoma de Madrid, Madrid, Spain; and
Departamento de Inmuno-Biología Molecular, Hospital General Universitario Gregorio Marañón, Madrid, Spain
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Virus-cell and cell-to-cell fusion processes are not fully understood. It is feasible that the existence of preassembled protein complexes on target cells might regulate these phenomena. Tetraspanins comprise a family of integral proteins that span the membrane 4-fold and establish specialized microdomains based on noncovalent protein-protein interactions (13). These proteins possess a highly conserved structure with a short and a large extracellular loop (LEL). The LEL domain contains critical protein-protein interaction sites that allow noncovalent association of these proteins with other tetraspanins and transmembrane proteins, such as integrins and members of the Ig superfamily (13, 14). In this regard, it has been demonstrated that tetraspanins can modulate the function of proteins associated with them such as integrins (15) or ICAM-1 and VCAM-1 (16). Disruption of tetraspanin-based membrane microdomains interferes with important cellular processes, such as signal transduction, Ag presentation, cell migration, and cellular adhesion (14, 17, 18, 19). Tetraspanins are also involved in membrane fusion events such as sperm-oocyte fusion (20), myotube formation (21), and fusion of mononuclear phagocytes (22). In addition, these molecules are implicated in viral processes such as CD63 in HIV infection (23, 24), CD81 in hepatitis C virus infection (25), CD82 in cell-to-cell human T cell leukemia virus type I (HTLV-1) spreading (26), and CD9 in feline immunodeficiency virus (FIV) and canine distemper virus spreading (27, 28).
In the present study, we addressed the possible role of CD9 and CD81 on the fusion process mediated by HIV-1 Env. Our data show that CD9 and CD81 blockade rendered target cells more susceptible to syncytia formation induced by HIV-1 Env. Accordingly, short interference RNA (siRNA) of CD9 or CD81 expression enhanced viral entry and syncytia formation, whereas CD9 and CD81 overexpression had an opposing effect.
| Materials and Methods |
|---|
|
|
|---|
The anti-CD4 HP2/6 mAb (IgG1) that blocks gp120/CD4 interaction has been described previously (29). The biotinylated anti-CD4, anti-CXCR4, and anti-CCR5 mAbs were purchased from BD Pharmingen. The anti-CD4 v4-PE mAb (IgG1) that does not react with the gp120 binding site was from BD Biosciences. Anti-CD9 mAbs (VJ1/20, VJ1/10, VJ1/8, and GR2110) and anti-CD147 (VJ1/9; IgG1) have been described previously (30, 31). Anti-CD81 (IgG1) mAbs 5A6 and I33.2.2 were provided by Dr. S. Levy (Stanford University, Stanford, CA) and Dr. R. Vilella (Hospital Clinic, Barcelona, Spain), respectively. The anti-CD3 OKT3 mAb was a gift from B. Alarcón (Centro de Biología Molecular, Madrid, Spain). The goat anti-mouse IgG (whole molecule) was purchased from Sigma-Aldrich. Secondary Abs Alexa488-anti-mouse IgG and Streptavidin-RhodamineRed-X were purchased from Molecular Probes. Anti-CD45 D3/9 (IgG1) mAb has been described previously (32). Anti-vimentin mAb clone VIM 13.2 was purchased from Sigma-Aldrich.
The fluorescent cell trackers Calcein-AM, Cell Tracker Orange 5-((and-6)-(4-chloromethyl-benzoyl-amino)tetramethylrhodamine)-mixed isomers (CMTMR), and Cell Tracker Blue 7-amino-4-chloromethylcoumarin (CMAC) were from Molecular Probes. The fusion inhibitor peptide T20 was from Roche Diagnostics. Recombinant human IL-2 was provided by the National Institutes of Health AIDS Research and Reference Reagent Program 20022003.
The wild type-CD9-GFP and wild type-CD81-GFP constructs have been described previously (16, 33). These expression vectors were transfected in CEM and HeLa P5 cells by electroporation or nucleofection, following the manufacturers instructions. Immunofluorescence and cell-to-cell fusion experiments were performed 24 h after transfection.
Cells and cell cultures
The human T cell line CEM 1.3 and the HIV-1 envelope (Env)-HxBc2 expressing Jurkat T cell (Jurkat HxBc2; provided by the National Institutes of Health AIDS Research and Reference Reagent Program 20022003) were cultured in RPMI 1640 culture medium supplemented with 10% FCS. The HeLa P5 cell clone, stably transfected with human CD4 and CCR5-GFP cDNA and an HIV-LTR-driven
-gal reporter gene (34, 35), were provided by Dr. M. Alizon (Hôpital Cochin, Paris, France). HeLa 243 and HeLa ADA cells, also provided by Dr. M. Alizon, coexpress Tat and Env HIV-1 proteins (34, 35, 36). Env proteins of HeLa 243 and HeLa ADA cells are X4- and R5-tropic, respectively. PBMC from healthy donors were isolated by Ficoll-Hypaque gradient centrifugation and cultured for 2 days in RPMI 1640 medium supplemented with 10% FCS in the presence of PHA (5 µg/ml). Then, isolated T lymphoblasts were maintained with recombinant human IL-2 (50 U/ml) for 5 days.
Flow cytometry analysis
Cells were washed and incubated with anti-tetraspanins mAbs or biotinylated anti-CXCR4 mAb, anti-CCR5 mAb, and anti-CD4 mAb for 20 min at room temperature. After washing with PBS, cells were incubated with streptavidin-R-PE or a goat anti-mouse IgG labeled with PE (Molecular Probes) for 15 min, washed again, and analyzed by flow cytometry.
Immunofluorescence and confocal images
HeLa, CEM 1.3, or HxBc2 T cells were fixed for 3 min in 3% paraformaldehyde in PBS, and immunostained for CD9 and CD81, as described previously (30). Then, cells were visualized using a Leica DMR photomicroscope (Leica) and a Leica TCS-SP confocal microscope. The intensity color-coded image was obtained with Leica software, and fluorescence intensity histograms were generated by ImageJ from National Institutes of Health web site. In capping experiments, cells were treated with 7 µg/ml recombinant gp120 (National Institutes of Health AIDS Research and Reference Reagent Program 20022003) 90 min before fixation and labeling with an anti-CD4 v4-PE mAb. Double staining immunofluorescences were blocked with nonimmune mouse serum before second primary Ab. To avoid cross-talk between the different Abs used, primary Abs for staining were directly conjugated with the fluorocrome or biotin.
Western blot analysis
Cells were lysed in 1% Nonidet P-40 in PBS with protease inhibitors (Roche Diagnostics) for 30 min at 4°C. Then, cell lysates were run in 12% SDS-PAGE and immunoblotted for CD81 and vimentin.
HIV-1 Env-mediated cell-to-cell fusion assay
Double fluorescence cell fusion assay was performed as described previously (37). Briefly, CMTMR-loaded Jurkat HxBc2 cells expressing X4-tropic HIV-1 HxBc2-Env were cocultured with CEM 1.3 cells labeled with Calcein-AM. Fused cells were detected 16 h later by flow cytometry as double-stained cells. Percentage of fusion is calculated as 100 x UR/UL, where UR is the percentage of double stained cells and UL is the percentage of single stained CMTMR+ cells (see Fig. 2A). Cells were trypsinized previous to flow cytometry analysis to disrupt cellular aggregates. When indicated, cells were preincubated with the anti-CD4 HP2/6 mAb.
|
-galactosidase cell fusion assay was performed as described previously (37). Briefly, HeLa 243 or HeLa ADA cells were coincubated with HeLa P5 cells in 96-well plates at a 1:1 ratio for 16 h. Only when gp120/gp41-mediated fusion occurs, Tat protein present in the cytoplasm of HeLa Env+ cells transactivates LTR promoter at HeLa P5 nuclei. For syncytia detection, cells were fixed with 0.5% glutaraldehyde and stained with the
-galactosidase substrate 5-bromo-4-chloro-3-indoyl-
-D-galactopyranoside (X-Gal), as described previously (34). X-Gal blue staining allows an overview of the extent of syncytia formed. For a quantitative measurement of syncytia formation, cells in parallel experiments were washed, lysed (50 µl of lysis buffer), and
-galactosidase enzymatic activity was evaluated by chemiluminiscence, using a kit that couples both
-galactosidase and luciferase activity (
-gal reporter gene assay; Roche Diagnostics). HIV-1 entry and infection
HIV-1NL4.3 entry and infection were assayed in HeLa P5 cells as described previously (38). Briefly, HIV-1NL4.3 infection of HeLa P5 cells was conducted in 96-well plates for 5 h at 37°C. When indicated, cells were pretreated with the anti-CD4 HP2/6 mAb (10 µg/ml). Then, virus was removed by washing (PBS) and subsequent trypsination (5 min, 37°C) of infected cells. HeLa P5 cells were cultured for another 3 days before lysis and
-galactosidase activity determination.
Human T lymphoblasts (106 cells) stimulated for 5 days with IL-2 were infected for 3 h at 37°C in 96-well plates in the presence of the different Abs in suspension or in precoated plates cross-linked by goat anti-mouse IgG (20 µg/ml), anti-CD3 (clone OKT3 at 0.5 µg/ml), and anti-CD81 (5A6 at 4 µg/ml). Then, virus was removed by washing (PBS) of infected cells. Cell-free supernatants were harvested at 24, 48, and 72 h and assayed for p24 contents by ELISA (INNOTEST HIV-1 Ag mAb; Innogenetic). Viral particles from cell-free supernatants were also quantified by COBAS Ampliprep/COBAS Amplicor HIV-1 monitor test (Roche Diagnostics), which specifically amplifies the viral gene pol.
siRNA assay
To knockdown the expression of specific tetraspanins, the RNA duplexes targeting the silencing sequences CAATTTGTGTCCCTCGGGC and CACCTTCTATGTAGGCATC (Ambion) for CD81 and ACCTTCACCGTGAAGTCCT and GAGCATCTTCGAGCAAGAAA for CD9 (16) were used. A double-stranded siRNA designed by Eurogentec, which does not pair with any eucaryotic mRNA, was used as control. siRNA was transfected in CEM 1.3 cells by electroporation or nucleofection, and HeLa P5 cells were transfected with oligofectamine (Invitrogen Life Technologies), following the manufacturers instructions. The kinetics of silencing were followed by FACS analysis. The highest interferences were achieved 20 h after transfection for CEM 1.3 cells and 3 days postoligotransfection for HeLa P5 cells. To enrich the tetraspanin low-expressing population, the siRNA-treated cells were negatively selected with anti-CD81 magnetic coated beads (Dynabeads M450 goat anti-mouse IgG; Dynal Biotech) for 5 min at 4°C under rotation. These cells were counted and used for the fusion assays and analyzed by flow cytometry to assess the expression of tetraspanins, CD4, CCR5, and CXCR4.
| Results |
|---|
|
|
|---|
It has been reported that CD81 is associated with CD4 (39, 40) and that provides a costimulatory signal that increases HIV-1 gene expression (41). To determine the possible role of CD81 in HIV-1-mediated cell-to-cell fusion, we first analyzed its expression in CEM1.3 cells (Fig. 1A). This T cell line expressed significant levels of CD81 but null levels of CD9. Then, the subcellular localization of CD81 and CD4 was studied in T lymphocytes exposed to HIV-1 and during syncytia formation. We found that in CEM 1.3 cells and T lymphoblasts exposed to HIV-1 virions, CD4 and CD81 were concentrated at the area of viral contact, a phenomena called capping (38, 42) (Fig. 1C and data not shown). However, CD147, a molecule expressed at comparable levels as CD81 in these cells (data not shown), remained evenly distributed. Thus, CD81 coclustered with CD4 when it is engaged by gp120. On the other hand, before the exposure to the virus, both CD4 and CD81 were uniformly distributed along the plasma membrane (Fig. 1C, upper panel). In addition, when target CEM 1.3 cells contacted with cells expressing gp120/gp41 of HIV-1 (Jurkat HxB2c cells), CD81 accumulated at the areas of intercellular contact, where membrane fusion events occur. The intensity color-coded image and the histogram revealed that the staining in the area of cell contact is brighter than the expected one for two apposed membranes (Fig. 1B). Hence, tetraspanin CD81 appeared to gather where gp120/gp41 engages with CD4 during both virus-cell attachment and syncytia formation. Since both Env+ and target cells express CD81, to confirm that tetraspanins on target cells were accumulating at cell-to-cell contacts, CEM cells were transfected with cDNAs coding for CD9-GFP and CD81-GFP and incubated with Env+ cells. The exogenous tetraspanins were also recruited toward gp120/gp41, together with CD4 (Fig. 1D), verifying that tetraspanins on the target plasma membrane localized toward Env+ cells.
|
To explore the possible functional role of CD81, we analyzed syncytia formation in the presence of different mAb against this tetraspanin. We observed that 5A6 anti-CD81 mAb increased HIV-1-mediated-cell fusion and favored the formation of large syncytia between either CEM 1.3 or primary human T lymphoblasts and HxB2c cells (Fig. 2A). However, quantitative flow cytometry data did not reflect the strong enhancing effect of both 5A6 and I33.2.2 anti-CD81 mAbs on syncytia formation that can be visualized by microscopy (Fig. 2B). Indeed, these Abs induced such large syncytia in overnight incubations that these giant multinucleated cells could not enter the capillar of the flow cytometer. Therefore, analyses at shorter incubation times were conducted to obtain a quantitative measurement of anti-CD81 effect (Fig. 2A). At 7 h, there is little syncytia formation in the absence of Abs. However, when an anti-CD81 Ab is added, a great proportion of cells had already undergone membrane fusion induced by gp120/gp41. This effect was specific of CD81 binding since the presence of an isotype control Ab VJ1/9, that recognizes CD147, did not exert any significant effect (Fig. 2, A and B). As expected, syncytia formation was prevented by either a blocking anti-CD4 Ab or the fusion inhibitor peptide T-20, indicating that this process depends on CD4-gp120 interaction (Fig. 2, A and B, and data not shown). To verify that this observation was not a consequence from a possible aggregating effect of the Abs, cells were incubated simultaneously with T20 and anti-CD81 mAbs. Syncytia formation was blocked at levels comparable to negative control (anti-CD4) (data not shown). Hence, Ab engagement of CD81 facilitates syncytia formation that is dependent on CD4/gp120 interaction.
Next, the possible effect of anti-CD81 mAb (5A6) in viral entry was assayed in primary human T cells. T lymphoblasts isolated from healthy donors were infected with the X4-tropic HIV-1 NL43 viral strain in the presence or absence of 5A6 mAb. Cells were treated with the Abs before virus addition to target early viral entry events. Supernatants were harvested at 24, 48, and 72 h, and viral production was evaluated by both ELISA and quantitative RT-PCR. Engagement of CD81 was sufficient to increase virus production at every time point (Fig. 2C and data not shown). Likewise, an increase in virus production was observed with cross-linked Abs coated to the plate, not only when the anti-CD3 was present, but also when T lymphoblasts were incubated with 5A6 mAb either alone or combined with anti-CD3 (Fig. 2D).
On the other hand, we observed that CD81 engagement induced a significant clustering of this tetraspanin together with CD4 and CXCR4 (Fig. 2E and data not shown). This effect was observed in both conjugated and isolated cells. This preclustering might facilitate the interaction of gp120 and CD4 and CXCR4, allowing more rapid and effective membrane fusion events.
Effect of knocking-down CD81 expression on syncytia formation
Expression of CD81 in CEM target cells was specifically reduced by siRNA oligonucleotides. Interference in CEM 1.3 cells was maximal at 20 h posttransfection, and CD81 expression was decreased greatly as determined by both flow cytometry and Western blot analysis (Fig. 3, A and B). CEM 1.3 cells silenced for CD81 had similar levels of CD4 and CXCR4 than control cells (Fig. 3B). These cells showed enhanced syncytia formation with HXB2c Env+ cells. Anti-CD4 and the fusion inhibitor T20 blocked syncytia formation both in cells interfered with the negative control or anti-CD81 oligonucleotide (Fig. 3C). Remarkably, interference of CD81 expression in target cells did not affect CD4 or CD81 redistribution to cellular contacts (CD81 mainly expressed on Env+ cells) (Fig. 3D) or their capping to viral-cell synapses (data not shown). Thus, CD81 interference does not seem to alter CD4 subcellular localization to both cell-to-cell and virus-cell contacts but enhances cell-to-cell membrane fusion.
|
It has been reported that HeLa P5 target cells (which express CD4, CXCR4, and CCR5 and possess the
-galactosidase reporter gene controlled by HIV LTR promoter) and Env+ cells (which harbor the HIV promoter transactivator Tat) constitute a highly reproducible model to analyze the preliminary steps of the membrane fusion process induced by gp120/gp41 (34, 35, 43). In addition, these HeLa clones express both CXCR4 and CCR5, thus allowing investigation of syncytia formation induced by both T- and M-tropic gp120. We found that these HeLa clones expressed comparable levels of tetraspanins CD9 and CD81 (Fig. 4A). In these cells, CD9 and CD81 were evenly distributed and redistributed to the cellular contacts between HeLa P5 cells and HeLa Env+, where CD4, CXCR4, and CCR5 were also present (Fig. 4B and data not shown). In agreement with our data with T cell lines, both anti-CD81 and anti-CD9 Abs increased syncytia formation between HeLa P5 and HeLa Env+ cells but not the isotype control Ab VJ1/9 (Fig. 4C). Furthermore, HeLa P5 target cells with a diminished expression of CD9 and CD81 (4060% reduction induced by siRNA; Fig. 5, A and B), but normal levels of CD4, CXCR4, and CCR5 (Fig. 5C) showed increased syncytia formation (Fig. 5, D and E). CD81 silencing mainly enhanced the X4-tropic fusion system, whereas CD9 silencing exerted a higher effect in the R5-tropic fusion system. Control experiments demonstrated that syncytia formation was dependent on the interaction of CD4 and gp120/gp41 as it was completely abrogated by a blocking anti-CD4 Ab (Fig. 5, D and E). In agreement with these data, we found that HeLa P5 cells with a deficient expression of CD9 and CD81 were more susceptible to HIV-1NL43 viral entry (Fig. 6).
|
|
|
|
| Discussion |
|---|
|
|
|---|
Most of previous studies on the effect of tetraspanin blockade reported that anti-CD9 and anti-CD81 Abs inhibit fusion of gametes, myoblasts, virus-infected cells, and virus-induced cell-to-cell fusion (22, 27, 28, 40, 48, 49). However, in agreement with our data, it has been reported that the fusion of monocytes and alveolar macrophages is promoted by anti-CD9 and -CD81 Abs and enhanced in CD9- and CD81-null mice macrophages (22). It is very likely that the preclustering of CD81 with CD4 and CXCR4 induced by anti-CD81 Abs may facilitate the gp120/gp41-mediated membrane fusion, explaining the enhancing effect that they produced in syncytia formation. It has been reported that CD81 engagement increases HIV-1 gene expression due to the transcriptional activation of HIV-1 provirus, a late step in virus infection cycle (41). However, it is evident that this mechanism cannot account for the enhancing effect observed by us because our experimental system was designed to discriminate the virus-induced membrane fusion process from other processes triggered by HIV-1 thereafter. These authors also reported a cooperation of CD81 engagement with CD3 stimulation in virus production when the Abs were added to already infected cells (41). Nevertheless, they did not observe the enhancing effect when cells are in the presence of the anti-CD81 mAb alone. Our data show that anti-CD81 mAb induces an enhanced HIV viral production both alone and cross-linked by anti-IgG, and it therefore could be due to CD81 engagement before viral exposure.
On the other hand, the effect of these Abs cannot be linked to a possible aggregating consequence as cells were trypsinized before flow cytometer data acquisition to dissociate unspecific cellular aggregates, and the fusion inhibitor T20 is able to block the enhancing effect of the Abs. Moreover, mAbs with different aggregation properties (VJ1/20 and VJ1/10) exerted the same enhancing effect (31).
Our data show, in two different cellular models, that Env-mediated cell-to-cell membrane fusion is enhanced by silencing CD9 or CD81 expression using siRNA treatment of target cells. This effect is specific for CD9 and CD81 since we found that interference of other tetraspanin, CD151, partially inhibited Env-induced membrane fusion and had no effect in viral entry. CD151 is also recruited to cell-to-cell contacts but its expression is lower than that of CD9 and CD81 in the cellular model used (M. Gordon-Alonso and M. Yáñez-Mó, unpublished observations). In addition, another specific siRNA oligonucleotide directed against different target sequences of either CD9 or CD81 confirmed the data presented (data not shown).
CD9 and CD81 could affect HIV-1-induced membrane fusion by different pathways: indirectly, due to enhanced T cell or LFA-1 activation, or directly, organizing associated proteins on the cell membrane such as CD4 and gp120 coreceptors. In this regard, it has been described that anti-CD81 mAb activate LFA-1 (50, 51), which has been described as an enhancer of HIV-1 infection and syncytia formation (52, 53). Although we could not rule out a role for LFA-1 in this process, the enhancing effect of anti-CD81 mAb also occurs in the HeLa cell system, where there is no expression of LFA-1. In addition, the effect of CD81 engagement in CEM 1.3-HxBc2 membrane fusion is not inhibited by the LFA-1 blocking molecule, BIRT 377 (54) (M. Gordon-Alonso and M. Yáñez-Mó, unpublished observations). On the other hand, tetraspanins are involved in different signaling pathways in T cells as the activation of protein kinase C (41, 55). Accordingly, CD81 ligation by mAbs stimulates T cell activation, and it is known that activated lymphocytes are easily infected by HIV-1 (41, 50, 56). Another possibility is that CD81 alters actin organization in viral synapses through the regulation of integrin function (15). Actin remodeling is essential for the fusion process (57, 58, 59) and is required for the recruitment of membrane molecules into clusters where fusion events take place. We and others (3, 60, 61) have observed a ring of actin at viral synapses, and drugs that disrupt actin network inhibit membrane fusion. However, no difference in actin remodeling has been observed between CEM 1.3 cells interfered with the control oligonucleotide or with the CD81siRNA conjugated with HxBc2. Therefore, according to our results and previous reports, the alteration of the membrane protein microdomains, where CD4 is included, due to diminution of tetraspanin expression or by engagement with anti-tetraspanin Abs, seems to be the most likely mechanism for the effects observed. Thus, although the reduction in CD9 or CD81 expression by siRNA does not affect the level of expression of CD4 nor its subcellular localization, it may alter its association with gp120 coreceptors (CXCR4 or CCR5) or CD4 presentation to gp120 in a more subtle way. We think that given that CD81 is constitutively associated with CD4, the engagement of CD81 with Abs or its reduction of expression might disrupt CD81-CD4 associations. Under such conditions, a higher number of CD4 molecules would be available to associate with CXCR4 or CCR5, forming useful complexes for gp120/gp41-induced membrane fusion. In addition, CD4 not associated with CD81 might interact more readily with gp120 viral protein.
It is evident that the understanding of HIV-1-induced membrane fusion could yield interesting therapeutic strategies to directly block the infection and to inhibit other important transmission pathways such as viral cell-to-cell spreading. Our results show that the levels of expression of CD9 and CD81 or its engagement with Abs on target cells alters HIV-1-induced cell-to-cell fusion and HIV-1 entry. Therefore, this work provides further evidence on the relevance of target cells in HIV-1 virus transmission and supports the feasibility of therapeutic strategies directed to induce less susceptible host cells.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 F.S.-M. is supported by Ministerio de Educación y Ciencia Grant BFU2005-08435/BMC, Fundación para la Investigación y Prevención del SIDA en España (FIPSE) Grants 36289/02 and 24508/05, Lilly Foundation, and "Ayuda a la Investigación Básica 2002 de la Fundación Juan March." A.V.-F. is supported by grants from FIPSE 24508/05 and PI050995 from Fondo de Investigación Sanitaria, Instituto de Salud Carlos III, Ministerio de Sanidad y Consumo. ![]()
2 Current address: Departamento de Medicina Física y Farmacología, Facultad de Medicina, Universidad de La Laguna, 38071 Tenerife, Spain. ![]()
3 Address correspondence and reprint requests to Dr. Francisco Sánchez-Madrid. Servicio de Inmunología. Hospital Universitario de la Princesa. Diego de León 62, 28006 Madrid, Spain. E-mail address: fsanchez.hlpr{at}salud.madrid.org ![]()
4 Abbreviations used in this paper: Env, envelope viral protein; FIV, feline immunodeficiency virus; HTLV-1, human T cell leukemia virus type 1; LEL, large extracellular loop; siRNA, short interference RNA; X-gal, 5-bromo-4-chloro-3-indoyl-
-D-galactopyranoside. ![]()
Received for publication January 12, 2006. Accepted for publication July 14, 2006.
| References |
|---|
|
|
|---|
3
1 integrin localized at endothelial lateral junctions. J. Cell Biol. 141: 791-804.
B, NFAT, and AP-1 transduction pathways. J. Virol. 79: 4316-4328.
6
1: implications for murine fertilization. Proc. Natl. Acad. Sci. USA 96: 11830-11835. This article has been cited by other articles:
![]() |
M. Barrero-Villar, J. R. Cabrero, M. Gordon-Alonso, J. Barroso-Gonzalez, S. Alvarez-Losada, M. A. Munoz-Fernandez, F. Sanchez-Madrid, and A. Valenzuela-Fernandez Moesin is required for HIV-1-induced CD4-CXCR4 interaction, F-actin redistribution, membrane fusion and viral infection in lymphocytes J. Cell Sci., January 1, 2009; 122(1): 103 - 113. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Arduise, T. Abache, L. Li, M. Billard, A. Chabanon, A. Ludwig, P. Mauduit, C. Boucheix, E. Rubinstein, and F. Le Naour Tetraspanins Regulate ADAM10-Mediated Cleavage of TNF-{alpha} and Epidermal Growth Factor J. Immunol., November 15, 2008; 181(10): 7002 - 7013. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Barreiro, M. Zamai, M. Yanez-Mo, E. Tejera, P. Lopez-Romero, P. N. Monk, E. Gratton, V. R. Caiolfa, and F. Sanchez-Madrid Endothelial adhesion receptors are recruited to adherent leukocytes by inclusion in preformed tetraspanin nanoplatforms J. Cell Biol., November 3, 2008; 183(3): 527 - 542. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Espenel, E. Margeat, P. Dosset, C. Arduise, C. Le Grimellec, C. A. Royer, C. Boucheix, E. Rubinstein, and P.-E. Milhiet Single-molecule analysis of CD9 dynamics and partitioning reveals multiple modes of interaction in the tetraspanin web J. Cell Biol., August 25, 2008; 182(4): 765 - 776. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Segura, A. Garnier, M. R. Di Falco, G. Whissell, A. Meneses-Acosta, N. Arcand, and A. Kamen Identification of Host Proteins Associated with Retroviral Vector Particles by Proteomic Analysis of Highly Purified Vector Preparations J. Virol., February 1, 2008; 82(3): 1107 - 1117. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sato, J. Aoki, N. Misawa, E. Daikoku, K. Sano, Y. Tanaka, and Y. Koyanagi Modulation of Human Immunodeficiency Virus Type 1 Infectivity through Incorporation of Tetraspanin Proteins J. Virol., January 15, 2008; 82(2): 1021 - 1033. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Griffiths, K. J. Heesom, and D. J. Anstee Normal prion protein trafficking in cultured human erythroblasts Blood, December 15, 2007; 110(13): 4518 - 4525. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Khurana, D. N. Krementsov, A. de Parseval, J. H. Elder, M. Foti, and M. Thali Human Immunodeficiency Virus Type 1 and Influenza Virus Exit via Different Membrane Microdomains J. Virol., November 15, 2007; 81(22): 12630 - 12640. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Jolly and Q. J. Sattentau Human Immunodeficiency Virus Type 1 Assembly, Budding, and Cell-Cell Spread in T Cells Take Place in Tetraspanin-Enriched Plasma Membrane Domains J. Virol., August 1, 2007; 81(15): 7873 - 7884. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |