|
|
||||||||


* Biogen-Idec, Cambridge, MA 01746; and
Department of Medicine, Renal Division, Brigham and Womens Hospital, Harvard Medical School, Boston, MA 02115
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
We have developed gene-targeted mice to study the function of the TIM family in vivo. Analyses of the TIM-2-deficient mouse reveal that this pathway is a critical negative regulator of Th2 immune responses. Adoptive transfer experiments further show that the TIM-2-deficient phenotype is due to disregulated CD4+ T cell activity and the robust overexpression of Th2 cytokines. Therefore, the TIM-2 pathway negatively regulates Th2 T cell responses. Consideration of the role of TIM-2 and other TIM family members in immune responses suggests that this protein family comprises a key control point for effector T cell activity.
| Materials and Methods |
|---|
|
|
|---|
Mice and rats were obtained from The Jackson Laboratory and Harlan, respectively. All animal procedures were reviewed and approved by Biogen Idecs and Brigham and Womens Hospitals Institutional Animal Use and Care Committee.
Construction of TIM-2-targeting GAL4 knock-in vector, generation of targeted GAL4 knock-in embryonic stem (ES) cells, and TIM-2-deficient GAL4 knock-in mice
A 20.5-kb fragment containing two exons encoding the signal peptide and Ig domains of TIM-2 was isolated from the 129/Svj
FIX II genomic phage library (Stratagene) using oligonucleotides designed from the sequence of the mouse TIM-2 expressed sequence tag AA 014343 (mi67e10.r1 Soares mouse embryo NbME13.5 14.5 cDNA clone IMAGE:468618) using standard techniques. Two tandem 6-kb EcoRI fragments, one, 5', containing the signal peptide exon, and the other, 3', containing the Ig domain exon, were isolated. The pKO Scrambler vector (Lexicon Genetics) was modified by inserting an AscI fragment containing a protein kinase G promoter, neomycin-resistant gene, and bovine growth hormone poly(A) region from pKO SelectNeo (Lexicon Genetics) into the AscI site of pKO to create pKO Neo. This vector was used as a backbone to generate a targeting/knock-in vector. A 2.5-kb EcoRI-PstI 5' flanking region genomic fragment of TIM-2 was first subcloned into the HpaI site of pKO Neo. A 4.2-kb EcoNI-EcoRI 3' flanking genomic fragment was then subcloned into the SmaI site of the vector. Subsequently, a NotI site of this vector was removed. An additional 1.8-kb 5' genomic fragment containing a PstI site at the 5' end of TIM-2 and the destroyed Kozak sequence and ATG site of the signal sequence exon with additional NotI and EcoRI sites at the 3' end was PCR amplified and inserted into PstI-EcoRI site of the targeting vector. To complete the targeting vector, a yeast transcription factor GAL4 cDNA from pGATN (a gift from N. Perrimon, Department of Genetics, Harvard Medical School, Boston, MA) with a SV40 large T poly(A) site fragment were inserted at the NotI site of the targeting vector.
J1 ES cells were electroporated with Aat2-linearized targeting/knock-in vector and selected for resistance to G418. DNA from resistant ES cell clones was digested with NotI or BamHI and analyzed by Southern blot analysis using both 5' (64-bp) and 3' (118-bp) PCR-amplified DNA fragments as the 5' and 3' probes, respectively. A GAL4 cDNA fragment (3 kb) was also used for Southern analysis to confirm potential target vector integrated clones. A total of 93 clones was analyzed, and 3 clones were confirmed to have integration of the target vector that had undergone correct homologous recombination on each side of the GAL4 and neocassette.
TIM-2-deficient mice were bred onto the BALB/c background for 10 generations. Same generation heterozygous breeding was used to generate mice for in vivo studies. Wild-type littermates were used as controls in all studies, except in some adoptive transfer experiments, in which BALB/c mice were purchased for use as recipients.
Reagent production and flow cytometry
Murine TIM-2 was amplified from image clone 5102129 using Titanium Taq (BD Clontech) and 5' primer GX3-718 (5'- GCGGCCGCTCTAGAATGAATCAGATTCAAGTCTTCATTTCAGGCCTCA-3') and the 3' primer SC1-703 (5'- GGATCCTCAACTAGTGGACTCTTCTTCGGGGTAAGGAGTGT-3'). The PCR product was TOPO cloned into pCR2.1 (Invitrogen Life Technologies), and the XbaI-SpeI fragment was ligated into expression vector pCGC to make hemagglutinin-tagged full-length TIM-2. The ectodomain of mouse TIM-2 was PCR amplified from an image clone (ID 5002129) using the 5' oligonucleotide GX3-718 and the 3' oligonucleotide SCI-797 (5'-ACTAGTGTCGACGCCCTTATTCAGGTTTTTCTGTGGCTTCT-3'). The PCR fragment was digested with NotI and SalI for cloning into the EAG409 vector that contains the human IgGFc coding sequence. The resulting construct was excised with BamHI and cloned into vector pV90, which contains the IE-CMV promoter for expression in Chinese hamster ovary cells. The cell line was selected using dihydrofolate reductase resistance, and was further selected for growth in serum-free medium. TIM-2-Fc was purified using a protein A-Sepharose column in PBS equilibrated to pH 7. The column was washed with PBS (pH 5.0), the fusion protein was eluted with PBS (pH 2.8), and the buffer was neutralized with 0.5 M Na phosphate (pH 8.6). The eluted protein was submitted to a second purification step to isolate the intact form from aggregates using a column of Fractogel TMAE equilibrated in PBS. The intact dimeric TIM-2-Fc bound to the resin and was eluted using salt gradient elution, leaving any large aggregates on the column. Lastly, the purified protein was dialyzed against PBS (pH 7).
Fischer rats were immunized with the TIM-2-Fc protein using standard procedures, and after several boosts to increase the anti-TIM-2 titer, the spleens were harvested and fused with SP2/0 to create the hybridomas. Individual clones were derived and screened by ELISA for reactivity with TIM-1-Fc, TIM-2-Fc, and purified human IgG. Clones reactive with TIM-2, but not TIM-1 or human IgG were selected for subcloning and further characterization by ELISA and by FACS analysis using 293 cells transfected with full-length TIM-1 or TIM-2 cDNAs. Three mAbs, including mAbs 2C2 and 1G10, were found to bind with high affinity and specificity to TIM-2 by surface plasmon resonance (Biacore; data not shown).
In vitro T cell costimulation
Splenocytes or purified lymph node (LN) CD4+ T cells were stimulated with 1 µg/ml soluble anti-CD3 with or without 10 µg/ml soluble anti-CD28 for 48 h and pulsed with 1 µCi of tritiated thymidine (Amersham Biosciences) for 8 h. Triplicate cultures were incubated for 72 h, and the supernatants were harvested for cytokine analysis and analyzed in duplicate using CBA bead kits (BD Biosciences) and specific mouse cytokine ELISA kits (R&D Systems). To create primary Th2 cultures, CD4+ T cells from splenocytes were purified by negative bead selection (Miltenyi Biotec) from TIM-2-deficient and wild-type mice. A total of 5 x 106 CD4+ T cells was activated with 1 µg/ml immobilized anti-CD3 and 5 µg/ml soluble anti-CD28 under Th2-polarizing conditions (10 µg/ml anti-IL-12 and anti-IFN-
(BD Biosciences) and 100 ng/ml murine IL (mIL)-4 (R&D Systems)) for 96 h at 37°C. Cells were stained with anti-murine TIM-2 mAb and rat IgG2a isotype control and detected with PE donkey anti-rat IgG (H + L; Jackson ImmunoResearch Laboratories) diluted at 1/200 for FACs analysis.
In vitro T cell differentiation and analysis of cultures
Dendritic cells (DC) were derived from the bone marrow of BALB/c mice by first depleting the bone marrow suspension with FITC-labeled anti-CD4, anti-CD8, anti-B220, and anti-GR1 mAbs (all from BD Biosciences) and anti-FITC MACS beads (Miltenyi Biotec), then culturing the remaining cells for 67 days in 25 ng/ml murine GM-CSF (R&D Systems) and 10 µg/ml mIL-4 (BD Biosciences). DC were then washed and irradiated at 1000 rad. CD4+ T cells were isolated from the spleens of DO11.10 mice using negative selection columns (Cedarlane Laboratories) and were cultured to produce Th1 and Th2 T cell subsets. To produce the Th1-dominant culture, 4 x 106 CD4+ T cells were incubated in RPMI 1640 containing 10% FBS with 50 µg/ml OVA in the presence of 2 x 105 bone marrow-derived DC, 10 µg/ml anti-mIL-4, and 5 ng/ml rIL-12 (both obtained from BD Biosciences) for 48 h. The cells were then rested for 7 days, and restimulated with 1 µg/ml plate-bound anti-CD3 and 5 µg/ml soluble anti-CD28 (BD Biosciences) and Th1 cytokine conditions, as described above. This cycle of resting and stimulation was repeated a total of three times. After the final stimulation, the cells were permeabilized using the Golgiplug kit (BD Biosciences) and stained with PE-labeled anti-IFN-
, allophycocyanin-labeled anti-IL-4, allophycocyanin-labeled anti-IL-5, or correspondingly labeled isotype controls (all obtained from BD Biosciences) for analysis by flow cytometry. To examine expression of TIM-2, cells were incubated with mAb 2C2 or the corresponding isotype control (rat IgG2a; BD Biosciences), then with PE-labeled goat anti-rat IgG (H + L; Jackson ImmunoResearch Laboratories).
To produce Th2-predominant cultures, 4 x 106 CD4+ T cells were incubated in RPMI 1640 containing 10% FBS with 50 µg/ml OVA in the presence of 2 x 105 bone marrow-derived DC, 10 µg/ml mIL-4 (R&D Systems), 10 µg/ml anti-murine IFN-
, and 100 ng/ml anti-mIL-12 (both from BD Biosciences) for 48 h. The cells were rested for 7 days, then restimulated with 1 µg/ml plate-bound anti-CD3 and 5 µg/ml soluble anti-CD28 (BD Biosciences) and Th2 cytokine conditions, as described above. This cycle of resting and stimulation was repeated a total of three times. The cells were then analyzed by flow cytometry, as described above.
In vivo T cell priming
TIM-2-deficient and wild-type mice (n = 5) were immunized s.c. below the shoulder blades and in the flanks with 1 mg of keyhole limpet hemocyanin (KLH) emulsified in 50 µg of CFA (both from Sigma-Aldrich). Six days later, the mice were sacrificed, and brachial, axillary, and inguinal LN were harvested and pooled. CD4+ T cells were isolated using affinity columns (Cedarlane Laboratories), and triplicates or quadruplicates of each sample were cultured in RPMI 1640 medium containing 10% FBS at a concentration of 5 x 105 cells/well plus varying concentrations of KLH in the presence of 2 x 105 irradiated splenocytes (10001500 rad) from naive (untreated) syngenic mice. Forty-eight hours later, the cell culture supernatants were harvested for analysis using CBA beads (BD Biosciences) and ELISA kits (R&D Systems). Parallel triplicate cultures were pulsed with 1 µCi of tritiated thymidine per well (Amersham Biosciences) for 8 h starting at the 64th hour of culture, then harvested and counted using the Microbetajet system (Wallac).
Induction and measurement of airway inflammation, and measurement of the recall response to OVA
Five- to 6-wk-old TIM-2-deficient mice and wild-type littermates (n = 8) were immunized i.p. on days 1 and 7 with 50 µg of OVA grade V (Sigma-Aldrich) in 200 µl of 50:50 solution of ImjectAlum (Pierce) and PBS. Serum samples were recovered 48 h after the second injection. Mice were placed in an ultrasonic nebulizer (Devilbis) and exposed to aerosolized 1% OVA in PBS for 20 min each on days 28, 29, and 30. On day 32, the mice were sacrificed, and bronchial lavage was performed with PBS. Cells in the bronchial lavage fluid (BALF) were isolated, washed, counted, and spun onto slides using a cytospin. Bronchial lavage cytospins were stained with Hema3 differential staining kit (Fisher Scientific), and alveolar macrophages, eosinophils, neutrophils, and lymphocytes were counted. The lung tissue was harvested into neutral buffered Formalin for routine histology, or was snap frozen in TRIzol for subsequent RNA isolation. Routine histology included H + E staining, anti-CD3 staining to detect T cells, and periodic acid-Schiff staining to stain mucus. Draining (bronchial) LN and spleen were harvested and pooled for isolation of mononuclear cells, which were placed into culture in RPMI 1640/10% FBS with varying concentrations of OVA. Seventy-two hours later, the supernatants were harvested and cells were pulsed, as described above. Supernatant samples were analyzed in duplicate using CBA beads (BD Biosciences) and IL-13 ELISA (R&D Systems).
For treatment with the TIM-2-Fc fusion protein, mice received TIM-2-Fc by i.p. injection. Two protocols were used. In the prophylactic protocol, mice were dosed with 200 µg of TIM-2-Fc on days 1, 3, 6, and 9 relative to immunization with OVA in alum on days 1 and 7. Then, the mice received a single bolus dose of 500 µg of TIM-2-Fc on day 28, 46 h before the first nebulization session. For the prechallenge protocol, mice were immunized with OVA in alum, as described above, but no TIM-2-Fc treatment was given during this time. One day before the first nebulization session, mice received 250 µg of TIM-2-Fc or isotype control protein. A second dose on 250 µg was given 46 h before the second nebulization session.
For the adoptive transfer experiments, 5- to 6-wk-old TIM-2-deficient and wild-type mice were immunized i.p. on days 0 and 7 with 50 µg of OVA in alum. On day 14, splenocytes were harvested and enriched for CD4+ T cells using negative selection columns (StemSep). A total of 5 x 106 CD4+ T cells was cultured in 6-well plates with 2 x 106 irradiated, CD4-depleted splenocytes from naive BALB/c mice, in the presence of 200 µg/ml soluble OVA for 3 days. The cells were then harvested, resuspended in 100 µl of sterile PBS, and transferred i.v. to naive BALB/c or wild-type mice using 45 x 106 cells per mouse. The recipient mice were challenged with nebulized 1% OVA in PBS or PBS alone on days 3, 4, and 5 posttransfer. On day 7 posttransfer, BALF was harvested, and lung tissue was collected. Pooled lung tissue from each cohort was digested using 1 mg/ml collagenase and 0.1 mg/ml DNase1 (both from Sigma-Aldrich) and 5 x 105 lymphocytes/well were incubated with 200 µg/ml OVA for ex vivo proliferation and cytokine analysis, as described above.
RNA isolation and RT-PCR
Cell lines were cultured in RPMI 1640 containing 10% FBS (JRH Biosciences) and antibiotic/antimycotic solution (Invitrogen Life Technologies). Primary cells were isolated from mouse spleen or LN using specific negative selection columns (Cedarlane Laboratories). RNA was isolated from cells or tissues using the homogenizer method (Omni International) and TRIzol buffer (Invitrogen Life Technologies). TIM-2 mRNAs were amplified using the First Strand RT-PCR kit (Invitrogen Life Technologies) and specific primers (5': TACCTCTACTTCTCCAACACC; 3': CCTTTTCATAACCACGTACCTGGTG). Mouse TIM-1 was amplified following the reverse-transcriptase (RT) step using specific primers (5': CACTCCTCCAACATCTACACACACATGG; 3': CTTAGAGACACGGAAGGCAAC CACGCT). Mouse TIM-3 was amplified following the RT step using specific primers (5': GTCTTACCCTCAACTGTGTCCTG; 3': GTGTCTCTGAACCATTTCTCTCC). All PCR were run at a predetermined limiting cycle number to allow for semiquantitative analysis of the resulting product.
| Results |
|---|
|
|
|---|
The mouse TIM-2 gene was disrupted by replacing exons encoding the signal peptide and Ig domains with a neoresistance gene cassette, and the gene deletion was confirmed using genomic blot analysis (Fig. 1). TIM-2 gene-deficient mice were produced from TIM-2+/ matings at the expected Mendelian frequency, and were backcrossed for 10 generations onto the BALB/c strain. To ensure that the adjacent genes in the TAPR locus were not affected by the TIM-2 disruption, we analyzed the level of expression of TIM-1 and TIM-3 mRNA in spleen and LN by RT-PCR and found that these were unchanged between TIM-2-deficient mice and wild-type littermates (data not shown). Furthermore, TIM-1 expression was up-regulated in injured kidney, as expected (4) (data not shown). TIM-2 mRNA expression was absent from all TIM-2-deficient tissues examined, including spleen, LN, thymus, and kidney (data not shown). To examine TIM-2 protein expression, CD4+ T cells were isolated from spleen and activated in Th2 culture conditions. Activated cells were stained with TIM-2-specific mAb 1G10 or isotype control, and the intensity of staining was examined. After 96 h of culture, TIM-2 expression was robust in T cell isolated from wild-type mice, and wholly absent from T cells isolated from TIM-2-deficient mice (Fig. 2a), showing that the gene targeting had indeed eliminated TIM-2 expression.
|
|
TIM-2 is expressed on lymphocytes and regulates immune responses
TIM-2 expression has been described on activated T cells (7, 8), a result we have reproduced (Fig. 2a). Furthermore, we found that TIM-2 mRNA was present in both T and B cells isolated from spleen and LN from BALB/c and C57BL/6 mice (Fig. 2b and data not shown). Similar to TIM-2, TIM-1 mRNA expression was found in both T and B cell populations, while TIM-3 expression was essentially found only in T cells (Fig. 2b). TIM-2 mRNA expression was also noted in various lymphocyte cell lines (Fig. 2c), and cell surface protein expression was detected on both T and B cell lines (Fig. 2d). Splenocytes or isolated CD4+ T cells from TIM-2-deficient mice and wild-type littermates were stimulated with anti-CD3 mAb or anti-CD3/anti-CD28 mAbs to investigate the cellular response to costimulation. No significant differences in proliferation or cytokine production between TIM-2-deficient mice and wild-type mice were noted (data not shown). These results showed that primary activation of naive T cells was not affected by the absence of TIM-2.
We next immunized TIM-2-deficient mice s.c. with KLH in CFA and 6 days later excised the draining LN. CD4+ T cells were isolated and restimulated for 48 h with KLH in PBS plus irradiated splenocytes, or with anti-CD3 mAb. Cellular proliferation and levels of secreted cytokines were determined in response to stimulation. Anti-CD3 treatment induced robust cellular proliferation of both TIM-2-deficient CD4+ T cells and wild-type CD4+ T cells, showing that both cell populations were competent to respond to polyclonal stimulation. In contrast, the in vitro recall response to soluble KLH was markedly higher in the TIM-2-deficient cultures (Fig. 3a). We assessed cytokines produced by wild-type and TIM-2-deficient T cells in response to KLH restimulation, and found that TIM-2-deficient T cells consistently produced higher levels of the Th2-associated cytokines IL-4, IL-5, IL-6, and IL-10 (Fig. 3b). The levels of IL-2 and TNF-
were similar in wild-type and TIM-2-deficient cultures (Fig. 3b and data not shown). Levels of the Th1-associated cytokine IFN-
were also consistently higher in TIM-2-deficient cultures as compared with controls (Fig. 3b). In contrast, the level of cytokines produced in response to anti-CD3 stimulation was generally similar in TIM-2-deficient and wild-type cultures (Fig. 3c), and the differences observed were not statistically significant. Therefore, the Ag-specific response of TIM-2-deficient mice differed markedly from that of wild-type mice, while the response to polyclonal stimulation was similar.
|
The development of atopic disorders requires effector T cell activation and expansion in the lymphoid compartment and subsequent migration to target tissue. We examined expression of TIM-2 during development of lung inflammation. BALB/c mice were sensitized with chicken OVA in alum by i.p. administration, then challenged with OVA in aerosol to elicit an inflammatory response in the lung (9). This model of airway inflammation is known to depend on Th2 cytokine production (9). Bronchial LN and lung tissue were harvested for analysis of TIM-2 RNA levels by semiquantitative RT-PCR before and after challenge with an aerosol of OVA in PBS. Striking up-regulation of TIM-2 was observed in both LN and lung 24 and 48 h after aerosol challenge (Fig. 4a). We collected BALF from OVA aerosol-challenged mice and examined the cellularity by differential staining. The majority of cells were alveolar macrophages (70% or more) and eosinophils (up to 30%) with small numbers of neutrophils and lymphocytes observed. No TIM-2 signal was detected by RT-PCR from RNA isolated from BALF cell pellets, suggesting that eosinophils and macrophages are not a major source of TIM-2 expression in lung (data not shown). To determine whether Ag stimulation of T cells could induce TIM-2 expression, we used CD4+ T cells from the transgenic DO11.10 mouse strain that express only an OVA peptide-specific TCR (10). CD4+ T cells isolated from DO11.10 mice were polarized using cytokine treatment and Ag challenge in vitro to create IL-4-secreting Th2 cells and IFN-
-secreting Th1 cells (11). After the lines were established, these cells were restimulated with Ag for 5 days and assessed for TIM-2 expression. Activated IL-4-secreting Th2 cells, but not IFN-
-secreting Th1 cells, expressed TIM-2 protein on the cell surface, as shown by FACS analysis (Fig. 4b). Therefore, TIM-2 mRNA was preferentially expressed by activated Th2 T cells.
|
We could not consistently detect TIM-2 staining in lung or bronchial LN paraffin sections. Robust mononuclear cell infiltration into lung tissue is associated with a pronounced inflammatory response that attracts granulocytes. As expected, therefore, analysis of cell infiltration into BALF revealed an increase in the number of eosinophils and lymphocytes present in the TIM-2-deficient animals as compared with wild-type mice, or wild-type mice not sensitized to OVA (Fig. 5a).
|
was higher in the TIM-2-deficient cultures than in the wild-type cultures, although levels of this cytokines remained below 10 pg/ml (Fig. 5c). Similarly, the expression of TNF approximately doubled in the TIM-2-deficient culture (40 pg/ml) as compared with the wild-type culture (18 pg/ml), but remained low on average. Therefore, lymphocytes from TIM-2-deficient mice displayed an enhanced response to Ag stimulation characterized by the predominant expression of Th2 cytokines. T cells are responsible for the TIM-2-deficient phenotype
To determine whether T cells were responsible for the phenotype caused by TIM-2 deficiency, we performed adoptive transfer experiments. TIM-2-deficient or wild-type littermates were immunized with i.p. administration of OVA in alum, and splenic CD4+ T cells were then isolated and transferred into naive TIM-2-deficient, wild-type, or BALB/c mice. The recipient mice were then exposed to nebulized OVA. Consistent with the TIM-2 defect impacting T cell activity, transfer of TIM-2-deficient T cells into wild-type littermates or into BALB/c recipients transferred hypersensitivity to OVA aerosol, as measured by the influx of eosinophils into the BALF (Fig. 6a). To confirm the mechanism underlying this inflammatory response, lymphocytes were isolated from lung tissue of recipient mice after nebulization. Lung tissue was used because we reasoned that this would be a source of effector T cells. Cells isolated from mice that had been adoptively transferred from TIM-2-deficient mice secreted higher levels of IL-5, IL-6, and IL-13 than did cells isolated from mice that had been adoptively transferred from wild-type mice, which produced only modest amounts of cytokines, at or just above background levels, as measured by cultures derived from the unsensitized control (Fig. 6b). Higher levels (
2-fold) of IL-4, IL-10, and IFN-
were also noted, while IL-2 and TNF levels remained unchanged (data not shown). These results identify CD4+ T cells as the critical cell type imparting the TIM-2-deficient phenotype. Furthermore, the results are consistent with the hypothesis that regulation of Th2 effector cell activity, resulting in altered cytokine production, is the mechanism underlying the hyperimmune responses seen in TIM-2-deficient mice.
|
The TIM-2 protein has the hallmarks of a receptor, including a cytoplasmic domain with both serine and tyrosine phosphorylation sites (7). We sought to antagonize TIM-2 activity in wild-type mice by treatment with a soluble TIM-2-Fc fusion protein. BALB/c mice were treated with TIM-2-Fc fusion protein during the sensitization and challenge phases in the OVA model. Similar to the TIM-2-deficient mice, TIM-2-Fc-treated mice had increased eosinophil counts in BALF (35% increase over human IgG control; p < 0.001) and enlarged mononuclear cell infiltrates containing CD3+ lymphocytes in the lung tissue (Fig. 7). In addition, there was enhanced proliferation by LN cells in response to Ag stimulation, and cytokine production, particularly of IL-5 and IL-13, was increased (Fig. 7). Secretion of other cytokines was also increased, including IL-6 and IL-10 (2- to 3-fold) and IFN-
(1.6-fold), while there was no increase in IL-2 or TNF (data not shown).
|
, although low (<100 pg/ml), was modestly enhanced also (2- to 3-fold), while levels of IL-2 and TNF were unchanged from the isotype control (data not shown). Therefore, TIM-2-Fc treatment appeared to influence the activity of OVA-specific effector T cells.
|
| Discussion |
|---|
|
|
|---|
was not specifically down-regulated, but was either unaffected, as seen in the Th2-dominated response to OVA/alum, or even elevated, as seen in the Th1-dominated response to KLH/CFA. In the KLH model, the generally elevated immune response may have driven further IFN-
expression indirectly (i.e., a bystander effect), but this requires additional study. To directly test whether Ag-driven Th2 differentiation is affected by TIM-2 deficiency will require crossing the TIM-2-deficient mouse onto a TCR-specific background. However, it is possible that the TIM-2 pathway regulates Th2 T cell activity downstream of Th1/Th2 differentiation. Thus, rather than skewing of Th1 or Th2 T cell responses, as is seen in mice deficient in critical T cell differentiation factors such as t-bet or GATA-3 (13, 14), TIM-2 deficiency may instead preferentially support the expansion or survival of the Th2 subset. This hypothesis is consistent with the effect of TIM-2-Fc treatment just before the challenge phase in the OVA model, that is, after T cell subsets have been established during the immunization phase. Therefore, the dramatic increase in the expression of Th2 cytokines does not occur at the expense of the expression of Th1 cytokines, but both responses are present. Such a mixed cytokine response is often present in asthmatic patients, and models in mice suggest that complex interactions between Th1 and Th2 cytokines can augment disease severity and lead to increased lung injury and fibrosis (15, 16, 17). Chronic models of lung inflammation will be used to examine the effect of TIM-2 deficiency on the extent of airway remodeling and airway resistance.
The analyses of the TIM-2 gene-deficient mouse clearly show that TIM-2 normally functions to down-regulate specific effector T cell responses, in particular those conferring a Th2 phenotype. It should be noted that expression of IFN-
was similarly modulated, albeit to a lesser extent, and therefore TIM-2 may generally regulate T cell activation and impact both Th1 and Th2 cytokines. The results that we obtained treating wild-type BALB/c mice with TIM-2-Fc fusion protein were very similar to those obtained using the TIM-2-deficient mice. Treatment of SJL/J mice with TIM-2-Fc during immunization with proteolipid apoprotein peptide also enhanced Th2 cytokine production (8), although in that study this response was associated with a pronounced decline in IFN-
production, a result at odds with the genetic data presented in this work. It may be that differences in the immunization protocols or background strain of mice account for the different effect on IFN-
expression. If we assume that TIM-2-Fc fusion protein blocks normal ligand/receptor interaction, then the data suggest that ligand engagement of TIM-2 normally transduces a negative regulatory signal. Notably, it has been proposed that APCs express a TIM-2 ligand (8), and it is reasonable to hypothesize that APCs themselves regulate effector T cell activity through this and other TIM pathways. Semaphorin4a, which is expressed by DC and activated B cells, was recently identified as a ligand for mouse TIM-2. However, semaphorin4a interaction with TIM-2 enhanced T cell responses in various in vitro and in vivo models (7), a finding inconsistent with the genetic data presented in this study. It is possible that multiple ligands for TIM-2 exist, which have divergent effects upon binding to the receptor.
Studies of the TIM-3-deficient mouse have shown that TIM-3 is a negative regulator of T cell effector activity, in particular of Th1 T cell activity (18, 19). We therefore can consider the hypothesis that TIM-2 and TIM-3 serve to regulate effector T cell activity to control Th2 and Th1 responses, respectively, in the mouse. Because both pathways have down-regulatory function, it appears that expression of these TIM proteins serves to block differentiation or expansion of specific effector T cell subsets, thus regulating immune responses. The results obtained from the studies in which TIM-2-Fc treatment was delayed until just before OVA challenge to the lung suggest that this pathway can impact T cell responses after differentiation has occurred during the sensitization phase.
TIM-2 is highly homologous to TIM-1, and appears to have arisen as a gene duplication in the rodent lineage, as only TIM-1 is found in primates. Functional studies of TIM-1 have been complicated by the varying effects that different mAbs have on TIM-1 activity. Anti-TIM-1 mAbs have been reported to enhance or block immune responses in a number of models (20, 21, 22). One recent study has demonstrated direct costimulatory activity of an anti-TIM-1 mAb, which was not reproduced with the Fab form of the molecule, strongly suggesting a direct signaling event might underlie the costimulatory activity (20). Furthermore, overexpression of TIM-1 resulted in increased T cell proliferation and expression of cytokines, and required an intact tyrosine phosphorylation motif (23). However, data derived from studies in which soluble TIM-1-Fc fusion proteins were shown to enhance immune responses suggest that TIM-1 would itself normally transduce a negative signal, one blocked when TIM-1-Fc interrupts the interaction of TIM-1 with its ligand(s) (21). As this last result is similar to that observed upon treatment with TIM-2-Fc and TIM-3-Fc (8, 18, 19), it may be that these three family members function similarly to down-regulate specific immune responses. Indeed, some signaling motifs present in the cytoplasmic domains of TIM-1, TIM-2, and TIM-3 appear well conserved (Fig. 9). Although the cytoplasmic domains of TIM-2 and TIM-3 are longer than that of TIM-1, it is not yet known whether the additional tyrosines found in these longer domains are functionally phosphorylated.
|
The striking phenotypes observed in the TIM-2-deficient mouse provide genetic evidence of the critical role that TIM-2 plays in regulating Th2 T cell activity and associated immune responses. The importance of the TIM gene family to immunity and disease is shown by the linkage of the TAPR locus to multiple diseases in human patient populations. Our investigations of the role of TIM-2 in murine lung immunity suggest that human immune responses will be influenced by the activity of TIM family members, including the TIM-2 homologue TIM-1, and that the TIM proteins will emerge as important therapeutic targets in airway inflammation and other atopic disorders.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 J.V.B. and T.I. were supported by National Institutes of Health Grants DK-39773, DK-72381, and DK-46267. ![]()
2 Address correspondence and reprint requests to Dr. Paul D. Rennert, Biogen Idec, 12 Cambridge Center, Cambridge, MA 01746. E-mail address: paul.rennert{at}biogenidec.com ![]()
3 Abbreviations used in this paper: TIM, T cell, Ig domain, mucin domain; BALF, bronchial lavage fluid; DC, dendritic cell; ES, embryonic stem; KLH, keyhole limpet hemocyanin; LN, lymph node; mIL, murine IL; RT, reverse transcriptase. ![]()
Received for publication March 14, 2006. Accepted for publication July 4, 2006.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R. Rodriguez-Manzanet, J. H. Meyers, S. Balasubramanian, J. Slavik, N. Kassam, V. Dardalhon, E. A. Greenfield, A. C. Anderson, R. A. Sobel, D. A. Hafler, et al. TIM-4 Expressed on APCs Induces T Cell Expansion and Survival J. Immunol., April 1, 2008; 180(7): 4706 - 4713. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nakae, M. Iikura, H. Suto, H. Akiba, D. T. Umetsu, R. H. DeKruyff, H. Saito, and S. J. Galli TIM-1 and TIM-3 enhancement of Th2 cytokine production by mast cells Blood, October 1, 2007; 110(7): 2565 - 2568. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Binne, M. L. Scott, and P. D. Rennert Human TIM-1 Associates with the TCR Complex and Up-Regulates T Cell Activation Signals J. Immunol., April 1, 2007; 178(7): 4342 - 4350. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. D. Sizing, V. Bailly, P. McCoon, W. Chang, S. Rao, L. Pablo, R. Rennard, M. Walsh, Z. Li, M. Zafari, et al. Epitope-Dependent Effect of Anti-Murine TIM-1 Monoclonal Antibodies on T Cell Activity and Lung Immune Responses J. Immunol., February 15, 2007; 178(4): 2249 - 2261. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Knickelbein, A. J. de Souza, R. Tosti, P. Narayan, and L. P. Kane Cutting Edge: Inhibition of T Cell Activation by TIM-2 J. Immunol., October 15, 2006; 177(8): 4966 - 4970. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |