|
|
||||||||
-Herpesvirus 68 Limits Naturally Occurring CD4+CD25+ T Regulatory Cell Activity following Infection1
Department of Biology, University of North Carolina, Charlotte, NC 28223
| Abstract |
|---|
|
|
|---|
-Herpesviruses are efficacious pathogens which are well-known for their ability to induce lymphoproliferative disease and to establish latency in the host. However, no studies have investigated the importance of naturally occurring CD4+CD25+ T regulatory cells during infection with these viruses. Using the murine model of
-herpesvirus infection, murine
-herpesvirus 68 (
HV-68), we were surprised to find that levels of the CD4+CD25+ T regulatory cell transcript, FoxP3, continued to decrease as viral latency increased and as the leukocytosis phase of the disease progressed. Consistent with these results, the decrease in FoxP3 protein expression followed similar kinetics. Along with the reduced expression of this regulatory T cell marker, we also observed diminished CD4+CD25+ T regulatory cell activity in these cells isolated from
HV-68-infected animals. Dendritic cells infected in vitro with
HV-68 did not alter the ability of normal CD4+CD25+ regulatory T cells to limit the proliferation of CD4+ Th cells following stimulation. Taken together, these studies demonstrate a decreased presence and activity of CD4+CD25+ T regulatory cells during the mononucleosis-like phase of this viral infection. These alterations in naturally occurring T regulatory cell function may help to explain the dysregulation of the hosts immune response which allows the uncontrolled expansion of leukocytes as viral latency is established. | Introduction |
|---|
|
|
|---|
Naturally occurring CD4+CD25+ T regulatory cells also play an important role during the response against microbial pathogens. These regulatory cells help to maintain a balance between pathogen-induced inflammation and the development of a protective host response (20, 21, 22). However, the manipulation of CD4+CD25+ T regulatory cells by depletion or transfer during infectious diseases has demonstrated that it is difficult to predict the exact role that these cells will play in any given microbial infection. In some cases, the depletion of CD4+CD25+ T regulatory cells can be beneficial and protect the host from a lethal infection with the parasite, Plasmodium yoelii (23). In such cases, it appears that the function of these T regulatory cells is to limit the protective host response to the benefit of the parasite. T regulatory cells may also contribute to viral persistence by limiting CD8+ T lymphocyte activity (24), or contributing to viral-induced disease progression (25). However, increases in CD4+CD25+ T regulatory cell activity following some viral infections serve to limit the destructive nature of pathogen-induced inflammation. Following infection with the
-herpesvirus, HSV, an increased number of CD4+CD25+ T regulatory cells were observed at the site of infection (17). Depletion of these cells before infection resulted in decreased viral burdens (13), however, depletion of CD4+CD25+ T regulatory cells also resulted in an increased severity of viral-induced inflammatory lesions of the cornea (17). In this case, it appears that the presence of T regulatory cells limits the destructive inflammatory response, thereby benefiting the host. A review of the T regulatory cell response (20, 21, 22, 26) demonstrates that the activity of CD4+CD25+ T regulatory cells may favor the host, or may favor the pathogen, depending upon the infectious agent being investigated.
Despite the importance of naturally occurring CD4+CD25+ T regulatory cells during infectious diseases, no investigations have focused on the role of these cells during a developing herpesvirus infection. In this study, we have used murine
-herpesvirus 68 (
HV-68)3 as a model of a latent, leukotropic viral infection (27, 28, 29) which induces a mononucleosis-like disease (30, 31). Intranasal inoculation with
HV-68 results in an acute, productive infection of the lung epithelium. This initial infection is followed by a mononucleosis-like disease where viral latency is established and persists for the life of the host. The initiation of an immune response in normal mice is insufficient to prevent the initial infection, as well as the establishment of latency (32). This fact demonstrates the efficacious nature of this viral pathogen, and provides a model system to explore viral evasion of the host response.
Based on the results previously reported using a mouse model of
-herpesvirus infection (13, 17), we anticipated that
-herpesvirus infected animals would demonstrate increased numbers and/or activity of CD4+CD25+ regulatory cells. Surprisingly, we found that expression of the T regulatory cell marker, FoxP3, was markedly decreased following
HV-68 infection. This result correlated with a decrease in CD4+CD25+ T regulatory cell activity in these
-herpesvirus-infected animals. The viral-induced reduction in the percentage and activity of CD4+CD25+ T regulatory cells correlated with the development of the mononucleosis-like disease and with the peak of viral latency. Together, these results demonstrate the ability of
HV-68 to limit the naturally occurring T regulatory cell response following infection. This virus-induced reduction in natural CD4+CD25+ T regulatory cells may provide an environment which allows proinflammatory responses to be perpetuated as leukocytosis develops and viral latency is established.
| Materials and Methods |
|---|
|
|
|---|
HV-68 was provided by Dr. A. Nash (University of Edinburgh, Edinburgh, U.K.) and Dr. P. Doherty (St. Judes Hospital, Memphis, TN). Virus stock was prepared by infecting BHK-21 cells (CCL-10; American Type Culture Collection (ATCC)) with
HV-68 at a low multiplicity of infection, followed by isolation of virus as previously described (33, 34, 35, 36). Replicating virus present in viral stocks was quantified using serial dilutions on NIH-3T12 cell (CCL-164; ATCC) monolayers.
Intranasal inoculations with
HV-68 or UV-inactivated virus
Female C57BL/6J mice, 68 wk old, (The Jackson Laboratory), were housed under specific pathogen-free conditions. Mice were given food and water ad libitum, and were housed in isolation cages throughout the experimental period. All experiments were approved by, and conducted following the guidelines set forth by, University of North Carolina (Charlotte, NC) Institutional Animal Care and Use Committee. Intranasal inoculations with
HV-68 were performed as previously described (33, 34, 35, 36). Briefly, mice were anesthetized and allowed to aspirate, via the nasal passages, 20 µl of inoculum containing 6 x 104 PFU of
HV-68. Animals exposed to UV-inactivated
HV-68 were used as controls. For UV inactivation, viral stocks, containing equivalent numbers of PFU as that used for infection, were exposed to UV light (1165 J/m2). Viral plaque assays were performed following inactivation to assure that UV-treated virus stocks contained no detectable levels of infectious virus. For these controls, mice were anesthetized in an identical manner and allowed to aspirate 20 µl of UV-killed
HV-68.
Isolation of splenic leukocytes and purification of CD4+CD25+ and CD4+CD25 T cells
At varying time points postinfection, spleens were harvested and single-cell suspensions were made by pressing spleens through a 30-gauge wire mesh, followed by hypotonic lysis of RBC. CD4+CD25+ and CD4+CD25 T cells were isolated using a regulatory T cell isolation kit (Miltenyi Biotec), according to the manufacturers instructions. Briefly, splenic leukocytes were depleted of non-CD4+ T cells by indirectly labeling non-CD4+ T cells with a biotinylated-Ab mixture and anti-biotin microbeads. CD4+CD25+ T cells were directly labeled with CD25-PE Ab before magnetic separation (VarioMACS; Miltenyi Biotec). The flow-through fraction of CD4+ T cells were then magnetically labeled with anti-PE microbeads, and a second magnetic separation was performed to separate CD4+CD25 T cells from CD4+CD25+ T cells.
Semiquantitative RT-PCR to detect mRNA expression following
HV-68 infection
To detect the presence of mRNA encoding FoxP3 and GAPDH, semiquantitative RT-PCR analyses were performed as previously described (37, 38). Briefly, total RNA from isolated cells or spleen and mediastinal lymph node homogenates was extracted with TRIzol reagent (Invitrogen Life Technologies). A total of 1 µg of total RNA was reversed-transcribed using SuperScriptII reverse transcriptase, (Invitrogen Life Technologies), and a portion of the total cDNA was amplified by PCR using 94°C denaturation, 59°C annealing, and 72°C extension temperatures, with the first three cycles having extended times. Positive and negative strand primers used for the amplification of each mRNA species were as follows: FoxP3, 30 cycles, CAGCTGCCTACAGTGCCCCTA and CATTTGCCAGCAGTGGGTAG; and GAPDH, 23 cycles, CCATCACCATCTTCCAGGAGCAGCGAG and CACAGTCTTCTGGGTGGCAGTGAT, respectively. Amplified products were electrophoresed on ethidium bromide-stained gels and visualized under UV illumination.
Real-time PCR
Real-time PCR was performed as previously described (39). Briefly, amplifications were conducted in a total volume of 20 µl containing QuantiTect SYBR Green PCR Master Mix, primer pairs, template cDNA and RNase-free water. Reactions were also run in the absence of template cDNA to detect any contamination for each primer set. At the conclusion of the PCR, the temperature was increased from 50°C to 99°C at a rate of 0.2°C/s, and the fluorescence was measured continuously to construct the melting curve. In addition, for each primer pair, a cDNA sample that was positive for the target was serially diluted and amplified with the experimental samples to enable calculation of the efficiencies (E) of the amplifications. The relative message levels of each target gene were normalized to the housekeeping gene GAPDH, using the method of Pfaffl (40). Briefly, the crossing points (Cp) for each target gene were normalized to the Cp of the housekeeping gene by the formula: relative expression ratio = (Etarget
CPtarget (control sample))/(Eref
CPref (control sample)), with the control values being FoxP3 or GAPDH expression within uninfected tissue. Positive and negative strand primers used for real-time amplification of each mRNA species were as follows: FoxP3, GGCCCTTCTCCAGGACAGA and GCTGATCATGGCTGGGTTGT; GAPDH, CCATCACCATCTTCCAGGAGCAGCGAG and CACAGTCTTCTGGGTGGCAGTGAT, respectively.
Western blot analyses
For immunoblots, isolated CD4+CD25+ or CD4+CD25 T cells were directly lysed in Laemmli sample buffer, separated on 10% SDS-PAGE gels, and transferred to polyvinylidene fluoride filters (Millipore). Filters were blocked in 5% nonfat, dry milk overnight, washed, and incubated for 4 h with a monospecific, polyclonal rabbit anti-FoxP3 Ab (Poly6238; BioLegend) at a dilution of 1/500 in 5% nonfat, dry milk. After washing, filters were then probed for 45 min with a HRP-conjugated anti-rabbit IgG Ab (Cell Sciences), at a dilution of 1/5000 in a solution of 2% BSA and 2% nonfat, dry milk. Chemiluminescent detection was performed with SuperSignal West Pico Substrate (Pierce), per manufacturers instructions. Following development, filters were stripped and reprobed with a goat polyclonal anti-actin Ab (SC1616; Santa Cruz Biotechnology), followed by a HRP-conjugated bovine anti-goat IgG Ab (Santa Cruz Biotechnology), to control for protein loading in each lane. In addition, molecular mass standards (Precision Plus Protein Standards; Bio-Rad) were electrophoresed on each gel so that the relative molecular mass of immunoreactive FoxP3 could be determined.
FACS analyses
The phenotypic characterization of cells was performed using a FACSCalibur instrument (BD Biosciences) and CellQuest software as previously described (41). Briefly, splenocytes were isolated from naive and
HV-68-infected mice as described above. Splenic leukocytes were washed with PBS and resuspended in 10% nonimmune rabbit serum (Zymed Laboratories), and FcBlock (anti-mouse CD16/CD32; BD Biosciences) for 20 min at 4°C. A FITC-conjugated anti-mouse CD4 Ab (BD Biosciences) was added to aliquots of cell suspension at a dilution of 1/100, and the incubation continued for 30 min at 4°C in the dark. Control samples were prepared using isotype-matched, irrelevant Abs which were fluorochrome-conjugated (BD Biosciences). Cells were washed three times with PBS, resuspended in fixation/permeabilization buffer (eBioscience), and incubated overnight at 4°C. Cells were then washed in permeabilization buffer twice, and the pellet was resuspended in rabbit serum and FcBlock (anti-mouse CD16/CD32; BD Biosciences) and incubated for 15 min at 4°C. A monoclonal PE-conjugated rat anti-mouse FoxP3 Ab (clone FJK-16s; eBioscience), was added to the cell suspensions at a dilution of 1/100, and the incubation continued for 30 min at 4°C in the dark. Control samples were prepared using isotype-matched, irrelevant Abs which were fluorochrome-conjugated (BD Biosciences). Cells were washed three times with permeabilization buffer, resuspended in PBS, and kept at 4°C in the dark until FACS analyses were performed. For each sample, data from 10,000 volume-gated viable cells were collected.
For some studies, CD4+ T lymphocytes were positively selected using anti-CD4 conjugated magnetic beads (Miltenyi Biotec) before staining. Following magnetic separation, CD4+ cells were washed with PBS and resuspended in 10% nonimmune rabbit serum (Zymed Laboratories), and FcBlock (BD Biosciences) for 20 min at 4°C. A FITC-conjugated anti-mouse CD25 Ab (BD Biosciences) was added to aliquots of cell suspension at a dilution of 1/100, and the incubation continued for 30 min at 4°C in the dark. Cells were then washed three times with PBS, resuspended in fixation/permeabilization buffer (eBioscience), and stained for FoxP3 expression as described above, incubated overnight at 4°C. For each sample, data from 10,000 volume-gated viable cells were collected.
Infectious centers assay
The presence of latent virus was quantified using an infectious centers assay as previously described (33, 34, 35, 36). Limiting dilutions of isolated splenic leukocytes were placed onto monolayers of NIH 3T12 cells. After 24 h, an agar overlay supplemented with medium and FBS was added and allowed to incubate for 5 days. The monolayers were then fixed and stained with crystal violet and the number of infectious centers counted in triplicate for several dilutions of cells for each experimental condition.
Proliferation assay to quantify CD4+CD25+ T regulatory cell activity
CD4+ T lymphocytes were negatively isolated from splenocytes of normal C57BL/6 mice. Briefly, single-cell suspensions were made from spleens, and depleted of non-CD4+ T cells using a magnetic cell sorter (VarioMACS; Miltenyi Biotec) and a CD4+ T cell isolation kit (Miltenyi Biotec). CD4+CD25+ T regulatory cells were isolated from uninfected or
HV-68-infected mice as described above. Cocultures of CD4+ T cells (1 x 105 cells/well) and CD4+CD25+ T cells (at the indicated ratios per well) were placed in flat-bottom 96-well plates that had been coated with anti-mouse CD3 (BD Biosciences) in RPMI 1640 (Invitrogen Life Technologies) supplemented with 10% FBS. Wells containing only CD4+ T cells, at the appropriate number of cells per well, were used as positive controls. Cells were cultured for 72 h (Isotemp incubator; Fisher Scientific), with the last 18 h of culture being in the presence of 1 µCi/well tritiated thymidine (MP Biomedicals). Cells were harvested (PHD cell harvester; Brandel), and incorporation of radiolabel was determined by scintillation counting.
IFN-
secretion to quantify CD4+CD25+ T regulatory cell activity
CD4+ T cells were isolated from normal C57BL/6 mice, and CD4+CD25+ T cells were isolated from normal or
HV-68-infected animals as described above. CD4+ T cells (2 x 104 cells/well) and CD4+CD25+ T cells (at the indicated ratios per well) were placed in round-bottom 96-well plates containing 2 µl of anti-CD3 and anti-CD28 Ab conjugated beads (Dynabeads; Invitrogen Life Technologies) in RPMI 1640 (Invitrogen Life Technologies) supplemented with 10% FBS. Wells containing only CD4+ T cells, at the appropriate number of cells per well, and anti-CD3 and anti-CD28 Ab-conjugated beads were used as positive controls. Cells were cultured for 5 days (Isotemp incubator; Fisher Scientific). Following incubation, culture supernatants were collected and assayed for IFN-
production via ELISA as previously described (35). The lower limit of detection was 10 pg/ml.
CD4+CD25+ T regulatory cell activity in the presence of
HV-68-infected dendritic cells
Bone marrow-derived dendritic cells were isolated as previously described (35, 41). Briefly, femurs of naive C57BL/6 mice were flushed with RPMI 1640 (Invitrogen Life Technologies), containing 2% FBS to collect total bone marrow cells. Total bone marrow cells were washed once and resuspended in RPMI 1640 containing 12% FBS and 1000 U/ml GM-CSF (BD Biosciences). After 3 days in culture, nonadherent cells were removed, washed, and resuspended in RPMI 1640 containing 10% FBS. Dendritic cells were then uninfected or exposed to
HV-68 at a multiplicity of infection of 10. After 24 h, uninfected and infected dendritic cells were washed and 4 x 104 cells added to cocultures of CD4+ T cells and CD4+CD25+ T cells, both isolated from normal mice as described above. Cells were cultured in round-bottom 96-well plates containing 2 µl of anti-CD3 and anti-CD28 Ab-conjugated beads (Invitrogen Life Technologies) in RPMI 1640 (Invitrogen Life Technologies) supplemented with 10% FBS. Wells containing only CD4+ T cells, at the appropriate number of cells per well, and anti-CD3 and anti-CD28 Ab-conjugated beads were used as positive controls. Cells were cultured for 72 h with the last 18 h of culture being in the presence of tritiated thymidine (MP Biomedicals). Cells were harvested as described above for proliferation assays.
Statistical analyses
Statistically significant differences in FoxP3 expression in spleen tissue, mediastinal lymph node tissue, or isolated cell populations of infected animals as compared with uninfected were determined using the Student t test (Graphpad), as well as differences between IFN-
production and tritiated thymidine incorporation.
| Results |
|---|
|
|
|---|
HV-68 induced down-regulation of FoxP3 mRNA expression in vivo
The transcriptional regulator, FoxP3, is expressed by CD4+CD25+ T regulatory cells (2, 3, 4), and has been used as a marker to identify such cell populations (13). To begin to define the role of these regulatory T cells during a developing infection with the
-herpesvirus,
HV-68, we followed the level of expression of the mRNA encoding FoxP3 in lymphoid tissues. C57BL/6 mice were uninfected or intranasally inoculated with infectious or UV-killed virus. At the indicated times, the mediastinal lymph nodes and spleens were removed and FoxP3 mRNA expression determined by semiquantitative RT-PCR (Figs. 1, A and C) and real-time PCR (Fig. 1, B and D) in whole tissues, respectively. Beginning at day 2 in the mediastinal lymph nodes, and day 10 in the spleen, the levels of FoxP3 mRNA expression in mice exposed to
HV-68 decreased significantly when compared with uninfected mice (Fig. 1, B and D) and when compared with mice given UV-inactivated virus (Fig. 1D). Therefore, the kinetics of decreasing FoxP3 mRNA expression in the draining and peripheral lymphoid organs (Fig. 1, AD) correlated with increasing numbers of cells harboring latent virus (Fig. 1E) (31, 33, 34, 35, 36). To assure that the decreases observed were not due to significant differences in input RNA or efficiencies of reverse transcription between samples, amplification of the housekeeping gene, G3PDH, was performed on the same cDNA samples for comparison.
|
HV-68-induced decreases in FoxP3 mRNA expression occurred in the CD4+CD25+ cell population, these cells were isolated from spleens at varying times postinfection. RNA was isolated, and FoxP3 mRNA expression was determined using semiquantitiative RT-PCR (Fig. 2A) and real-time PCR (Fig. 2B). As early as day 5 postinfection (Fig. 2B), there was a significant decrease in the levels of FoxP3 mRNA expression in the CD4+CD25+ T cell population. Decreased expression of this transcript was also evident at days 10 and 15 postinfection (Fig. 2B), with real-time PCR analyses demonstrating an
17-fold decrease in message expression when compared with levels observed in uninfected mice (Fig. 2C). As expected (2, 3, 4), these studies demonstrated that the CD4+CD25+ population of cells expressed the bulk of FoxP3 transcripts (Fig. 2, A and B). Furthermore, we observed no significant alteration in the level of FoxP3 mRNA expression in the CD4+CD25 population of cells at any time following infection with
HV-68 (Fig. 2B).
|
HV-68
Intracellular staining for FoxP3 was performed to demonstrate that the viral-induced decrease in FoxP3 mRNA expression (Figs. 1 and 2) translated into diminished FoxP3 protein production. For these studies, splenic leukocytes were isolated from naive and
HV-68-infected mice and stained for both FoxP3 and CD4 expression. FACS analyses demonstrated a progressive decline in the percentage of FoxP3+CD4+ cells following infection (Table I).
|
HV-68-infected mice. These isolated CD4+ T cells were then stained for both FoxP3 and CD25 expression. FACS analysis demonstrated a progressive decline in the percentage of FoxP3+CD25+ following infection (Table II). A representative dot plot showing decreased percentages of double-positive cells following
HV-68 infection is shown in Fig. 3.
|
|
HV-68 infection
To confirm the results obtained using FACS analyses, Western blot analyses were also performed to show a viral-induced decrease in FoxP3 protein expression (Fig. 4). Importantly, the Western blot analyses were performed using a different anti-FoxP3 Ab than that used for FACS analyses (Tables I and II and Fig. 3). For these studies, CD4+CD25+ and CD4+CD25 T cell populations were isolated from mice at varying times postinfection. Using a monospecific, polyclonal anti-FoxP3 Ab, Western blot analyses were performed on protein lysates from these T lymphocyte populations. As expected (2, 3, 4), Fig. 4A shows the presence of the 48-kDa FoxP3 protein in CD4+CD25+ cells from uninfected mice, but not in CD4+CD25 cells. However, following infection with
HV-68, a significant decrease in FoxP3 immunoreactivity was observed in the CD4+CD25+ cell populations (Fig. 4A), despite the presence of actin in each sample (Fig. 4B). Taken together, the Western blot (Fig. 4) and FACS analyses (Tables I and II and Fig. 3) demonstrate a reduction in the amount of FoxP3 expressed by CD4+ T cells, as well as a decrease in the percentage of CD4+ T cells which express FoxP3.
|
HV-68-infected mice
After observing that the levels of FoxP3 mRNA and protein expression decreased upon
HV-68 infection, we next questioned whether the activities of these CD4+CD25+ regulatory T cells were diminished in
HV-68-infected animals. For these studies, CD4+CD25+ T regulatory cells were isolated from the spleens of uninfected mice or mice which had been infected with
HV-68 for 15 days. These CD4+CD25+ T cells were then cocultured with CD4+ T cells isolated from normal mice on anti-CD3-coated plates for 72 h. Cells were pulsed with tritiated thymidine for the last 18 h of culture, and incorporation of radiolabel was then determined. As expected (10, 11, 12), CD4+CD25+ T regulatory cells isolated from uninfected mice were efficient in suppressing anti-CD3-stimulated proliferation of normal CD4+ T cells (Fig. 5A). Conversely, CD4+CD25+ T cells isolated from
HV-68-infected mice were unable to suppress the proliferation of stimulated CD4+ T cells (Fig. 5A).
|
HV-68-infected animals had such activity, these cells were isolated from the spleens of uninfected and infected mice. Cocultures of these cells with normal CD4+ T cells stimulated with beads coated with anti-CD3 and anti-CD28 were performed for 5 days, and then culture supernatants were collected for quantification of IFN-
. Fig. 5B shows the ability of CD4+CD25+ T regulatory cells isolated from uninfected mice to effectively suppress IFN-
secretion by stimulated CD4+ T lymphocytes. However, CD4+CD25+ T cells isolated from
HV-68-infected animals did not have the ability to suppress cytokine production (Fig. 5B). Taken together, the studies in Fig. 5 clearly demonstrate a lack of T regulatory cell activity in CD4+CD25+ T cells isolated from
HV-68-infected animals.
HV-68-infected dendritic cells do not alter the activity of normal CD4+CD25+ T regulatory cells
HV-68 does not infect CD4+ T lymphocytes, therefore the reduction in T regulatory cell activity in these infected mice likely results from the effect of viral infection on a cell population capable of altering T regulatory cell activity. APCs can harbor virus following infection with
HV-68, and the activation and/or maturation state of dendritic cells seems to be critically important for the development and activity of CD4+CD25+ T regulatory cells (42, 43, 44). Therefore, we questioned whether
HV-68-infected dendritic cells had the ability to alter the activity of normal CD4+CD25+ T regulatory cells. For these studies, bone marrow-derived dendritic cells were uninfected, or were infected in vitro, and then added to cocultures of normal CD4+ T lymphocytes and normal CD4+CD25+ T regulatory cells in the presence of anti-CD3 and anti-CD28-coated beads. As expected (42, 43, 44), proliferation of the stimulated CD4+ T cells could be suppressed in the presence of CD4+CD25+ T regulatory cells when uninfected dendritic cells were present in the culture (Fig. 6). Similar results were obtained when
HV-68-infected dendritic cells were present in these cultures (Fig. 6). These results demonstrate that the presence of virally infected dendritic cells is not, by itself, sufficient to significantly alter CD4+CD5+ T regulatory cell activity during this 72-h culture period.
|
| Discussion |
|---|
|
|
|---|
-herpesvirus,
HV-68.
It was difficult to predict a priori what role CD4+CD25+ T regulatory cells might have during the course of
HV-68 infection. An increased percentage and activity of such cells would have suggested a viral strategy for suppressing the protective immune response. Such a finding would have been consistent with the efficacious nature of
HV-68 as a pathogen, where an acute infection precedes the establishment of lifelong latency in the host (27, 28, 29). Alternatively, an increased activity of CD4+CD25+ T regulatory cells following infection might have also suggested that such a host response was necessary to limit viral-induced pathophysiology. This too would have been consistent with our understanding of
HV-68 pathology, which routinely resolves itself in normal mice, but can be greatly exacerbated in mice which have immune defects (45, 46). Surprisingly, we found that the levels of FoxP3 mRNA (Figs. 1 and 2) and FoxP3 protein (Fig. 4) and the percentage of CD4+FoxP3+ cells (Table I) and CD4+CD25+FoxP3+ cells (Table II and Fig. 3) decreased significantly following infection with this
-herpesvirus. Consistent with these results, decreased T regulatory cell activity was observed in CD4+CD25+ T cells isolated from
HV-68-infected mice (Fig. 5). It is clear from these studies that naturally occurring CD4+CD25+ T regulatory cells are decreased in their percentages and activity within days following viral infection.
This study did not directly address alterations in the numbers or activity of inducible T regulatory cells following infection with
HV-68. Although it is clear from the studies presented here that naturally occurring CD4+CD25+ T cells were affected, future studies will be needed to address any effect this viral infection has on inducible regulatory T cells.
Hypothetically, several possible justifications could be put forth to explain why infection with
HV-68 might reduce natural T regulatory cell activity.
HV-68 induces a mononucleosis-like disease where there is an uncontrolled expansion of B lymphocytes, T lymphocytes, and APCs, resulting in splenomegaly (27, 28, 31). The viral mechanisms responsible for inducing this leukocytosis are not known, however, there are aspects of this pathology which would be considered inflammatory (47). It has been suggested that activation of the proinflammatory transcription factor, NF-
B, facilitates the establishment of
-herpesvirus latency (48, 49, 50, 51). Therefore, it is possible that events which occur during the mononucleosis phase of the disease promote the transition from acute viral infection to latency. If this is true, then a virus-induced reduction in the percentage and activity of natural CD4+CD25+ T regulatory cells would provide an environment which would allow proinflammatory responses to be perpetuated and possibly promote the establishment of latent infection. Therefore, the results presented here may represent one mechanism used by
HV-68 to facilitate the uncontrolled expansion of leukocytes as viral latency is established.
The mechanisms used by
HV-68 to reduce the percentage and activity of naturally occurring CD4+CD25+ T regulatory cells are not apparent. CD4+ T lymphocytes are not a target for acute or latent virus in immunocompetent mice (52, 53, 54), therefore any effects on these regulatory T cells would not likely be due to intracellular virus. Viral latency can be established in APCs, including B lymphocytes (52, 53), macrophages (55, 56), and dendritic cells (55). Therefore, it is possible that one or more of these infected cell populations may promote an environment which limits CD4+CD25+ T regulatory cell activity. Because the interaction between naturally occurring T regulatory cells and dendritic cells has been suggested as an important mechanism for controlling immune responses (42, 43, 44), we began with this APC population to question whether a
-herpesvirus might alter T regulatory cell activity. Fig. 6 shows that the mere presence of
HV-68-infected dendritic cells for 3 days in CD4+ T cell cocultures was insufficient to reduce the activity of normal CD4+CD25+ T regulatory cells. These results suggest that other cell populations (e.g., latently infected B lymphocytes) may contribute to the reduction in T regulatory cell activity. If this is true, then in vitro culture systems may be insufficient to identify
-herpesvirus-mediated mechanisms of altered T regulatory cell activity due to the difficulty of infecting normal mouse B lymphocytes with
HV-68 in vitro (57).
Perhaps the most intriguing implication of the work presented here lies in the long-term consequences for the immune response of animals latently infected with this
-herpesvirus. Once infected, mice harbor virus for their lifetime, with reactivation of
HV-68 from latency always a possibility. Therefore, it will be important to determine whether the reduction of normally occurring CD4+CD25+ T regulatory cell activity in infected mice is transient, or whether it persists. If there is a diminution of regulatory T cell activity for a prolonged period during the life of a
-herpesvirus-infected animal, it may be possible that such a viral-induced alteration could result in an increased sensitivity to subsequent inflammatory stimuli, or in an increased susceptibility to the development of autoimmune diseases. Similarly, it will be important to determine whether reactivation of
-herpesviruses from latency results in any reduction of CD4+CD25+ T regulatory cell activity, as we have observed here during the initial infection of naive mice with
HV-68. If there are persistent alterations in these naturally occurring T regulatory cells following
-herpesvirus infection, or following reactivation of virus from latency, such results would suggest a mechanism by which
HV-68 infection could significantly alter the maintenance of tolerance within the infected host.
The human
-herpesvirus, EBV, has been implicated as one environmental factor which contributes to the development and/or severity of a variety of autoimmune diseases (58, 59, 60, 61, 62, 63, 64, 65). However, studies using human subjects are inherently limited by the reliance on sera, peripheral blood leukocytes, or postmortem human tissue. Although it has not been difficult to establish correlations between EBV infections and autoimmune diseases, definitive proof of such relationships remains speculative because it is not clear what mechanism might be used by
-herpesviruses to promote autoimmunity. Some insight into possible mechanisms for
-herpesvirus exacerbated autoimmunity has been obtained using
HV-68 infection to contribute to the development of experimental allergic encephalomyelitis (66) and autoimmune arthritis (67) in rodent models of these diseases. Such animal studies are consistent with the notion that
-herpesvirus infection in patients may contribute to the development and/or severity of human autoimmune disease. Therefore, it is likely that future studies using
HV-68 as a rodent model of
-herpesvirus infection will be an invaluable tool for dissecting the mechanisms responsible for virus-exacerbated autoimmune disease.
Our understanding of
-herpesvirus-induced alterations in the protective host response during acute and latent virus infection is still developing (68). The present work demonstrates that
HV-68 can limit the percentage and activity of naturally occurring CD4+CD25+ T regulatory cells following infection. This finding may help to explain, in part, the dysregulated host response which allows the uncontrolled expansion of leukocytes as viral latency is established.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grant AI32976. ![]()
2 Address correspondence and reprint requests to Dr. Kenneth L. Bost, Department of Biology, University of North Carolina, 9201 University City Boulevard, Charlotte, NC 28223. E-mail address: klbost{at}email.uncc.edu ![]()
3 Abbreviations used in this paper:
HV-68, murine
-herpesvirus 68; Cp, crossing point. ![]()
Received for publication February 10, 2006. Accepted for publication July 21, 2006.
| References |
|---|
|
|
|---|
-chains (CD25): breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J. Immunol. 155: 1151-1164. [Abstract]
herpesvirus. Acta Virol. 44: 211-226. [Medline]
herpesvirus 68: a model for the study of
herpesvirus pathogenesis. Trends Microbiol. 6: 276-282. [Medline]
herpesvirus with the immune system. Curr. Opin. Immunol. 6: 560-563. [Medline]
herpesvirus infection in immunocompetent mice. Viral Immunol. 17: 473-480. [Medline]
herpesvirus-68. J. Gen. Virol. 81: 421-429.
herpesvirus-68-induced interleukin-10 increases viral burden, but limits virus-induced splenomegaly and leukocytosis. Immunology 104: 109-117. [Medline]
-herpesvirus-68-induced IL-12 contributes to the control of latent viral burden, but also contributes to viral-mediated leukocytosis. J. Immunol. 172: 516-524.
-herpesvirus 68. J. Immunol. 170: 2605-2612.
herpesvirus infection. Virology 261: 173-179. [Medline]
interferon receptor-deficient mice infected with murine
herpesvirus: a role for CD8 T cells. J. Virol. 71: 4278-4283. [Abstract]
herpesvirus 68. Am. J. Pathol. 145: 818-826. [Abstract]
B inhibits
herpesvirus lytic replication. J. Virol. 77: 8532-8540.
B. Mol. Cell. Biol. 14: 1939-1948.
B in cell survival and transcription of latent membrane protein 1-expressing or Epstein-Barr virus latency III-infected cells. J. Virol. 78: 4108-4119.
herpesvirus-induced splenomegaly: a critical role for CD4 T cells. J. Gen. Virol. 77: (Pt. 4):627-630.
herpesvirus 68 establishes a latent infection in mouse B lymphocytes in vivo. J. Gen. Virol. 73: (Pt. 12):3275-3279.
herpesvirus 68 with B and T cell lines. Virology 193: 825-833. [Medline]
-herpesvirus infection is established in activated B cells, dendritic cells, and macrophages. J. Immunol. 165: 1074-1081.
herpesvirus 68 in peritoneal cells. J. Virol. 73: 3273-3283.
herpesvirus-68 in vitro. J. Gen. Virol. 80: (Pt. 10):2729-2736.
herpesvirus-68. Eur. J. Immunol. 33: 1849-1858. [Medline]
herpesvirus-68 infection. Viral Immunol. 18: 445-456. [Medline]This article has been cited by other articles:
![]() |
S. Roy, P. F. Barnes, A. Garg, S. Wu, D. Cosman, and R. Vankayalapati NK Cells Lyse T Regulatory Cells That Expand in Response to an Intracellular Pathogen J. Immunol., February 1, 2008; 180(3): 1729 - 1736. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Smith, S. Efstathiou, and A. Cooke Murine Gammaherpesvirus-68 Infection Alters Self-Antigen Presentation and Type 1 Diabetes Onset in NOD Mice J. Immunol., December 1, 2007; 179(11): 7325 - 7333. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Ordway, M. Henao-Tamayo, M. Harton, G. Palanisamy, J. Troudt, C. Shanley, R. J. Basaraba, and I. M. Orme The Hypervirulent Mycobacterium tuberculosis Strain HN878 Induces a Potent TH1 Response followed by Rapid Down-Regulation J. Immunol., July 1, 2007; 179(1): 522 - 531. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |