The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, H.-Y.
Right arrow Articles by Liu, F.-T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, H.-Y.
Right arrow Articles by Liu, F.-T.
The Journal of Immunology, 2006, 177: 4991-4997.
Copyright © 2006 by The American Association of Immunologists, Inc.

Role of Galectin-3 in Mast Cell Functions: Galectin-3-Deficient Mast Cells Exhibit Impaired Mediator Release and Defective JNK Expression1

Huan-Yuan Chen2,*, Bhavya B. Sharma2,{dagger}, Lan Yu*, Riaz Zuberi3,{dagger}, I-Chun Weng*, Yuko Kawakami{dagger}, Toshiaki Kawakami{dagger}, Daniel K. Hsu* and Fu-Tong Liu4,*

* Department of Dermatology, School of Medicine, University of California-Davis, Sacramento, CA 95817; and {dagger} Division of Cell Biology, La Jolla Institute for Allergy and Immunology, San Diego, CA 92121


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Galectin-3 is a member of the beta-galactoside-binding animal lectin family expressed in various cell types, including mast cells. To determine the role of galectin-3 in the function of mast cells, we studied bone marrow-derived mast cells (BMMC) from wild-type (gal3+/+) and galectin-3-deficient (gal3–/–) mice. Cells from the two genotypes showed comparable expression of IgE receptor and c-Kit. However, upon activation by Fc{epsilon}RI cross-linkage, gal3–/– BMMC secreted a significantly lower amount of histamine as well as the cytokine IL-4, compared with gal3+/+ BMMC. In addition, we found significantly reduced passive cutaneous anaphylaxis reactions in gal3–/– mice compared with gal3+/+ mice. These results indicate that there is a defect in the response of mast cells in gal3–/– mice. Unexpectedly, we found that gal3–/– BMMC contained a dramatically lower basal level of JNK1 protein compared with gal3+/+ BMMC, which is probably responsible for the lower IL-4 production. The decreased JNK1 level in gal3–/– BMMC is accompanied by a lower JNK1 mRNA level, suggesting that galectin-3 regulates the transcription of the JNK gene or processing of its RNA. All together, these results point to an important role of galectin-3 in mast cell biology.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Galectins are beta-galactoside-binding animal lectins characterized by consensus amino acid sequences and affinity for beta-galactosides. In mammals, 15 members of this family have been reported in the literature. They are composed of either one carbohydrate-binding domain (CRD)5 of ~120 aa or two CRDs connected by a short linker (1, 2). Some galectins have wide tissue distribution, while others exhibit tissue specificity (reviewed in Refs. 3 and 4). Although none of the galectin family members has a classical signal sequence, the presence of these proteins in the extracellular fluid has been demonstrated (reviewed in Ref. 5). A number of galectins have been shown to exert various biological activities through binding to and engaging cell surface glycoconjugates (glycoproteins and glycolipids) (reviewed in Refs. 6 and 7). The same proteins have also been found to reside inside the cells and function intracellularly (reviewed in Ref. 8).

Galectin-3 consists of a C-terminal CRD and N-terminal nonlectin tandem repeats of 9–14 aa (depending on the animal species). It has a wide tissue distribution and is abundantly present in the epithelia of several organs, including the lungs, the intestines, and the skin. It is also expressed by a number of inflammatory cells, including neutrophils, monocytes, macrophages, eosinophils, and mast cells (reviewed in Ref. 4). By using recombinant protein, galectin-3 has been shown to be able to activate a variety of cells and promote homotypic cell adhesion or adhesion of cells to extracellular matrices (reviewed in Refs. 4 , 7 , and 9). These are believed to result from the lectin binding to cell surface glycoconjugates. By using the gene transfection approach, galectin-3 has been shown to play a role in regulation of cell growth, cell cycle progression, and apoptosis (reviewed in Ref. 8). Its role in regulation of neoplastic transformation and other processes related to tumor progression has also been documented (reviewed in Ref. 10). These are believed to be related to this protein’s intracellular functions.

The development of genetically engineered mice deficient in galectin-3 (11) has made it possible to directly study the endogenous functions of this protein in cells in vitro, as well as to elucidate the physiological and pathological functions of this protein in vivo. Previously, we have demonstrated by using these mice that galectin-3 plays an important role in phagocytosis by macrophages (12), development of peritoneal inflammation (11), and promotion of airway inflammation (13). In the present study, we have addressed the role of galectin-3 in mast cells.

Galectin-3 has been shown to be expressed in cultured primary mast cells, tissue mast cells, and mast cell lines (14, 15) and localized in the cytoplasm and the nucleus of these cells (16). An exogenous source of galectin-3 has been shown to activate mast cells (17, 18), but the function of endogenous galectin-3 is unknown. Mast cells are the primary effector cells in immediate hypersensitivity reactions (19). The binding of multivalent Ags to surface-bound IgE causes aggregation of high-affinity IgE receptor (Fc{epsilon}RI) and initiates transmembrane signal transduction. This results in the secretion of histamine and an array of other preformed or newly synthesized mediators and production of cytokines with proinflammatory and immunoregulatory properties (20, 21). In the present study, we have compared the biological responses of mast cells from wild-type (gal3+/+) and galectin-3-deficient (gal3–/–) mice, both in vitro and in vivo, and obtained evidence for the significant involvement of galectin-3 in the mast cell response.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Mice

gal3–/– mice were generated as described previously (11) and backcrossed to C57BL/6 for nine generations. Experiments with mice were approved by the Institutional Animal Care and Use Committee of the University of California-Davis (Sacramento, CA).

Preparation of bone marrow-derived mast cells (BMMC), expansion of mast cells from peritoneal cavity, and generation of embryonic fibroblasts

BMMC were prepared as described from bone marrow cultures in BMMC medium (RPMI 1640, 2 mM glutamine, nonessential amino acids, and 55 µM 2-ME supplemented with WEHI-3-conditioned medium) (22, 23) and 4- to 6-wk-old cultures were used for experiments. For some experiments, 3-wk-old cultures were further incubated in the presence of 100 ng/ml mouse recombinant stem cell factor (rSCF; provided by Pharmaceutical Research Laboratory, Kirin Brewery) for 2 wk.

For expansion of peritoneal mast cells, the peritoneal cavity was lavaged using 5–10 ml of ice-cold HBSS without Ca2+ and Mg2+. The cells were resuspended in 72.5% Percoll (Amersham Biosciences), collected by centrifugation for 7 min at 300 x g, and cultured in BMMC medium at 37°C for 1 h to remove any residual adherent macrophages. The nonadherent cells were cultured in the presence of 100 ng/ml mouse rSCF in regular mast cell culture medium (22, 23) for 3–6 wk. Embryonic fibroblasts were prepared according to the described procedures (24).

Measurement of Fc{epsilon}RI and c-Kit expression

Expression of Fc{epsilon}RI on BMMC was determined by flow cytometry. A total of 106 BMMC were treated with 10 µg of mouse monoclonal anti-DNP IgE, H1 DNP-{epsilon}-26.82 (25) at 4°C for 40 min, followed by staining with FITC-conjugated anti-IgE Ab (BD Pharmingen). Expression of c-Kit was assessed by staining the cells with PE-conjugated anti-c-Kit Ab (BD Pharmingen). Cells were analyzed by using a FACSCalibur (BD Biosciences).

Activation of BMMC

1) Measurement of histamine release. Mediator release from BMMC induced by Fc{epsilon}RI cross-linkage was performed as described (26). BMMC were sensitized overnight with 500 ng/ml mouse monoclonal anti-DNP IgE, H1 DNP-{epsilon}-26.82 (25). Cells were washed and then stimulated with 0–100 ng/ml DNP-BSA in Tyrode buffer for 45 min at 37°C. 2) Measurement of cytokine release and kinases. BMMC were activated as described above, except that activation was performed in BMMC medium, and for various periods (0.5–4 h). In some experiments, IgE-mediated activation was accomplished by incubating the cells in tissue culture wells coated with IgE. Briefly, 96-well plates were coated with 10 µg/ml anti-DNP IgE in PBS at 37°C for 1 h. A total of 105 BMMC in 100 µl were added into each well. The plates were spun and incubated at 37°C for 4 h. In experiments to establish the role of JNK, various concentrations of the JNK inhibitor SP600125 (AG Scientific) were included in the wells.

Quantitation of histamine

Histamine content in the supernatant and the pellet solubilized with 1% Triton X-100 was measured by an automatic fluorometric method (27).

ELISA for IL-4

The concentrations of IL-4 in the culture supernatants were quantified by ELISA using the mouse cytokine OptEIA set from BD Pharmingen.

Passive cutaneous anaphylaxis (PCA) reactions

Mice were anesthetized by injecting 250–350 µl of Avertin i.p. The ears were injected intradermally with 15 µl of appropriately diluted mouse ascites fluid from an anti-DNP IgE hybridoma line (25) in saline containing 0.1% gelatin. The control (contralateral) site was injected with 15 µl of diluent only. After 3–4 h, mice were challenged with 200 µl of 1 mg/ml DNP-BSA along with 1% Evans blue in saline i.v. through the tail vein. The mice were sacrificed and the ears were cut into several pieces to facilitate extraction of the dye. The tissue from each ear was placed in 300 µl of 0.5% Na2SO4 and 700 µl of acetone overnight at room temperature. Then, 150-µl samples were transferred into a flat-bottom microtiter plate and the absorbance at 620 nm was read in an automated ELISA plate reader. There was little or no extravasation of the dye in control ear, but the control contralateral absorbance value (≤ 0.05) was subtracted from the experimental value for each pair of ears from a mouse. The values were converted to concentrations by using serially diluted (0.312–20 µg/ml) solutions of Evans blue in saline as standards.

Immunoblot analysis

Immunoblot analyses of galectin-3 (28) and kinases (29) were performed as described. The primary Abs used were: JNK and JNK1/2, mouse mAb recognizing, respectively, JNK1 only and both JNK1 and JNK2 (BD Pharmingen); ERK1/2 and p38, respective mouse mAb (Santa Cruz Biotechnology); galectin-3, rabbit polyclonal Ab to human galectin-3 (28); tubulin, a mouse mAb (Sigma-Aldrich); phosphorylated c-Jun (p-c-Jun), rabbit anti-p-c-Jun Ab (Cell Signaling Technology); phosphorylated linker for activation of T cells (LAT) and phospholipase C (PLC) {gamma}1, respective rabbit Ab (Cell Signaling Technology); LAT, PLC{gamma}1, and PLC{gamma}2, respective rabbit Ab (Santa Cruz Biotechnology). Secondary Abs used were: HRP-conjugated goat anti-mouse IgG and HRP-conjugated goat anti-rabbit IgG (Chemicon International).

In vitro kinase assay

IgE-sensitized BMMC were stimulated with 100 ng/ml DNP-BSA in Tyrode buffer for indicated time periods at 37°C. The determination of the JNK activity of the cell lysates in vitro was performed using GST-c-Jun (1–79) as the substrate, as described (29).

Measurement of protein kinase C (PKC) activation associated with granule exocytosis

IgE-sensitized BMMC were stimulated with 30 ng/ml DNP-BSA for indicated time periods. The cells were extracted with lysis buffer (1% Nonidet P-40, 25 mM Tris-HCl, 150 mM NaCl, 2 mM EDTA, 100 nM NaVO4, and 1000x diluted protease inhibitor mixture (Sigma-Aldrich)) on ice for 30 min. A total of 100 µg of total lysate protein were mixed with 1 µg of anti-PKCbetaII Ab (Santa Cruz Biotechnology) followed by 20 µl of protein G-Sepharose 4B beads (Zymed Laboratories). After the beads were washed with lysis buffer, the bound proteins were eluted and analyzed by immunoblotting using anti-p-Pan-PKC (Cell Signaling Technology) and anti-PKCbetaII. The relative density of the p-PKCbetaII over total PKCbetaII protein bands was analyzed by using ImageJ version 1.36 (W. S. Rasband, National Institutes of Health, Bethesda, MD; <http://rsb.info.nih.gov/ij/>, 1997–2006).

Measurement of calcium influx

IgE-sensitized BMMC were resuspended in 50 µl of culture medium and mixed with 50 µl of Ca+2 detecting dye (final concentration of Fluo-4: 1 µg/ml, Fura Red: 2 µg/ml, probenecid: 25 mM, and Pluronic F-127: 0.02%) in Tyrode buffer. The mixtures were incubated at room temperature for 15 min. The cells were stimulated with 30 ng/ml or 1 µg/ml DNP-BSA and analyzed on a Coulter EPICS XL flow cytometer (Coulter). List mode files were analyzed using FlowJo (Tree Star). Fura Red, Fluo-4, and Pluronic F-127 are all from Molecular Probes. Probenecid was from Alfa Aesar.

Polymerase chain reactions

First, quantitation of JNK mRNA by RT-PCR was performed. Total RNA from resting and activated BMMC was isolated using TRI reagent (Molecular Research Center) following the manufacturer’s protocol. To synthesize the first strand cDNA, 5 µg of total RNA was reverse transcribed in a 25-µl reaction using SuperScript II preamplification system (Invitrogen Life Technologies). With 1 µl of the reaction product as a template, JNK1 cDNA was amplified by PCR using forward (agcaccagaggtcattctcg) and reverse primers (ctgaaggatcataccagacg). As a control, G3PDH cDNA was amplified in the same samples. The PCR products were visualized by running on a 1% agarose gel in Tris-borate/EDTA buffer. Second, quantitation of IL-4 mRNA by real-time PCR was performed. Total mRNA from BMMC were purified by RNAeasy kits (Qiagen) according to the manufacture’s protocol. A total of 1 µg of total RNAs was used to synthesize cDNA by using Omniscript reverse transcriptase kit (Qiagen) according to the manufacturer’s instructions. Real-time PCR were performed using the TaqMan probes for mouse IL-4 and GAPDH (30) and the iCycler iQ system (Bio-Rad).

JNK promoter reporter assay

The promoter region of the human JNK gene 1 kbp upstream of the transcription start site was cloned into pGL 3 vector (Promega), resulting in phJNK1-Luc. gal3–/– BMMC (5 x 106) were transfected with 20 µg of a plasmid containing galectin-3 cDNA (pEF1gal3) (31) or the control plasmid pEF1, in combination with 6 µg of luciferase reporter vector (phJNK1-Luc) and 4 µg of control vector (pCMV-LacZ) by electroporation (Bio-Rad electroporator; 1000 µF and 240V). The cells were cultured in 2 ml of complete medium for 48 h and then harvested for luciferase activity assay. Luciferase values (relative light units) were calculated by dividing the luciferase activity by the beta-gal activity.

Statistical analysis

Statistical analysis of control and experimental groups was accomplished by Student’s t test or ANOVA using the software Statview 4.01. Values of p <0.05 were considered significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
gal3–/– BMMC exhibit diminished degranulation

To investigate the role for galectin-3 in mast cell activation, we compared BMMC from gal3+/+ and gal3–/– mice with regard to their response to Fc{epsilon}RI cross-linkage. BMMC were first sensitized with anti-DNP IgE and then stimulated with a multivalent Ag, DNP-BSA, and histamine release was measured. As shown in Fig. 1 A, BMMC from gal3–/– mice exhibited significantly lower histamine release over a wide range of Ag concentrations used. In these experiments, we found that BMMC from the two genotypes contained comparable amounts of histamine (data not shown).


Figure 1
View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 1. gal3–/– BMMC are defective in histamine release induced by cross-linkage of Fc{epsilon}RI. A, BMMC were sensitized with anti-DNP IgE, then activated by the indicated doses of multivalent DNP-BSA, and histamine release was determined. Each data point represents the mean ± SEM of results from three separate cell cultures. Similar results were obtained from three separate experiments. gal3–/– BMMC exhibit significantly lower histamine release compared with gal3+/+ BMMC (p << 0.001 by ANOVA). B, gal3+/+ (left panel) and gal3–/– (right panel) BMMC incubated with anti-DNP IgE, followed by staining with FITC conjugated anti-IgE Ab, were analyzed by flow cytometry. C, gal3+/+ (left panel) and gal3–/– (right panel) BMMC were stained with PE-conjugated anti-c-Kit Ab and analyzed by flow cytometry. Fluorescence staining of the receptors is shown as solid lines and that background staining is shown as dotted lines.

 
To exclude the possibility that galectin-3 deficiency results in aberrant Fc{epsilon}RI expression, we measured the basal level expression of Fc{epsilon}RI on the cell surfaces of both genotypes by flow cytometry and did not find any difference (Fig. 1B). Fc{epsilon}RI on mast cells is known to be induced by IgE. We treated the cells with increasing concentrations of IgE and then measured the levels of cell surface Fc{epsilon}RI. gal3+/+ and gal3–/– BMMC displayed comparable amounts of Fc{epsilon}RI after treatment with various doses of IgE (data not shown). We also determined the levels of another marker of mast cell differentiation, c-Kit, which is the receptor for SCF and plays a key role in mast cell proliferation and differentiation. The expression of c-Kit in the two genotypes was comparable (Fig. 1C).

gal3–/– BMMC exhibit diminished cytokine production

Besides degranulation, mast cell activation also leads to signaling events resulting in production of various cytokines, including IL-4. gal3+/+ and gal3–/– BMMC were activated by Fc{epsilon}RI cross-linkage with various doses of DNP-BSA and IL-4 in the culture supernatants was quantitated by ELISA. As shown in Fig. 2 A, gal3+/+ BMMC produced greater amounts of IL-4 than gal3–/– BMMC at all of the doses of DNP-BSA used. The time course of the response of the two genotypes to DNP-BSA was also compared and the reduced IL-4 release from gal3–/– BMMC was apparent at all the time points tested (Fig. 2B). Thus, the reduced response of gal3–/– BMMC was not due to slower kinetics.


Figure 2
View larger version (11K):
[in this window]
[in a new window]
  		FIGURE 2. gal3–/– BMMC exhibit diminished IL-4 production upon stimulation by Fc{epsilon}RI cross-linkage. A and B, BMMC were sensitized with anti-DNP IgE and activated with DNP-BSA; the amounts of IL-4 in the supernatants were quantitated. A, Dose-response curve over a range of Ag concentrations in cells activated for 2 h; p < 0.01 by ANOVA. B, The response over 0.5–4 h in cells activated by DNP-BSA at 30 ng/ml. Each data point represents the mean ± SEM of results from three different experiments. The production of the cytokine is significantly lower in gal3–/– BMMC compared with gal3+/+ BMMC; p < 0.02 by ANOVA. C, BMMC were incubated in plastic wells coated with anti-DNP IgE for 4 h at 37°C; the amounts of IL-4 in the supernatants were determined. The data represent the mean ± SEM of results from three measurements (p < 0.006, by Student’s t test). Similar results were obtained from three separate experiments.

 
The above experiments required the sensitization of the cells with IgE overnight and there existed a possibility that the defect observed for gal3–/– BMMC was due to an altered response in the sensitization phase. We performed experiments in which BMMC were cultured in plastic wells coated with anti-DNP IgE, and thus activated directly, as cell surface Fc{epsilon}RI was cross-linked by solid phase IgE. As shown in Fig. 2C, IL-4 production was significantly lower in gal3–/– BMMC compared with gal3+/+ BMMC.

gal3–/– mice exhibit reduced PCA reactions

To determine whether galectin-3 deficiency results in a defective mast cell response in vivo, we compared the PCA reactions in gal3+/+ and gal3–/– mice. Mice were given serial dilutions of mouse monoclonal anti-DNP IgE intradermally and then challenged with the multivalent Ag DNP-BSA i.v. The cutaneous reaction was gauged by the extravasation of the i.v. injected dye at the sensitized sites. As shown in Fig. 3, gal3–/– mice showed significantly lower cutaneous reactions compared with gal3+/+ mice. Mast cell numbers in the skin were not significantly different between the two genotypes (data not shown).


Figure 3
View larger version (11K):
[in this window]
[in a new window]
  		FIGURE 3. gal3–/– mice exhibit reduced PCA reactions. The ears of gal3+/+ and gal3–/– mice were injected intradermally with serially diluted ascites from an anti-DNP IgE hybridoma, followed by i.v. challenge using DNP-BSA along with Evans blue dye. The concentrations (micrograms per milliliter) of the extravasated dye at the IgE-sensitized sites were determined by a colorimetric method. gal3–/– mice showed significantly lower cutaneous reactions compared with gal3+/+ mice. Each data point represents the mean ± SEM of results from three separate experiments; p < 0.02 by ANOVA.

 
gal3–/– BMMC are defective in the expression of JNK1 protein

It has been shown that recombinant galectin-3 can induce mediator release from mast cells, when added to cultures of these cells (17). Thus, one possible cause for the difference between gal3+/+ and gal3–/– BMMC in response to activation is that galectin-3 released by the cells might activate the neighboring cells in a paracrine fashion. We performed the activation of BMMC in the presence of lactose, which is known to inhibit the binding of galectin-3 to glycoconjugates (17, 32). The amount of IL-4 released was not affected by lactose in both genotypes of mast cells (data not shown).

Galectin-3 has been shown to be present inside mast cells (16) and have a number of different intracellular functions in various other cell types (reviewed in Ref. 8). Thus, galectin-3 may regulate the mast cell response through an intracellular mechanism(s). Because our results show that galectin-3 is involved in IL-4 production, we focused on the signal transduction pathway leading to transcriptional activation of the cytokine gene in mast cells. We found that gal3+/+ and gal3–/– BMMC did not differ in the phosphorylation of ERK1/2 and MEK (data not shown). However, when we analyzed activation of JNK, we found a strikingly diminished basal protein level of the 46-kDa isoform of JNK1 in gal3–/– BMMC (Fig. 4A). There is no difference in the 55-kDa isoform of this kinase (Fig. 4A). When the same membrane was reprobed with Ab that recognizes both JNK1 and JNK2, there was no appreciable difference in the signals from mast cells between the two genotypes. The results suggest that the Ab may detect primarily JNK2 and thus the difference in JNK1 was masked.


Figure 4
View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 4. gal3–/– BMMC contain lower JNK1 protein level. The levels of different kinases, as well as galectin-3 and tubulin in the cell lysates of gal3+/+ and gal3–/– cells, were determined by immunoblotting using specific Abs. A and B, Unstimulated gal3+/+ and gal3–/– BMMC. C, gal3+/+ and gal3–/– BMMC sensitized with anti-DNP IgE and then activated with DNP-BSA for 12 and 24 h. D, Three-week-old gal3+/+ and gal3–/– BMMC incubated with SCF for 2 wk. E, Cells obtained from lavage of the peritoneal cavity of gal3+/+ and gal3–/– mice were cultured in the presence of SCF for 3 wk. F, gal3+/+ and gal3–/– embryonic fibroblasts.

 
The decreased JNK1 protein level in gal3–/– BMMC is not due to a global defect in protein expression in these cells. The expression levels of other kinases P38 and ERK1/2 were comparable between the two genotypes (Fig. 4B). In addition, the baseline expression levels of beta and {gamma} subunits of Fc{epsilon}R and various other upstream tyrosine and serine-threonine kinases, namely Lyn, Syk, Btk, Emt, PLC-{gamma}1, Grb 2, HS1, PKC{alpha}, PKCbeta1, were also comparable between the two genotypes, as determined by immunoblot analysis (data not shown).

JNK has been shown to be inducible in T cells, when activated by PMA or anti-CD3 Ab (33). Therefore, we determined whether JNK1 is also inducible in mast cells and whether the galectin-3 affects its induction. We activated mast cells by cross-liking Fc{epsilon}RI for 12 and 24 h and then analyzed the JNK1 level by immunoblotting. We found that JNK1 was inducible in mast cells in both gal3+/+ and gal3–/– BMMC, but even after prolonged activation, the JNK1 protein content in gal3–/– BMMC was substantially lower than that in gal3+/+ BMMC (Fig. 4C).

BMMC are believed to show the phenotype of mature mast cells if grown in the presence of SCF (34). We measured the JNK1 level in 3-wk-old BMMC that were further cultured in the presence of SCF for 2 wk and still noted defective expression in gal3–/– BMMC (Fig. 4D). We also measured the JNK1 level in mast cells originating from the peritoneal cavity and expanded in the presence of SCF. As shown in Fig. 4E, the association between low JNK1 expression and galectin-3 deficiency is retained. To determine whether the defective JNK1 expression in gal3–/– mice is cell type specific, we tested the JNK1 levels in other cell types from gal3+/+ and gal3–/– mice. We did not see any difference in JNK1 levels in embryonic fibroblasts (Fig. 4F), as well as in resting and activated macrophages and lymphocytes (data not shown).

gal3–/– BMMC are defective in activation of c-Jun

Consistent with the defective JNK1 expression, phosphorylation of c-Jun was significantly lower in gal3–/– BMMC compared with gal3+/+ BMMC that were activated by Fc{epsilon}RI cross-linkage (Fig. 5A). In addition, we precipitated JNK1 in the cell lysates and quantitated the c-Jun kinase activity in the precipitates by an in vitro kinase assay. As shown in Fig. 5B, immunoprecipitates from gal3–/– BMMC had significantly reduced ability to phosphorylate c-Jun compared with gal3+/+ BMMC. Comparison of the relative amounts of phosphorylated c-Jun with those of JNK1 between the two genotypes showed that JNK1 in gal3–/– BMMC had lower kinase activity compared with that in gal3+/+ BMMC.


Figure 5
View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 5. gal3–/– BMMC exhibit lower c-Jun activation. A, BMMC were sensitized with anti-DNP IgE and then activated with DNP-BSA for the indicated periods. The levels of phosphorylation of c-Jun were determined by immunoblotting using anti-phospho-c-Jun. B, BMMC were sensitized with anti-DNP IgE and then activated with DNP-BSA for the indicated periods. The JNK kinase activity in the lysates was analyzed by using GST-c-Jun as substrate. The activities relative to the amount of JNK1 are listed underneath the bands.

 
gal3–/– BMMC have reduced IL-4 mRNA and JNK mRNA

Because IL-4 production is controlled by JNK at the transcription level, our results suggested that the decreased IL-4 production in gal3–/– BMMC may be due to a reduced level of transcription of this cytokine. By using real-time PCR, we compared the IL-4 mRNA levels in gal3+/+ and gal3–/– BMMC that were activated by Fc{epsilon}RI cross-linkage. As shown in Fig. 6A, the level was significantly lower in gal3–/– BMMC than gal3+/+ BMMC.


Figure 6
View larger version (10K):
[in this window]
[in a new window]
  		FIGURE 6. gal3–/– BMMC exhibit lower levels of mRNA for IL-4 and JNK1. A, BMMC were activated by incubating in microtiter wells coated with anti-DNP IgE or PBS (control) and the levels of IL-4 mRNA were determined by real-time PCR. B, RT-PCR analysis of JNK mRNA levels in BMMC sensitized with anti-DNP IgE and then activated with DNP-BSA. After various periods, the JNK mRNA levels were analyzed by RT-PCR.

 
As a first step in elucidating the mechanism by which JNK expression is regulated by galectin-3, we determined whether transcriptional regulation is involved. We compared the mRNA levels of JNK1 in gal3+/+ and gal3–/– BMMC by RT-PCR. The results showed that the basal level of JNK1 mRNA was lower in gal3–/– BMMC compared with gal3+/+ BMMC (Fig. 6B). There was a rapid induction of JNK1 mRNA in both genotypes upon activation by Fc{epsilon}RI cross-linkage. However, the level in gal3–/– BMMC remained considerably lower than that in gal3+/+ BMMC (Fig. 6B).

To determine whether galectin-3 controls JNK1 gene transcription, we tested the effect of galectin-3 on the activation of JNK promoter by a reporter assay. We did not detect induction of JNK promoter by galectin-3 in gal3–/– BMMC cotransfected with JNK promoter-reporter construct and galectin-3 (data not shown).

Suppression of IL-4 production in BMMC by a JNK inhibitor

Although JNK is known to mediate cytokine production in T cells, its role in IL-4 production in mast cells has not been demonstrated. To confirm that defective JNK1 synthesis and activation as seen in gal3–/– mast cells can result in reduced IL-4 production, we tested whether inhibition of JNK1 can suppress IL-4 production. gal3+/+ and gal3–/– BMMC were activated in the presence of a serially diluted JNK inhibitor, SP600125 (35). As shown in Fig. 7, IL-4 release in both gal3+/+ and gal3–/– BMMC was inhibited by this drug in a dose-dependent fashion.


Figure 7
View larger version (8K):
[in this window]
[in a new window]
  		FIGURE 7. IL-4 secretion by BMMC is down-regulated by JNK inhibitor. BMMC were incubated in plastic wells coated with anti-DNP IgE for 4 h in the presence of serially diluted JNK inhibitor SP600125. The amounts of IL-4 in the supernatants were determined. Each data point represents mean ± SEM of results from three separate experiments; p < 0.005, by ANOVA.

 
gal3+/+ and gal3–/– BMMC do not differ significantly in signaling pathways linked to secretory granule exocytosis

Because JNK1 is not known to be involved in the signaling events associated with mast cell granule exocytosis, we conducted experiments to determine how galectin-3 contributes to this process. Galectin-3 does not appear to regulate some upstream events, such as activation of receptor-associated tyrosine kinases, because tyrosine phosphorylation of both Lyn and Syk were comparable in gal3+/+ and gal3–/– BMMC activated by Fc{epsilon}RI cross-linkage (data not shown). We then examined calcium mobilization induced by Fc{epsilon}RI cross-linkage and did not notice a difference between gal3+/+ and gal3–/– BMMC (Fig. 8A). We next studied phosphorylation of PLC{gamma}1 and an adaptor molecule, LAT, and did not find significant differences (Fig. 8B). It is unlikely that galectin-3 is involved in activation of another adaptor molecule, Src homology protein of 76 kDa (SLP-76), because this protein as well as LAT has an essential role in calcium mobilization and galectin-3 appears not to be involved in this latter process. Finally, we examined the activation of PKCbeta, which is implicated in degranulation and noted that a similar extent of phosphorylation of PKCbetaII was achieved in gal3+/+ and gal3–/– BMMC upon Fc{epsilon}RI cross-linkage (Fig. 8C).


Figure 8
View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 8. Measurements of signaling events associated with granule exocytosis. A, IgE-sensitized BMMC were mixed with Ca+2 detecting dye Fluo-4, Fura-red, probenecid, and Pluronic F-127. The cells were then stimulated with 30 ng/ml or 1 µg/ml DNP-BSA to induce Fc{epsilon}RI cross linkage and analyzed by flow cytometry. B, IgE-sensitized BMMC were stimulated with 30 ng/ml DNP-BSA for the indicated time periods. Proteins were extracted with SDS-PAGE sample buffer and subjected to immunoblotting for detection of phosphorylated LAT and phosphorylated PLC{gamma}1. Relative densities of the phosphorylated vs total protein for each signaling molecule were analyzed using ImageJ, and are shown below the protein bands. C, IgE-sensitized BMMC were stimulated with 30 ng/ml DNP-BSA for the indicated time periods. The cells were extracted with lysis buffer, PKCbetaII was immunoprecipitated and both phosphorylated protein and total protein were detected by immunoblotting. The relative densities of the phosphorylated PKCbetaII over total PKCbetaII protein are shown below the protein bands.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
The functions of galectin-3 have previously been studied mainly by treating various cells with exogenously added recombinant protein, and by this approach, galectin-3 has been shown to be able to activate various cell types, including mast cells (17). The availability of genetically engineered galectin-3-deficient mice has made it possible to study the role of endogenous galectin-3 in various cell types. Our results show the involvement of galectin-3 in the Fc{epsilon}RI-mediated mast cell response. BMMC from gal3–/– mice exhibited significantly reduced degranulation (i.e., histamine release) and lower cytokine (IL-4) production upon Fc{epsilon}RI cross-linkage. Importantly, gal3–/– mice exhibit a significantly diminished cutaneous mast cell response in vivo, as demonstrated by PCA reactions.

Like all other members of the galectin family, galectin-3 does not contain a classical signal sequence. Nevertheless, it can be secreted from various cell types (5), including mouse macrophage cell lines stimulated with a calcium ionophore (36). However, the possibility that galectin-3 released by mast cells in turn activates neighboring cells in a paracrine fashion, through binding to cell surface glycoconjugates, is excluded by the following experimental results. We activated gal3+/+ BMMC by Fc{epsilon}RI cross-linkage in the presence of lactose, which would bind to extracellular galectin-3 and inhibit its activity, or with another disaccharide, sucrose, which does not bind to the lectin. We found that IL-4 production was not affected by the presence of either sugar (data not shown). These results strongly suggest the involvement of galectin-3 in mast cell signaling through an intracellular mechanism.

Based on our results, some potential causes of lower degranulation and cytokine production in gal3–/– BMMC can be excluded. First, the deficiency is not due to a reduction in the number of Fc{epsilon}RI on the cells. Second, it is not due to lack of differentiation of these cells, as we found comparable levels of cell surface c-Kit (Fig. 1C) and mRNA of a mast cell-specific protease, MCP-5 (data not shown) in cells from the two genotypes. Third, galectin-3 does not appear to regulate some upstream events, such as activation of receptor-associated tyrosine kinases, because tyrosine phosphorylation of both Lyn and Syk were comparable in gal3+/+ and gal3–/– BMMC activated by Fc{epsilon}RI cross-linkage (data not shown).

Our present study provides a significant mechanistic insight into the regulation of mast cell cytokine production by galectin-3 and that is the involvement of this lectin in regulation of JNK1 expression. JNK1 is known to play an important role in the production of cytokines from T cells by activating the transcription factor c-Jun, which is in turn involved in transcription of various cytokines (37). Thus, the reduced cytokine production in gal3–/– BMMC is likely due to the lower JNK1 level. It is to be noted that only one of the two isoforms of JNK1 is affected, and this could explain a partial reduction in IL-4 production as the other isoform is likely to regulate the production of this cytokine also.

The basis for galectin-3’s regulation of JNK1 expression remains to be elucidated. Our finding that gal3–/– BMMC contains significantly lower JNK1 transcript suggests that galectin-3 regulates JNK1 transcription. Galectin-3 has been shown to interact with a thyroid transcription factor, TTF, and potentiate the activity of this factor (38). It is conceivable that galectin-3 regulates the transcription factor involved in the expression of JNK1. However, our experiments with a reporter assay did not support the control of JNK promoter activity by galectin-3 (data not shown). The finding that only one isoform is affected is unusual. Because these isoforms are products of alternative splicing, the intriguing possibility exists that galectin-3 regulates differential splicing of JNK pre-mRNA. In this regard, it is interesting to note that galectin-3, as well as galectin-1, has been shown to be active in inducing pre-mRNA splicing in vitro (39).

How galectin-3 regulates degranulation needs to be considered, since this process is not known to be dependent on JNK1. We studied a number of signaling events and molecules known to contribute to secretory granule exocytosis, including calcium influx, phosphorylation of PLC{gamma}1, and the adaptor molecule LAT, and activation of PKCbeta and did not notice significant alterations in gal3–/– BMMC. We cannot exclude the possibility that galectin-3 regulates activation of the soluble N-ethylmaleimide-sensitive factor attachment receptor complex that is involved in the membrane fusion during degranulation (40). Galectin-3 has recently been shown to be present in the lumen of intracellular vesicles containing glycoproteins destined to the apical site of epithelial cells (41). A model has been proposed in which galectin-3 is responsible for clustering these apical glycoproteins and facilitating the generation of apical vesicles. Because galectin-3 is present in secretory granules in mast cells (16), an intriguing possibility exists that galectin-3 is involved in clustering of glycoproteins contained in the granules and thus facilitating the targeting of these granules to the plasma membrane before exocytosis.

Our results strengthen the notion that the galectins can function intracellularly. Such functions are unexpected from the lectin properties, but are consistent with their intracellular localization (42). These functions likely involve interactions with intracellular proteins, which could be dependent or independent of carbohydrates. Saccharides, especially the O-linked varieties, do exist in the cytoplasm and may potentially be ligands of cytosolic galectins. However, there is evidence that galectin-3 interacts with proteins that are not glycoproteins, suggesting the involvement of carbohydrate-independent protein-protein interactions (reviewed in Ref. 8).

In conclusion, our studies have established an important role for galectin-3 in the mast cell response. In view of the well-established significance of mast cells in allergic inflammation, our studies suggest that galectin-3 could be a potential therapeutic target for controlling allergic disorders.


   Acknowledgments
 
We are grateful to Drs. Jiro Kitaura, Masami Narita, and Mari Maeda-Yamamoto for their contributions to some of the data presented in the manuscript.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants R01 AI20958, R01 AI39620, and P01 AI50498. Back

2 H.-Y.C. and B.B.S. contributed equally. Back

3 Current address: La Jolla Institute for Molecular Medicine, 4570 Executive Drive, San Diego CA 92121. Back

4 Address correspondence and reprint requests to Dr. Fu-Tong Liu, Department of Dermatology, School of Medicine, University of California-Davis, 3301 C Street, Suite No. 1400, Sacramento, CA 95816. E-mail address: fliu{at}ucdavis.edu Back

5 Abbreviations used in this paper: CRD, carbohydrate-recognition domain; BMMC, bone marrow-derived mast cell; SCF, stem cell factor; LAT, linker for activation of T cells; PLC, phospholipase C; PKC, protein kinase C; PCA, passive cutaneous anaphylaxis. Back

Received for publication October 20, 2005. Accepted for publication July 17, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Leffler, H., S. Carlsson, M. Hedlund, Y. Qian, F. Poirier. 2004. Introduction to galectins. Glycoconj. J. 19: 433-440. [Medline]
  2. Cooper, D. N.. 2002. Galectinomics: finding themes in complexity. Biochim. Biophys. Acta 1572: 209-231. [Medline]
  3. Rabinovich, G. A., L. G. Baum, N. Tinari, R. Paganelli, C. Natoli, F. T. Liu, S. Iacobelli. 2002. Galectins and their ligands: amplifiers, silencers or tuners of the inflammatory response?. Trends Immunol. 23: 313-320. [Medline]
  4. Liu, F. T.. 2005. Regulatory roles of galectins in the immune response. Int. Arch. Allergy Immunol. 136: 385-400. [Medline]
  5. Hughes, R. C.. 1999. Secretion of the galectin family of mammalian carbohydrate-binding proteins. Biochim. Biophys. Acta 1473: 172-185. [Medline]
  6. Almkvist, J., A. Karlsson. 2004. Galectins as inflammatory mediators. Glycoconj. J. 19: 575-581. [Medline]
  7. Ochieng, J., V. Furtak, P. Lukyanov. 2004. Extracellular functions of galectin-3. Glycoconj. J. 19: 527-535. [Medline]
  8. Liu, F. T., R. J. Patterson, J. L. Wang. 2002. Intracellular functions of galectins. Biochim. Biophys. Acta 1572: 263-273. [Medline]
  9. Hughes, R. C.. 2001. Galectins as modulators of cell adhesion. Biochimie 83: 667-676. [Medline]
  10. Liu, F. T., G. A. Rabinovich. 2005. Galectins as modulators of tumour progression. Nat. Rev. Cancer 5: 29-41. [Medline]
  11. Hsu, D. K., R.-Y. Yang, L. Yu, Z. Pan, D. R. Salomon, W.-P. Fung-Leung, F.-T. Liu. 2000. Targeted disruption of the galectin-3 gene results in attenuated peritoneal inflammatory responses. Am. J. Pathol. 156: 1073-1083. [Abstract/Free Full Text]
  12. Sano, H., D. K. Hsu, J. R. Apgar, L. Yu, B. B. Sharma, I. Kuwabara, S. Izui, F.-T. Liu. 2003. Critical role of galectin-3 in phagocytosis by macrophages. J. Clin. Invest. 112: 389-397. [Medline]
  13. Zuberi, R. I., D. K. Hsu, O. Kalayci, H. Y. Chen, H. K. Sheldon, L. Yu, J. R. Apgar, T. Kawakami, C. M. Lilly, F. T. Liu. 2004. Critical role for galectin-3 in airway inflammation and bronchial hyperresponsiveness in a murine model of asthma. Am. J. Pathol. 165: 2045-2053. [Abstract/Free Full Text]
  14. Frigeri, L. G., F.-T. Liu. 1992. Surface expression of functional IgE binding protein, an endogenous lectin, on mast cells and macrophages. J. Immunol. 148: 861-869. [Abstract]
  15. Liu, F.-T., L. G. Frigeri, C. A. Gritzmacher, D. K. Hsu, M. W. Robertson, R. I. Zuberi. 1993. Expression and function of an IgE-binding animal lectin ([/oe]BP) in mast cells. Immunopharmacology 26: 187-195. [Medline]
  16. Craig, S. S., P. Krishnaswamy, A.-M. A. Irani, C. L. Kepley, F.-T. Liu, L. B. Schwartz. 1995. Immunoelectron microscopic localization of galectin-3, an IgE binding protein, in human mast cells and basophils. Anat. Rec. 242: 211-216. [Medline]
  17. Frigeri, L. G., R. I. Zuberi, F.-T. Liu. 1993. {epsilon}BP, a beta-galactoside-binding animal lectin, recognizes IgE receptor (Fc{epsilon} RI) and activates mast cells. Biochemistry 32: 7644-7649. [Medline]
  18. Zuberi, R. I., L. G. Frigeri, F.-T. Liu. 1994. Activation of rat basophilic leukemia cells by {epsilon}BP, an IgE-binding endogenous lectin. Cell. Immunol. 156: 1-12. [Medline]
  19. Metcalfe, D. D., D. Baram, Y. A. Mekori. 1997. Mast cells. Immunol. Rev. 77: 1033-1079.
  20. Gordon, J. R., P. R. Burd, S. J. Galli. 1990. Mast cells as a source of multifunctional cytokines. Immunol. Today 11: 458-464. [Medline]
  21. Schwartz, L. B.. 1994. Mast cells: function and contents. Curr. Opin. Immunol. 6: 91-97. [Medline]
  22. Razin, E., J. M. Mencia-Huert, R. L. Stevens, R. A. Lewis, F.-T. Liu, E. T. Corey, F. K. Austen. 1983. IgE mediated release of leukotriene C4, chondroitin sulfate E, proteoglycan, beta-hexosaminidase, and histamine from cultured bone marrow-derived mouse mast cells. J. Exp. Med. 157: 189-201. [Abstract/Free Full Text]
  23. Hata, D., Y. Kawakami, N. Inagaki, C. S. Lantz, T. Kitamura, W. N. Khan, M. Maeda-Yamamoto, T. Miura, W. Han, S. E. Hartman, et al 1998. Involvement of Bruton’s tyrosine kinase in Fc{epsilon}RI-dependent mast cell degranulation and cytokine production. J. Exp. Med. 187: 1235-1247. [Abstract/Free Full Text]
  24. Hogan, B., R. Beddington, F. Costantini, E. Lacy. 1994. Manipulating The Mouse Embryo: a Laboratory Manual Cold Spring Harbor Lab. Press, Cold Spring Harbor, NY.
  25. Liu, F.-T., J. W. Bohn, E. L. Ferry, H. Yamamoto, C. A. Molinaro, L. A. Sherman, N. R. Klinman, D. H. Katz. 1980. Monoclonal dinitrophenyl-specific murine IgE antibody: preparation, isolation and characterization. J. Immunol. 124: 2728-2731. [Medline]
  26. Kawakami, Y., T. Miura, R. Bissonnette, D. Hata, W. N. Khan, T. Kitamura, M. Maeda-Yamamoto, S. E. Hartman, L. Yao, F. W. Alt, T. Kawakami. 1996. Bruton’s tyrosine kinase (Btk) regulates apoptosis and JNK/SAPK kinase activity. Proc. Natl. Acad. Sci. USA 94: 3938-3942.
  27. Siraganian, R. P.. 1974. An automated continuous-flow system for the extraction and fluorometric analysis of histamine. Anal. Biochem. 57: 383-387. [Medline]
  28. Liu, F.-T., D. K. Hsu, R. I. Zuberi, I. Kuwabara, E. Y. Chi, W. R. Henderson, Jr. 1995. Expression and function of galectin-3, a beta-galactoside-binding lectin, in human monocytes and macrophages. Am. J. Pathol. 147: 1016-1029. [Abstract]
  29. Kawakami, Y., S. E. Hartman, P. M. Holland, J. A. Cooper, T. Kawakami. 1998. Multiple signaling pathways for the activation of JNK in mast cells: involvement of Bruton’s tyrosine kinase, protein kinase C, and JNK kinases, SEK1 and MKK7. J. Immunol. 161: 1795-1802. [Abstract/Free Full Text]
  30. Overbergh, L., A. Guilietti, D. Valckx, R. Decallonne, R. Bouillon, C. Mathieu. 2003. The use of real-time reverse transcriptase PCR for the quantification of cytokine gene expression. J. Biomol. Tech. 14: 33-43. [Medline]
  31. Yang, R. Y., P. N. Hill, D. K. Hsu, F. T. Liu. 1998. Role of the carboxyl-terminal lectin domain in self-association of galectin-3. Biochemistry 37: 4086-4092. [Medline]
  32. Yamaoka, A., I. Kuwabara, L. G. Frigeri, F.-T. Liu. 1995. A human lectin, galectin-3 ({epsilon}BP/Mac-2), stimulates superoxide production by neutrophils. J. Immunol. 154: 3479-3487. [Abstract]
  33. Weiss, L., A. J. Whitmarsh, D. D. Yang, M. Rincón, R. J. Davis, R. A. Flavell. 2000. Regulation of c-Jun NH2-terminal kinase (Jnk) gene expression during T cell activation. J. Exp. Med. 191: 139-145. [Abstract/Free Full Text]
  34. Tsai, M., T. Takeishi, H. Thompson, K. E. Langley, K. M. Zsebo, D. D. Metcalfe, E. N. Geissler, S. J. Galli. 1991. Induction of mast cell proliferation, maturation, and heparin synthesis by the rat c-kit ligand, stem cell factor. Proc. Natl. Acad. Sci. USA 88: 6382-6386. [Abstract/Free Full Text]
  35. Bennett, B. L., D. T. Sasaki, B. W. Murray, E. C. O’Leary, S. T. Sakata, W. Xu, J. C. Leisten, A. Motiwala, S. Pierce, Y. Satoh, et al 2001. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc. Natl. Acad. Sci. USA 98: 13681-13686. [Abstract/Free Full Text]
  36. Sato, S., R. C. Hughes. 1994. Regulation of secretion and surface expression of Mac-2, a galactoside-binding protein of macrophages. J. Biol. Chem. 269: 4424-4430. [Abstract/Free Full Text]
  37. Rooney, J. W., T. Hoey, L. H. Glimcher. 1995. Coordinate and cooperative roles for NF-AT and AP-1 in the regulation of the murine IL-4 gene. Immunity 2: 473-483. [Medline]
  38. Paron, I., A. Scaloni, A. Pines, A. Bachi, F. T. Liu, C. Puppin, M. Pandolfi, L. Ledda, C. Di Loreto, G. Damante, G. Tell. 2003. Nuclear localization of Galectin-3 in transformed thyroid cells: a role in transcriptional regulation. Biochem. Biophys. Res. Commun. 302: 545-553. [Medline]
  39. Dagher, S. F., J. L. Wang, R. J. Patterson. 1995. Identification of galectin-3 as a factor in pre-mRNA splicing. Proc. Natl. Acad. Sci. USA 92: 1213-1217. [Abstract/Free Full Text]
  40. Blank, U., J. Rivera. 2004. The ins and outs of IgE-dependent mast-cell exocytosis. Trends Immunol. 25: 266-273. [Medline]
  41. Delacour, D., C. I. Cramm-Behrens, H. Drobecq, A. Le Bivic, H. Y. Naim, R. Jacob. 2006. Requirement for galectin-3 in apical protein sorting. Curr. Biol. 16: 408-414. [Medline]
  42. Wang, J. L., R. M. Gray, K. C. Haudek, R. J. Patterson. 2004. Nucleocytoplasmic lectins. Biochim. Biophys. Acta 1673: 75-93. [Medline]



This article has been cited by other articles:


Home page
 Am. J. Pathol.Home page
M. Nachtigal, A. Ghaffar, and E. P. Mayer
Galectin-3 Gene Inactivation Reduces Atherosclerotic Lesions and Adventitial Inflammation in ApoE-Deficient Mice
Am. J. Pathol., January 1, 2008; 172(1): 247 - 255.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. Tasumi and G. R. Vasta
A Galectin of Unique Domain Organization from Hemocytes of the Eastern Oyster (Crassostrea virginica) Is a Receptor for the Protistan Parasite Perkinsus marinus
J. Immunol., September 1, 2007; 179(5): 3086 - 3098.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, H.-Y.
Right arrow Articles by Liu, F.-T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, H.-Y.
Right arrow Articles by Liu, F.-T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS