HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Lukashev, D. Articles by Sitkovsky, M. Search for Related Content PubMed PubMed Citation Articles by Lukashev, D. Articles by Sitkovsky, M. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene

Cutting Edge: Hypoxia-Inducible Factor 1 and Its Activation-Inducible Short Isoform I.1 Negatively Regulate Functions of CD4⁺ and CD8⁺ T Lymphocytes

Dmitriy Lukashev^*, Boris Klebanov^*, Hidefumi Kojima, Alex Grinberg, Akiko Ohta^*, Ludmilla Berenfeld^*, Roland H. Wenger, Akio Ohta^* and Michail Sitkovsky^1,*

^* New England Inflammation and Tissue Protection Institute, Northeastern University, Boston, MA; Division of Immunology, Institute for Medical Science, Dokkyo University School of Medicine, Tochigi, Japan; Laboratory of Mammalian Genes and Development, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD; and Institute of Physiology and Center for Integrative Human Physiology (CIHP), University of Zurich, Zurich, Switzerland

	Abstract

Top Abstract Introduction Materials and Methods Results and Discussion Conclusion Disclosures References

 
To evaluate the role of hypoxia-inducible factor 1 (HIF-1) and its TCR activation-inducible short isoform I.1 in T cell functions, we genetically engineered unique mice with: 1) knockout of I.1 isoform of HIF-1; 2) T cell-targeted HIF-1 knockdown; and 3) chimeric mice with HIF-1 gene deletion in T and B lymphocytes. In all three types of mice, the HIF-1-deficient T lymphocytes, which were TCR-activated in vitro, produced more proinflammatory cytokines compared with HIF-1-expressing control T cells. Surprisingly, deletion of the I.1 isoform, which represents <30% of total HIF-1 mRNA in activated T cells, was sufficient to markedly enhance TCR-triggered cytokine secretion. These data suggest that HIF-1 not only plays a critical role in oxygen homeostasis but also may serve as a negative regulator of T cells.

	Introduction

Top Abstract Introduction Materials and Methods Results and Discussion Conclusion Disclosures References

 
T cells are exposed to different levels of oxygen tension including very low (hypoxia) or the complete oxygen absence (anoxia) as they differentiate, mature, migrate, and function in different tissue microenvironments (1, 2). One of important mechanisms of adaptation of cells to the low oxygen tensions is based on activities of the hypoxia-inducible factor 1 (HIF-1)² (reviewed in Ref. 3). HIF-1 was shown to be necessary for switching to glycolysis (4) and for promoting angiogenesis (5), thus ensuring the cells and tissues survival in hypoxic conditions. Since myeloid cells critically rely on glycolysis for their ATP production, it was shown that targeted deletion of HIF-1 in myeloid cells results in a dramatic decrease in inflammatory activity and survival of macrophages (6).

On the other hand, T cells are not expected to be dependent on HIF-1 for survival to the same extent as macrophages since T cells can produce ATP by both glycolysis and oxidative phosphorylation (7). Accordingly, we have proposed that changes in levels of HIF-1 may play not only the energy-providing but also a regulatory role in T cell functions in inflamed and hypoxic tissue microenvironments (2). This proposal was prompted by our earlier observations of increased inflammatory tissue damage in chimeric mice with complete HIF-1 deletion in cells of adaptive immune system (8). These observations suggested that HIF-1 in T cells may play the anti-inflammatory and tissue-protecting role by negatively regulating T cell functions (2, 9, 10). Our published hypothesis of the inhibitory role of HIF-1 in T cells (2) was recently supported by another group showing that HIF-1 overexpression leads to a decrease in TCR-triggered Ca²⁺ response (11). In addition, HIF-1 was shown to be involved in regulation of CD39, CD73, and A2B adenosine receptor molecules (12, 13), which are known to be involved in anti-inflammatory signaling by extracellular adenosine (14, 15).

HIF-1 expression in T lymphocytes can be induced both by hypoxia (16) and by non-hypoxic pathways, including TCR-triggered and PI3K-mediated pathways, resulting in mRNA up-regulation and protein stabilization (17, 18, 19). We previously demonstrated that T cell activation leads to "immediate early response gene" up-regulation of the alternative mRNA isoform of HIF-1 I.1 (20), which contains a different first exon and is expressed from self promoter in a immune tissue-specific manner (21, 22). Despite that I.1 isoform mRNA encodes protein 12-aa residues shorter than full-sized HIF-1 isoform I.2, it retains the DNA-binding and transcriptional activity (20, 23).

In this report, we describe studies of three new types of gene-altered mice that we developed to directly test the hypothesis whether HIF-1 is a negative regulator of T cells. We show that both known HIF-1 isoforms may function as negative regulators of T cell functions.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results and Discussion Conclusion Disclosures References

 
Generation of I.1-deficient mice

HIF-1-I.1-deficient mice were developed using 129 mouse embryonic stem (ES) cells with targeted I.1 locus and C57BL/6 blastocysts to generate chimeric offsprings, which were mated with C57BL/6 mice to generate F1 mice. An 0.5-kbp BamHI-HindIII fragment containing I.1 exon was replaced with "loxP-I.1 exon-loxP-neo-loxP" cassette, which was subsequently excised by Cre. The targeting vector contained 1.5-kbp XhoI-BamHI 5' homology fragment, 1.5-kbp loxP-I.1 exon-loxP-neo-loxP cassette, 3-kbp HindIII-EcoRI 3' homology fragment, and diphtheria toxin A chain. DNA was digested with SacI/BamHI and analyzed by Southern blot using ³²P-labeled EcoRI-SacI probe, which is located outside of the 3' homology fragment of targeting vector. Properly targeted ES cell clones were transfected with Cre recombinase. ES cell clones with deleted I.1 were microinjected into C57BL/6 blastocysts to generate chimeric mice.

Generation of mice with T cell-specific deletion of HIF-1

Mice with T cell-targeted deletion of HIF-1 gene (Lck-Cre⁺/HIF-1-floxed) have been generated by breeding a homozygous HIF-1-floxed mice (24) with the Lck-Cre transgenic mice (25). Mice that were HIF-1-floxed and heterozygous for Lck-Cre had HIF-1-deficient T cells, whereas control wild-type mice were their Lck-Cre-negative/HIF-1-floxed siblings. Chimeric mice with lymphocyte-specific deletion of HIF-1 were described previously (8).

Reagents

All Abs were obtained from BD Biosciences except anti-HIF-1 mAb (Novus Biologicals). ELISA kits were purchased from R&D Systems. PMA and A23187 were from Sigma-Aldrich. Cells were maintained in RPMI 1640 medium supplemented with 10% heat-inactivated FCS, 100 U/ml penicillin, 100 µg/ml streptomycin, 1 mM HEPES, and 50 µM 2-ME.

RNA preparation and real-time PCR

T lymphocytes were separated from splenocytes, which were incubated with plate-bound anti-CD3/anti-CD28 mAb for 24 h, by auto-MACS separator (Miltenyi Biotec) using FITC-conjugated anti-CD4, anti-CD8 Abs and anti-FITC magnetic beads according to manufacturer’s protocol. RNA was extracted using RNA-STAT-60 (Tel-Test); cDNA was synthesized using 1 µg of total RNA using SuperScript first-strand synthesis kit (Invitrogen Life Technologies) with random hexaprimers. Real-time PCR was performed using SYBR Green master mix (Applied Biosystems) with L32 mRNA as an internal standard. Primers used: I.1 CCCCGTCCACCCATTTCT, CTGGCTTCTTGCTTACAGGAGAG; I.2 CACCGATTCGCCATGGA, TTCGACGTTCAGAACTCATCTTTT; L32 AGCAACAAGAAAACCAAGCACAT, TTGACATTGTGGACCAGGAACT.

	Results and Discussion

Top Abstract Introduction Materials and Methods Results and Discussion Conclusion Disclosures References

 
Generation of mice with T cell-targeted deletion of HIF-1 isoforms

We tested the hypothesis that HIF-1 serves as a negative regulator in activated T lymphocytes (2) using T cells from chimeric mice obtained using the Rag-2 blastocyst-complementation approach as described (8, 26). Then, we studied the role of HIF-1 by developing the HIF-1 isoform I.1-deficient mice. The I.1 exon was disrupted using the vector containing I.1 exon and neomycin resistance gene (neo) surrounded by loxP sites (Fig. 1A). After selection on G418, successfully targeted ES cell clones were found by Southern blot (Fig. 1B). The Neo gene and I.1 exon were subsequently removed via the transient transfection of vector expressing Cre recombinase (Fig. 1C). Chimeric mice were bred to produce HIF-1-I.1^+/– mice. To confirm that the mice indeed do not express I.1 isoform, mRNA from I.1^–/– mice was analyzed by RT-PCR in comparison to I.1^+/+ mice (Fig. 1D). For all experiments, I.1^–/– and I.1^+/+ siblings were used, which were produced by breeding of HIF-1-I.1^+/– heterozygous mice and screened by PCR (Fig. 1E).

View larger version (49K): [in this window] [in a new window]   FIGURE 1. Generation of HIF-1-I.1-deficient mice. A, Strategy used to disrupt I.1 exon of HIF-1. B, BamHI; H, HindIII; R, EcoRI; S, SacI; X, XhoI. B, Southern blot analysis of genomic DNA digested with BamHI/SacI from ES after electroporation with targeting vector; C, after Cre-mediated deletion of the loxP-flanked I.1 exon and Neo. D, RT-PCR analysis of two mRNA isoforms of HIF-1 from wild-type I.1–/– splenocytes activated with 1 µg/ml plate-bound anti-CD3 and anti-CD28 mAb for 24 h compared with -actin mRNA (20 ). E, PCR analysis of genomic DNA obtained from HIF-1-I.1+/+ and HIF-1-I.1–/– mice tails.

Enhanced cytokine production by HIF-1-deficient CD4⁺ and CD8⁺ T lymphocytes

First, we analyzed cytokine production by T cells that lack both isoforms of HIF-1. We compared cytokine secretion by TCR-triggered HIF-1-deficient CD8⁺ T cells (T cell line HID2) obtained from HIF-1-deficient chimeras (8) and the matched HIF-1-expressing control CD8⁺ T cells (line 129D2). We found that at both hypoxic (2% O₂) and normoxic (20% O₂) conditions, HIF-1-deficient T cells secrete more IFN- than wild-type cells (Fig. 2A). In addition, we examined the per cell levels of IFN- in CD8⁺ T cells using intracellular staining. Flow cytometry analysis showed that HIF-1-deficient CD8⁺ T lymphocytes produce more IFN- than wild-type control (Fig. 2B).

View larger version (36K): [in this window] [in a new window]   FIGURE 2. Up-regulation of TCR-triggered IFN- production in HIF-1-deficient T cells. A, IFN- secretion by HIF-1–/– CD8+ T cell line HID2 derived from HIF-1/RAG-2 chimera spleen cells and normal CTL line 129D2 derived from spleen cells of a 129 mouse, incubated with different concentrations of plate-bound anti-CD3 mAb for 48 h under normoxic conditions (20% O2) or hypoxic (2% O2). B, Flow cytometry analysis of intracellular IFN- production by splenocytes from HIF-1–/– chimeras vs 129 mice incubated with 5 µg/ml plate-bound anti-CD3 mAb for 24 h before addition of 2 µM monensin. C, IFN- secretion by Lck-Cre+/HIF-1–/– T cells compared with wild-type (HIF-1-floxed) activated with 0.1 µg/ml soluble anti-CD3 mAb. D, Intracellular IFN- production in Lck-Cre+/HIF-1–/– CD4+ and CD8+ T cells compared with wild-type cells incubated with 0.1 µg/ml soluble anti-CD3 for 24, followed by addition of 20 ng/ml PMA and 200 ng/ml A23187 for 2 h (where indicated). Quantity of IFN--positive CD4+ and CD8+ T cells were measured by flow cytometry after preincubation with 10 µg/ml brefeldin A for 4 h. *, p < 0.05 compared with the wild-type.

Short isoform I.1 is a minor HIF-1 isoform

We confirmed and extended our previous observation (20) showing that activation of splenocytes with anti-CD3/anti-CD28 Abs induced expression of I.1 mRNA and, to a lesser degree, I.2 mRNA (Fig. 3A). To determine proportions of short and long HIF-1 isoforms in purified T lymphocytes, we first activated splenocytes with plate-bound anti-CD3/anti-CD28 mAb, and then separated T cells from B cells and macrophages using auto-MACS magnetic sorter. Surprisingly, even up regulated I.1 mRNA amounts in T cells were approximately 3 times lower than amounts of I.2 mRNA isoform of HIF-1 (Fig. 3B). The observation that I.1 is a minor isoform of HIF-1 was confirmed by Western blot analysis, which showed no significant differences in HIF-1 protein quantity between wild-type and I.1^–/– splenocytes after the TCR activation (Fig. 3C). These data indicate that despite the enhanced expression in activated T cells, I.1 isoform of HIF-1 represent only a small proportion of total HIF-1.

View larger version (21K): [in this window] [in a new window]   FIGURE 3. I.1 is a minor HIF-1 isoform. A, Real-time RT-PCR analysis of I.1 and I.2 isoforms in activated splenocytes from C57BL/6 mice (n = 4) incubated with 1 µg/ml plate-bound anti-CD3/anti-CD28 mAb for 24 h. B, Relative amounts of I.1 and I.2 mRNA isoforms in activated T cells purified from splenocytes of C57BL/6 mice (n = 3) measured by real-time RT-PCR. Standard amplification curves for I.1 and I.2 isoforms were calculated using 5 ng of I.1 and I.2 cDNA. C, Western blot analysis of HIF-1 expression in wild-type and I.1–/– splenocytes incubated with or without 1 µg/ml plate-bound anti-CD3/anti-CD28 mAb for 24 h (u/t, untreated; CD3, CD3/CD28-activated).

Lack of I.1 isoform of HIF-1 results in enhanced secretion of proinflammatory cytokines

Surprisingly, in view of low abundancy expression of short I.1 HIF-1 among total HIF-1 molecular species, we found that the lymph node-derived I.1-deficient cells produce more IFN-, TNF- (Fig. 4A), IL-2, IL-4, and IL-13 (data not shown) upon TCR activation, in both normoxic and hypoxic conditions. The similar effect was observed in splenocytes that were TCR activated by anti-CD3 and anti-CD28 Abs (Fig. 4B). In addition, I.1 isoform deficiency led to up-regulation of proinflammatory secretion by splenocytes activated by allogenic MLC, when splenocytes were activated with H-2k^d MHC class I expressing splenocytes from DBA/2 mice (Fig. 4C).

View larger version (27K): [in this window] [in a new window]   FIGURE 4. Enhanced secretion of proinflammatory cytokines by I.1-deficient immune cells. IFN- and TNF- secretion by immune cells from wild-type (n = 3) and I.1–/– mice (n = 3) lymph nodes (A) and spleens (B) activated in triplicates with 1 µg/ml plate-bound anti-CD3/anti-CD28 mAb for 24 and 48 h, or by mitomycin C-treated DBA/2 splenocytes for 72 h (C). *, p < 0.05 compared with the wild type. Experiments were repeated at least three times.

	Conclusion

Top Abstract Introduction Materials and Methods Results and Discussion Conclusion Disclosures References

 
Our suggestion of the anti-inflammatory role of HIF-1 in T cells was based on our observations of autoimmunity and inflammatory tissue damage in chimeric mice with complete HIF-1 deletion in lymphocytes (8). Here we demonstrate that HIF-1 and activation-inducible short isoform I.1 play an anti-inflammatory role in T cells. Our data suggest that I.1 isoform is disproportionately important in negative regulation of activated T cells and may function as a physiological regulator of T cells by attenuating the T cell activation in a delayed feed-back manner. We suggest that one of the appealing but yet to be tested hypothesis is that increased transcriptional activity of up-regulated HIF-1 and particularly its short isoform may result in higher rates of glycolysis, intracellular acidification, and suboptimal activities of pH dependent enzymes involved in transmembrane signaling and T cell effector functions. Another possibility is that the short isoform of HIF-1 may inhibit NF-B activity (e.g., by binding and retaining NF-B from nuclear translocation, or by up-regulation of expression of IB), and thereby inhibit proinflammatory transcription. We suggest that HIF-1-mediated anti-inflammatory pathway in T cells is complementary to tissue-protecting immunosuppressive signaling by extracellular adenosine (2, 14, 15, 28, 29), which is accumulated in hypoxic conditions (30, 31).

	Acknowledgments

 
We thank Dr. Randall Johnson for providing HIF-1-floxed mice and Dr. Karl Pfeifer for help in designing knockout of I.1 isoform.

	Disclosures

Top Abstract Introduction Materials and Methods Results and Discussion Conclusion Disclosures References

 
The authors have no financial conflict of interest.

	Footnotes

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ Address correspondence and reprint requests to: Dr. Michail Sitkovsky, New England Inflammation and Tissue Protection Institute, Northeastern University, 360 Huntington Avenue, 113MU, Boston, MA 02115. E-mail address: m.sitkovsky{at}neu.edu

² Abbreviations used in this paper: HIF-1, hypoxia-inducible factor 1; ES cells, embryonic stem cell.

Received for publication May 22, 2006. Accepted for publication August 10, 2006.

	References

Top Abstract Introduction Materials and Methods Results and Discussion Conclusion Disclosures References

 

1. Caldwell, C. C., H. Kojima, D. Lukashev, J. Armstrong, M. Farber, S. G. Apasov, M. V. Sitkovsky. 2001. Differential effects of physiologically relevant hypoxic conditions on T lymphocyte development and effector functions. J. Immunol. 167: 6140-6149. [Abstract/Free Full Text]
2. Sitkovsky, M., D. Lukashev. 2005. Regulation of immune cells by local-tissue oxygen tension: HIF-1 and adenosine receptors. Nat. Rev. Immunol. 5: 712-721. [Medline]
3. Semenza, G. L.. 1998. Hypoxia-inducible factor 1: master regulator of O₂ homeostasis. Curr. Opin. Gene Dev. 8: 588-594. [Medline]
4. Semenza, G. L., P. H. Roth, H. M. Fang, G. L. Wang. 1994. Transcriptional regulation of genes encoding glycolytic enzymes by hypoxia-inducible factor 1. J. Biol. Chem. 269: 23757-23763. [Abstract/Free Full Text]
5. Forsythe, J. A., B. H. Jiang, N. V. Iyer, F. Agani, S. W. Leung, R. D. Koos, G. L. Semenza. 1996. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol. Cell Biol. 16: 4604-4613. [Abstract]
6. Cramer, T., Y. Yamanishi, B. E. Clausen, I. Forster, R. Pawlinski, N. Mackman, V. H. Haase, R. Jaenisch, M. Corr, V. Nizet, et al 2003. HIF-1 is essential for myeloid cell-mediated inflammation. Cell 112: 645-657. [Medline]
7. Brand, K. A., U. Hermfisse. 1997. Aerobic glycolysis by proliferating cells: a protective strategy against reactive oxygen species. FASEB J. 11: 388-395. [Abstract]
8. Kojima, H., H. Gu, S. Nomura, C. C. Caldwell, T. Kobata, P. Carmeliet, G. L. Semenza, M. V. Sitkovsky. 2002. Abnormal B lymphocyte development and autoimmunity in hypoxia-inducible factor 1-deficient chimeric mice. Proc. Natl. Acad. Sci. USA 99: 2170-2174. [Abstract/Free Full Text]
9. Sitkovsky, M. V., D. Lukashev, S. Apasov, H. Kojima, M. Koshiba, C. Caldwell, A. Ohta, M. Thiel. 2004. Physiological control of immune response and inflammatory tissue damage by hypoxia-inducible factors and adenosine A2A receptors. Annu. Rev. Immunol. 22: 657-682. [Medline]
10. Sitkovsky, M. V., A. Ohta. 2005. The ‘danger’ sensors that STOP the immune response: the A2 adenosine receptors?. Trends Immunol. 26: 299-304. [Medline]
11. Neumann, A. K., J. Yang, M. P. Biju, S. K. Joseph, R. S. Johnson, V. H. Haase, B. D. Freedman, L. A. Turka. 2005. Hypoxia inducible factor 1 regulates T cell receptor signal transduction. Proc. Natl. Acad. Sci. USA 102: 17071-17076. [Abstract/Free Full Text]
12. Eltzschig, H. K., L. F. Thompson, J. Karhausen, R. J. Cotta, J. C. Ibla, S. C. Robson, S. P. Colgan. 2004. Endogenous adenosine produced during hypoxia attenuates neutrophil accumulation: coordination by extracellular nucleotide metabolism. Blood 104: 3986-3992. [Abstract/Free Full Text]
13. Eltzschig, H. K., J. C. Ibla, G. T. Furuta, M. O. Leonard, K. A. Jacobson, K. Enjyoji, S. C. Robson, S. P. Colgan. 2003. Coordinated adenine nucleotide phosphohydrolysis and nucleoside signaling in posthypoxic endothelium: role of ectonucleotidases and adenosine A2B receptors. J. Exp. Med. 198: 783-796. [Abstract/Free Full Text]
14. Ohta, A., M. Sitkovsky. 2001. Role of G-protein-coupled adenosine receptors in downregulation of inflammation and protection from tissue damage. Nature 414: 916-920. [Medline]
15. Lappas, C. M., J. M. Rieger, J. Linden. 2005. A2A adenosine receptor induction inhibits IFN- production in murine CD4+ T cells. J. Immunol. 174: 1073-1080. [Abstract/Free Full Text]
16. Wang, G. L., G. L. Semensa. 1993. General involvement of hypoxia-inducible factor 1 in transcriptional response to hypoxia. Proc. Natl. Acad. Sci. USA 90: 4304-4308. [Abstract/Free Full Text]
17. Hudson, C. C., M. Liu, G. G. Chiang, D. M. Otterness, D. C. Loomis, F. Kaper, A. J. Giaccia, R. T. Abraham. 2002. Regulation of hypoxia-inducible factor 1 expression and function by the mammalian target of rapamycin. Mol. Cell Biol. 22: 7004-7014. [Abstract/Free Full Text]
18. Nakamura, H., Y. Makino, K. Okamoto, L. Poellinger, K. Ohnuma, C. Morimoto, H. Tanaka. 2005. TCR engagement increases hypoxia-inducible factor-1 protein synthesis via rapamycin-sensitive pathway under hypoxic conditions in human peripheral T cells. J. Immunol. 174: 7592-7599. [Abstract/Free Full Text]
19. Thornton, R. D., P. Lane, R. C. Borghaei, E. A. Pease, J. Caro, E. Mochan. 2000. Interleukin 1 induces hypoxia-inducible factor 1 in human gingival and synovial fibroblasts. Biochem. J. 350: 307-312. [Medline]
20. Lukashev, D., C. Caldwell, A. Ohta, P. Chen, M. Sitkovsky. 2001. Differential regulation of two alternatively spliced isoforms of hypoxia-inducible factor-1 in activated T lymphocytes. J. Biol. Chem. 276: 48754-48763. [Abstract/Free Full Text]
21. Wenger, R. H., A. Rolfs, P. Spielmann, D. R. Zimmermann, M. Gassmann. 1998. Mouse hypoxia-inducible factor-1 is encoded by two different mRNA isoforms—expression from a tissue-specific and a housekeeping-type promoter. Blood 91: 3471-3480. [Abstract/Free Full Text]
22. Marti, H. H., D. M. Katschinski, K. F. Wagner, L. Schaffer, B. Stier, R. H. Wenger. 2002. Isoform-specific expression of hypoxia-inducible factor-1 during the late stages of mouse spermiogenesis. Mol. Endocrinol. 16: 234-243. [Abstract/Free Full Text]
23. Gorlach, A., G. Camenisch, I. Kvietikova, L. Vogt, R. H. Wenger, M. Gassmann. 2000. Efficient translation of mouse hypoxia-inducible factor-1 under normoxic and hypoxic conditions. Biochim. Biophys. Acta 1493: 125-134. [Medline]
24. Ryan, H. E., M. Poloni, W. McNulty, D. Elson, M. Gassmann, J. M. Arbeit, R. S. Johnson. 2000. Hypoxia-inducible factor-1 is a positive factor in solid tumor growth. Cancer Res. 60: 4010-4015. [Abstract/Free Full Text]
25. Takahama, Y., K. Ohishi, Y. Tokoro, T. Sugawara, Y. Yoshimura, M. Okabe, T. Kinoshita, J. Takeda. 1998. Functional competence of T cells in the absence of glycosylphosphatidylinositol-anchored proteins caused by T cell-specific disruption of the Pig-a gene. Eur. J. Immunol. 28: 2159-2166. [Medline]
26. Chen, J., R. Lansford, V. Stewart, F. Young, F. W. Alt. 1993. RAG-2-deficient blastocyst complementation: an assay of gene function in lymphocyte development. Proc. Natl. Acad. Sci. USA 90: 4528-4532. [Abstract/Free Full Text]
27. Ryan, H. E., J. Lo, R. S. Johnson. 1998. HIF-1 is required for solid tumor formation and embryonic vascularization. EMBO J. 17: 3005-3015. [Medline]
28. Thiel, M., A. Chouker, A. Ohta, E. Jackson, C. Caldwell, P. Smith, D. Lukashev, I. Bittmann, M. V. Sitkovsky. 2005. Oxygenation inhibits the physiological tissue-protecting mechanism and thereby exacerbates acute inflammatory lung injury. PLoS Biol. 3: e174[Medline]
29. Cronstein, B. N.. 1994. Adenosine, an endogenous anti-inflammatory agent. J. Appl. Physiol. 76: 5-13. [Abstract/Free Full Text]
30. Van Belle, H., F. Goossens, J. Wynants. 1987. Formation and release of purine catabolites during hypoperfusion, anoxia, and ischemia. Am. J. Pathol. 252: H886-H893.
31. Winn, H. R., R. Rubio, R. R. Curnish, R. M. Berne. 1981. Changes in regional cerebral blood flow (rCBF) caused by increase in CSF concentrations of adenosine and 2-chloroadenosine (CHL-ADO). J. Cereb. Blood Flow Metab. 1: 401-402.

This article has been cited by other articles:

				J. Jantsch, D. Chakravortty, N. Turza, A. T. Prechtel, B. Buchholz, R. G. Gerlach, M. Volke, J. Glasner, C. Warnecke, M. S. Wiesener, et al. Hypoxia and Hypoxia-Inducible Factor-1{alpha} Modulate Lipopolysaccharide-Induced Dendritic Cell Activation and Function J. Immunol., April 1, 2008; 180(7): 4697 - 4705. [Abstract] [Full Text] [PDF]

				S. Srinivasan, D. T. Bolick, D. Lukashev, C. Lappas, M. Sitkovsky, K. R. Lynch, and C. C. Hedrick Sphingosine-1-Phosphate Reduces CD4+ T-Cell Activation in Type 1 Diabetes Through Regulation of Hypoxia-Inducible Factor Short Isoform I.1 and CD69 Diabetes, February 1, 2008; 57(2): 484 - 493. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Lukashev, D. Articles by Sitkovsky, M. Search for Related Content PubMed PubMed Citation Articles by Lukashev, D. Articles by Sitkovsky, M. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene