The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rennert, P. D.
Right arrow Articles by Bonventre, J. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rennert, P. D.
Right arrow Articles by Bonventre, J. V.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH
The Journal of Immunology, 2006, 177: 4311-4321.
Copyright © 2006 by The American Association of Immunologists, Inc.

T Cell, Ig Domain, Mucin Domain-2 Gene-Deficient Mice Reveal a Novel Mechanism for the Regulation of Th2 Immune Responses and Airway Inflammation1

Paul D. Rennert2,*, Takaharu Ichimura{dagger}, Irene D. Sizing*, Veronique Bailly*, Zhifang Li*, Rachel Rennard*, Patricia McCoon*, Lourdes Pablo*, Steven Miklasz*, Leticia Tarilonte* and Joseph V. Bonventre{dagger}

* Biogen-Idec, Cambridge, MA 01746; and {dagger} Department of Medicine, Renal Division, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The development of asthma and other atopic diseases is influenced by cytokines produced by Th2 effector T cells. How effector T cell responses are regulated once these cell populations are established remains unclear. The recently described T cell and airway phenotype regulator locus, containing the T cell, Ig domain, mucin domain (TIM) genes, is genetically associated with Th2 cytokine production and Th2-dependent immune responses. In this study, we report the phenotype of the TIM-2 gene-deficient mouse, and demonstrate exacerbated lung inflammation in an airway atopic response model. Immune responses in the TIM-2-deficient mouse reveal disregulated expression of Th2 cytokines, and adoptive transfer experiments show that the T cell compartment is responsible for the heightened inflammatory phenotype. These studies show that TIM-2 is a novel and critical regulator of effector T cell activity.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The T cell, Ig domain, mucin domain (TIM)3 gene family is found within the T cell and airway phenotype regulator (TAPR) locus on mouse chromosome 11 and the syntenic region on human chromosome 5q33.2 (1). The number of genes in this locus is variable, with eight genes represented by expressed sequence tags in mouse, and three in human (1). In both mice and humans, allelic variation at the TAPR locus is associated with atopic immune responses (1, 2, 3). In particular, variation in human TIM-1 (originally KIM-1 (4)) is associated with susceptibility to atopic disease in patients seropositive for hepatitis A virus (2) and in African Americans (3). Because TIM-1 has also been identified as a primate cellular receptor for hepatitis A virus (5), the data suggest that TIM-1 may provide a molecular basis for the epidemiological observation that asthma rates are inversely correlated with the incidence of viral infection in industrialized countries (6). Murine TIM-2 and TIM-1 are highly homologous (1), but it is unclear whether either or both genes contribute to the phenotype conferred by TAPR locus polymorphisms, or even whether they have similar activities. We are therefore investigating the activity of these pathways in mouse models of Th2 T cell-mediated disease to better understand the role of the human homologue, TIM-1, in asthma and other atopic disorders.

We have developed gene-targeted mice to study the function of the TIM family in vivo. Analyses of the TIM-2-deficient mouse reveal that this pathway is a critical negative regulator of Th2 immune responses. Adoptive transfer experiments further show that the TIM-2-deficient phenotype is due to disregulated CD4+ T cell activity and the robust overexpression of Th2 cytokines. Therefore, the TIM-2 pathway negatively regulates Th2 T cell responses. Consideration of the role of TIM-2 and other TIM family members in immune responses suggests that this protein family comprises a key control point for effector T cell activity.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Animals

Mice and rats were obtained from The Jackson Laboratory and Harlan, respectively. All animal procedures were reviewed and approved by Biogen Idec’s and Brigham and Women’s Hospital’s Institutional Animal Use and Care Committee.

Construction of TIM-2-targeting GAL4 knock-in vector, generation of targeted GAL4 knock-in embryonic stem (ES) cells, and TIM-2-deficient GAL4 knock-in mice

A 20.5-kb fragment containing two exons encoding the signal peptide and Ig domains of TIM-2 was isolated from the 129/Svj {lambda} FIX II genomic phage library (Stratagene) using oligonucleotides designed from the sequence of the mouse TIM-2 expressed sequence tag AA 014343 (mi67e10.r1 Soares mouse embryo NbME13.5 14.5 cDNA clone IMAGE:468618) using standard techniques. Two tandem 6-kb EcoRI fragments, one, 5', containing the signal peptide exon, and the other, 3', containing the Ig domain exon, were isolated. The pKO Scrambler vector (Lexicon Genetics) was modified by inserting an AscI fragment containing a protein kinase G promoter, neomycin-resistant gene, and bovine growth hormone poly(A) region from pKO SelectNeo (Lexicon Genetics) into the AscI site of pKO to create pKO Neo. This vector was used as a backbone to generate a targeting/knock-in vector. A 2.5-kb EcoRI-PstI 5' flanking region genomic fragment of TIM-2 was first subcloned into the HpaI site of pKO Neo. A 4.2-kb EcoNI-EcoRI 3' flanking genomic fragment was then subcloned into the SmaI site of the vector. Subsequently, a NotI site of this vector was removed. An additional 1.8-kb 5' genomic fragment containing a PstI site at the 5' end of TIM-2 and the destroyed Kozak sequence and ATG site of the signal sequence exon with additional NotI and EcoRI sites at the 3' end was PCR amplified and inserted into PstI-EcoRI site of the targeting vector. To complete the targeting vector, a yeast transcription factor GAL4 cDNA from pGATN (a gift from N. Perrimon, Department of Genetics, Harvard Medical School, Boston, MA) with a SV40 large T poly(A) site fragment were inserted at the NotI site of the targeting vector.

J1 ES cells were electroporated with Aat2-linearized targeting/knock-in vector and selected for resistance to G418. DNA from resistant ES cell clones was digested with NotI or BamHI and analyzed by Southern blot analysis using both 5' (64-bp) and 3' (118-bp) PCR-amplified DNA fragments as the 5' and 3' probes, respectively. A GAL4 cDNA fragment (3 kb) was also used for Southern analysis to confirm potential target vector integrated clones. A total of 93 clones was analyzed, and 3 clones were confirmed to have integration of the target vector that had undergone correct homologous recombination on each side of the GAL4 and neocassette.

TIM-2-deficient mice were bred onto the BALB/c background for 10 generations. Same generation heterozygous breeding was used to generate mice for in vivo studies. Wild-type littermates were used as controls in all studies, except in some adoptive transfer experiments, in which BALB/c mice were purchased for use as recipients.

Reagent production and flow cytometry

Murine TIM-2 was amplified from image clone 5102129 using Titanium Taq (BD Clontech) and 5' primer GX3-718 (5'- GCGGCCGCTCTAGAATGAATCAGATTCAAGTCTTCATTTCAGGCCTCA-3') and the 3' primer SC1-703 (5'- GGATCCTCAACTAGTGGACTCTTCTTCGGGGTAAGGAGTGT-3'). The PCR product was TOPO cloned into pCR2.1 (Invitrogen Life Technologies), and the XbaI-SpeI fragment was ligated into expression vector pCGC to make hemagglutinin-tagged full-length TIM-2. The ectodomain of mouse TIM-2 was PCR amplified from an image clone (ID 5002129) using the 5' oligonucleotide GX3-718 and the 3' oligonucleotide SCI-797 (5'-ACTAGTGTCGACGCCCTTATTCAGGTTTTTCTGTGGCTTCT-3'). The PCR fragment was digested with NotI and SalI for cloning into the EAG409 vector that contains the human IgGFc coding sequence. The resulting construct was excised with BamHI and cloned into vector pV90, which contains the IE-CMV promoter for expression in Chinese hamster ovary cells. The cell line was selected using dihydrofolate reductase resistance, and was further selected for growth in serum-free medium. TIM-2-Fc was purified using a protein A-Sepharose column in PBS equilibrated to pH 7. The column was washed with PBS (pH 5.0), the fusion protein was eluted with PBS (pH 2.8), and the buffer was neutralized with 0.5 M Na phosphate (pH 8.6). The eluted protein was submitted to a second purification step to isolate the intact form from aggregates using a column of Fractogel TMAE equilibrated in PBS. The intact dimeric TIM-2-Fc bound to the resin and was eluted using salt gradient elution, leaving any large aggregates on the column. Lastly, the purified protein was dialyzed against PBS (pH 7).

Fischer rats were immunized with the TIM-2-Fc protein using standard procedures, and after several boosts to increase the anti-TIM-2 titer, the spleens were harvested and fused with SP2/0 to create the hybridomas. Individual clones were derived and screened by ELISA for reactivity with TIM-1-Fc, TIM-2-Fc, and purified human IgG. Clones reactive with TIM-2, but not TIM-1 or human IgG were selected for subcloning and further characterization by ELISA and by FACS analysis using 293 cells transfected with full-length TIM-1 or TIM-2 cDNAs. Three mAbs, including mAbs 2C2 and 1G10, were found to bind with high affinity and specificity to TIM-2 by surface plasmon resonance (Biacore; data not shown).

In vitro T cell costimulation

Splenocytes or purified lymph node (LN) CD4+ T cells were stimulated with 1 µg/ml soluble anti-CD3 with or without 10 µg/ml soluble anti-CD28 for 48 h and pulsed with 1 µCi of tritiated thymidine (Amersham Biosciences) for 8 h. Triplicate cultures were incubated for 72 h, and the supernatants were harvested for cytokine analysis and analyzed in duplicate using CBA bead kits (BD Biosciences) and specific mouse cytokine ELISA kits (R&D Systems). To create primary Th2 cultures, CD4+ T cells from splenocytes were purified by negative bead selection (Miltenyi Biotec) from TIM-2-deficient and wild-type mice. A total of 5 x 106 CD4+ T cells was activated with 1 µg/ml immobilized anti-CD3 and 5 µg/ml soluble anti-CD28 under Th2-polarizing conditions (10 µg/ml anti-IL-12 and anti-IFN-{gamma} (BD Biosciences) and 100 ng/ml murine IL (mIL)-4 (R&D Systems)) for 96 h at 37°C. Cells were stained with anti-murine TIM-2 mAb and rat IgG2a isotype control and detected with PE donkey anti-rat IgG (H + L; Jackson ImmunoResearch Laboratories) diluted at 1/200 for FACs analysis.

In vitro T cell differentiation and analysis of cultures

Dendritic cells (DC) were derived from the bone marrow of BALB/c mice by first depleting the bone marrow suspension with FITC-labeled anti-CD4, anti-CD8, anti-B220, and anti-GR1 mAbs (all from BD Biosciences) and anti-FITC MACS beads (Miltenyi Biotec), then culturing the remaining cells for 6–7 days in 25 ng/ml murine GM-CSF (R&D Systems) and 10 µg/ml mIL-4 (BD Biosciences). DC were then washed and irradiated at 1000 rad. CD4+ T cells were isolated from the spleens of DO11.10 mice using negative selection columns (Cedarlane Laboratories) and were cultured to produce Th1 and Th2 T cell subsets. To produce the Th1-dominant culture, 4 x 106 CD4+ T cells were incubated in RPMI 1640 containing 10% FBS with 50 µg/ml OVA in the presence of 2 x 105 bone marrow-derived DC, 10 µg/ml anti-mIL-4, and 5 ng/ml rIL-12 (both obtained from BD Biosciences) for 48 h. The cells were then rested for 7 days, and restimulated with 1 µg/ml plate-bound anti-CD3 and 5 µg/ml soluble anti-CD28 (BD Biosciences) and Th1 cytokine conditions, as described above. This cycle of resting and stimulation was repeated a total of three times. After the final stimulation, the cells were permeabilized using the Golgiplug kit (BD Biosciences) and stained with PE-labeled anti-IFN-{gamma}, allophycocyanin-labeled anti-IL-4, allophycocyanin-labeled anti-IL-5, or correspondingly labeled isotype controls (all obtained from BD Biosciences) for analysis by flow cytometry. To examine expression of TIM-2, cells were incubated with mAb 2C2 or the corresponding isotype control (rat IgG2a; BD Biosciences), then with PE-labeled goat anti-rat IgG (H + L; Jackson ImmunoResearch Laboratories).

To produce Th2-predominant cultures, 4 x 106 CD4+ T cells were incubated in RPMI 1640 containing 10% FBS with 50 µg/ml OVA in the presence of 2 x 105 bone marrow-derived DC, 10 µg/ml mIL-4 (R&D Systems), 10 µg/ml anti-murine IFN-{gamma}, and 100 ng/ml anti-mIL-12 (both from BD Biosciences) for 48 h. The cells were rested for 7 days, then restimulated with 1 µg/ml plate-bound anti-CD3 and 5 µg/ml soluble anti-CD28 (BD Biosciences) and Th2 cytokine conditions, as described above. This cycle of resting and stimulation was repeated a total of three times. The cells were then analyzed by flow cytometry, as described above.

In vivo T cell priming

TIM-2-deficient and wild-type mice (n = 5) were immunized s.c. below the shoulder blades and in the flanks with 1 mg of keyhole limpet hemocyanin (KLH) emulsified in 50 µg of CFA (both from Sigma-Aldrich). Six days later, the mice were sacrificed, and brachial, axillary, and inguinal LN were harvested and pooled. CD4+ T cells were isolated using affinity columns (Cedarlane Laboratories), and triplicates or quadruplicates of each sample were cultured in RPMI 1640 medium containing 10% FBS at a concentration of 5 x 105 cells/well plus varying concentrations of KLH in the presence of 2 x 105 irradiated splenocytes (1000–1500 rad) from naive (untreated) syngenic mice. Forty-eight hours later, the cell culture supernatants were harvested for analysis using CBA beads (BD Biosciences) and ELISA kits (R&D Systems). Parallel triplicate cultures were pulsed with 1 µCi of tritiated thymidine per well (Amersham Biosciences) for 8 h starting at the 64th hour of culture, then harvested and counted using the Microbetajet system (Wallac).

Induction and measurement of airway inflammation, and measurement of the recall response to OVA

Five- to 6-wk-old TIM-2-deficient mice and wild-type littermates (n = 8) were immunized i.p. on days 1 and 7 with 50 µg of OVA grade V (Sigma-Aldrich) in 200 µl of 50:50 solution of ImjectAlum (Pierce) and PBS. Serum samples were recovered 48 h after the second injection. Mice were placed in an ultrasonic nebulizer (Devilbis) and exposed to aerosolized 1% OVA in PBS for 20 min each on days 28, 29, and 30. On day 32, the mice were sacrificed, and bronchial lavage was performed with PBS. Cells in the bronchial lavage fluid (BALF) were isolated, washed, counted, and spun onto slides using a cytospin. Bronchial lavage cytospins were stained with Hema3 differential staining kit (Fisher Scientific), and alveolar macrophages, eosinophils, neutrophils, and lymphocytes were counted. The lung tissue was harvested into neutral buffered Formalin for routine histology, or was snap frozen in TRIzol for subsequent RNA isolation. Routine histology included H + E staining, anti-CD3 staining to detect T cells, and periodic acid-Schiff staining to stain mucus. Draining (bronchial) LN and spleen were harvested and pooled for isolation of mononuclear cells, which were placed into culture in RPMI 1640/10% FBS with varying concentrations of OVA. Seventy-two hours later, the supernatants were harvested and cells were pulsed, as described above. Supernatant samples were analyzed in duplicate using CBA beads (BD Biosciences) and IL-13 ELISA (R&D Systems).

For treatment with the TIM-2-Fc fusion protein, mice received TIM-2-Fc by i.p. injection. Two protocols were used. In the prophylactic protocol, mice were dosed with 200 µg of TIM-2-Fc on days –1, 3, 6, and 9 relative to immunization with OVA in alum on days 1 and 7. Then, the mice received a single bolus dose of 500 µg of TIM-2-Fc on day 28, 4–6 h before the first nebulization session. For the prechallenge protocol, mice were immunized with OVA in alum, as described above, but no TIM-2-Fc treatment was given during this time. One day before the first nebulization session, mice received 250 µg of TIM-2-Fc or isotype control protein. A second dose on 250 µg was given 4–6 h before the second nebulization session.

For the adoptive transfer experiments, 5- to 6-wk-old TIM-2-deficient and wild-type mice were immunized i.p. on days 0 and 7 with 50 µg of OVA in alum. On day 14, splenocytes were harvested and enriched for CD4+ T cells using negative selection columns (StemSep). A total of 5 x 106 CD4+ T cells was cultured in 6-well plates with 2 x 106 irradiated, CD4-depleted splenocytes from naive BALB/c mice, in the presence of 200 µg/ml soluble OVA for 3 days. The cells were then harvested, resuspended in 100 µl of sterile PBS, and transferred i.v. to naive BALB/c or wild-type mice using 4–5 x 106 cells per mouse. The recipient mice were challenged with nebulized 1% OVA in PBS or PBS alone on days 3, 4, and 5 posttransfer. On day 7 posttransfer, BALF was harvested, and lung tissue was collected. Pooled lung tissue from each cohort was digested using 1 mg/ml collagenase and 0.1 mg/ml DNase1 (both from Sigma-Aldrich) and 5 x 105 lymphocytes/well were incubated with 200 µg/ml OVA for ex vivo proliferation and cytokine analysis, as described above.

RNA isolation and RT-PCR

Cell lines were cultured in RPMI 1640 containing 10% FBS (JRH Biosciences) and antibiotic/antimycotic solution (Invitrogen Life Technologies). Primary cells were isolated from mouse spleen or LN using specific negative selection columns (Cedarlane Laboratories). RNA was isolated from cells or tissues using the homogenizer method (Omni International) and TRIzol buffer (Invitrogen Life Technologies). TIM-2 mRNAs were amplified using the First Strand RT-PCR kit (Invitrogen Life Technologies) and specific primers (5': TACCTCTACTTCTCCAACACC; 3': CCTTTTCATAACCACGTACCTGGTG). Mouse TIM-1 was amplified following the reverse-transcriptase (RT) step using specific primers (5': CACTCCTCCAACATCTACACACACATGG; 3': CTTAGAGACACGGAAGGCAAC CACGCT). Mouse TIM-3 was amplified following the RT step using specific primers (5': GTCTTACCCTCAACTGTGTCCTG; 3': GTGTCTCTGAACCATTTCTCTCC). All PCR were run at a predetermined limiting cycle number to allow for semiquantitative analysis of the resulting product.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Creation and analysis of the TIM-2-deficient mouse

The mouse TIM-2 gene was disrupted by replacing exons encoding the signal peptide and Ig domains with a neoresistance gene cassette, and the gene deletion was confirmed using genomic blot analysis (Fig. 1). TIM-2 gene-deficient mice were produced from TIM-2+/– matings at the expected Mendelian frequency, and were backcrossed for 10 generations onto the BALB/c strain. To ensure that the adjacent genes in the TAPR locus were not affected by the TIM-2 disruption, we analyzed the level of expression of TIM-1 and TIM-3 mRNA in spleen and LN by RT-PCR and found that these were unchanged between TIM-2-deficient mice and wild-type littermates (data not shown). Furthermore, TIM-1 expression was up-regulated in injured kidney, as expected (4) (data not shown). TIM-2 mRNA expression was absent from all TIM-2-deficient tissues examined, including spleen, LN, thymus, and kidney (data not shown). To examine TIM-2 protein expression, CD4+ T cells were isolated from spleen and activated in Th2 culture conditions. Activated cells were stained with TIM-2-specific mAb 1G10 or isotype control, and the intensity of staining was examined. After 96 h of culture, TIM-2 expression was robust in T cell isolated from wild-type mice, and wholly absent from T cells isolated from TIM-2-deficient mice (Fig. 2a), showing that the gene targeting had indeed eliminated TIM-2 expression.


Figure 1
View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 1. Representation of the TIM-2 gene knockout and analysis of the resultant mice. a, The mouse TIM-2 targeting construct replaced the exons encoding the signal sequence and IgV domain with GAL4 and neomycin coding sequence. b, Genomic analysis shows the expected size reduction of the band recognized by the 3' probe, as well as the presence of the GAL4 coding sequence.

 

Figure 2
View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 2. TIM family expression in lymphoid tissues and cells. a, Activated CD4+ T cells express TIM-2. CD4+ T cells from wild-type and TIM-2-deficient mice were activated with anti-CD3 and anti-CD28 in Th2-polarizing conditions for 4 days. Expression of TIM-2 was assessed using the specific mAb 1G10 (blue line) as compared with a rat IgG2a isotype control (red line). b, TIM-1 and TIM-2 mRNA is expressed in both B and T cell populations in mouse spleen, while TIM-3 expression is primarily limited to the T cell compartment. mRNA was isolated from BALB/c mouse tissues and analyzed for expression of TIM-1, TIM-2, and TIM-3 by semiquantitative RT-PCR. Sp, splenocytes; T, T cells; B, B cells. c, Mouse T and B cell lines express TIM-2 mRNA: W, WEHI-174; A, A20; S, S49-1; E, EL-4; C, negative control lane (A20 mRNA subjected to PCR without the RT step). d, Mouse EL4 thymoma and A20 B lymphoma lines express TIM-2 on the cell surface. Cells were incubated with rat anti-mTIM-2 mAb 2C2 (blue) or rat IgG2a isotype control mAb (red). Cell-bound mAb was detected with a PE-labeled secondary Ab raised against rat Ig.

 
No obvious abnormalities in the development of the cells and organs of the immune system of TIM-2-deficient mice were detected by FACs analyses or immunohistochemistry, and circulating levels of serum Igs were similar in TIM-2-deficient mice and wild-type littermates (data not shown). These results indicated that the resting immune system was unaffected by the absence of TIM-2.

TIM-2 is expressed on lymphocytes and regulates immune responses

TIM-2 expression has been described on activated T cells (7, 8), a result we have reproduced (Fig. 2a). Furthermore, we found that TIM-2 mRNA was present in both T and B cells isolated from spleen and LN from BALB/c and C57BL/6 mice (Fig. 2b and data not shown). Similar to TIM-2, TIM-1 mRNA expression was found in both T and B cell populations, while TIM-3 expression was essentially found only in T cells (Fig. 2b). TIM-2 mRNA expression was also noted in various lymphocyte cell lines (Fig. 2c), and cell surface protein expression was detected on both T and B cell lines (Fig. 2d). Splenocytes or isolated CD4+ T cells from TIM-2-deficient mice and wild-type littermates were stimulated with anti-CD3 mAb or anti-CD3/anti-CD28 mAbs to investigate the cellular response to costimulation. No significant differences in proliferation or cytokine production between TIM-2-deficient mice and wild-type mice were noted (data not shown). These results showed that primary activation of naive T cells was not affected by the absence of TIM-2.

We next immunized TIM-2-deficient mice s.c. with KLH in CFA and 6 days later excised the draining LN. CD4+ T cells were isolated and restimulated for 48 h with KLH in PBS plus irradiated splenocytes, or with anti-CD3 mAb. Cellular proliferation and levels of secreted cytokines were determined in response to stimulation. Anti-CD3 treatment induced robust cellular proliferation of both TIM-2-deficient CD4+ T cells and wild-type CD4+ T cells, showing that both cell populations were competent to respond to polyclonal stimulation. In contrast, the in vitro recall response to soluble KLH was markedly higher in the TIM-2-deficient cultures (Fig. 3a). We assessed cytokines produced by wild-type and TIM-2-deficient T cells in response to KLH restimulation, and found that TIM-2-deficient T cells consistently produced higher levels of the Th2-associated cytokines IL-4, IL-5, IL-6, and IL-10 (Fig. 3b). The levels of IL-2 and TNF-{alpha} were similar in wild-type and TIM-2-deficient cultures (Fig. 3b and data not shown). Levels of the Th1-associated cytokine IFN-{gamma} were also consistently higher in TIM-2-deficient cultures as compared with controls (Fig. 3b). In contrast, the level of cytokines produced in response to anti-CD3 stimulation was generally similar in TIM-2-deficient and wild-type cultures (Fig. 3c), and the differences observed were not statistically significant. Therefore, the Ag-specific response of TIM-2-deficient mice differed markedly from that of wild-type mice, while the response to polyclonal stimulation was similar.


Figure 3
View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 3. TIM-2-deficient LN T cells hyperproliferate in an Ag recall response assay. a, CD4+ T cells were isolated from draining LN 6 days after immunization with KLH in CFA. CD4+ T cells were rechallenged ex vivo with KLH in PBS plus irradiated splenocytes for 72 h, and thymidine incorporation was measured. The response of wild-type (•: TIM-2+/+) or TIM-2-deficient ({blacksquare}) CD4+ T cells to increasing concentrations of KLH (left panel) or to stimulation with 1 µg/ml soluble anti-CD3, without Ag (right panel), was measured. Means and SE are shown; n = 3. *, p < 0.001. b, TIM-2-deficient LN T cells produce elevated levels of Th2 cytokines in an Ag recall response assay. CD4+ T cells were challenged with Ag plus irradiated splenocytes for 48 h, and cytokine secretion into supernatant was measured. Means and SE are shown; n = 3. *, p < 0.001. c, Wild-type and TIM-2-deficient CD4+ T cells produce similar levels of cytokines upon stimulation with anti-CD3. Means and SE are shown; n = 3. *, p < 0.001. The data are representative of two separate experiments.

 
TIM-2 regulates atopic lung inflammation

The development of atopic disorders requires effector T cell activation and expansion in the lymphoid compartment and subsequent migration to target tissue. We examined expression of TIM-2 during development of lung inflammation. BALB/c mice were sensitized with chicken OVA in alum by i.p. administration, then challenged with OVA in aerosol to elicit an inflammatory response in the lung (9). This model of airway inflammation is known to depend on Th2 cytokine production (9). Bronchial LN and lung tissue were harvested for analysis of TIM-2 RNA levels by semiquantitative RT-PCR before and after challenge with an aerosol of OVA in PBS. Striking up-regulation of TIM-2 was observed in both LN and lung 24 and 48 h after aerosol challenge (Fig. 4a). We collected BALF from OVA aerosol-challenged mice and examined the cellularity by differential staining. The majority of cells were alveolar macrophages (70% or more) and eosinophils (up to 30%) with small numbers of neutrophils and lymphocytes observed. No TIM-2 signal was detected by RT-PCR from RNA isolated from BALF cell pellets, suggesting that eosinophils and macrophages are not a major source of TIM-2 expression in lung (data not shown). To determine whether Ag stimulation of T cells could induce TIM-2 expression, we used CD4+ T cells from the transgenic DO11.10 mouse strain that express only an OVA peptide-specific TCR (10). CD4+ T cells isolated from DO11.10 mice were polarized using cytokine treatment and Ag challenge in vitro to create IL-4-secreting Th2 cells and IFN-{gamma}-secreting Th1 cells (11). After the lines were established, these cells were restimulated with Ag for 5 days and assessed for TIM-2 expression. Activated IL-4-secreting Th2 cells, but not IFN-{gamma}-secreting Th1 cells, expressed TIM-2 protein on the cell surface, as shown by FACS analysis (Fig. 4b). Therefore, TIM-2 mRNA was preferentially expressed by activated Th2 T cells.


Figure 4
View larger version (73K):
[in this window]
[in a new window]
 
FIGURE 4. TIM-2 expression is up-regulated with the onset of lung inflammation. a, TIM-2 mRNA expression is up-regulated in bronchial LN (left panel) and lung tissue (right panel) upon challenge with aerosolized Ag. LN were pooled from six mice per time point; samples of lung tissue from different individual mice are shown. Tissues were harvested either before ("0") or 24 and 48 h after the 3-day period of nebulization with OVA aerosol. The data are representative of three individual experiments. b, TIM-2 expression on CD4+ T cells isolated from DO11.10 mice and induced to a Th1 or Th2 phenotype. T cell differentiation status was assessed using mAbs to IFN-{gamma}, IL-4, and IL-5 (solid lines) as compared with matched isotype controls (dotted lines). IL-4 and IL-5 staining are shown as an overlay: IL-4 staining in green and IL-5 staining in blue. TIM-2 expression was detected using the specific mAb 2C2 (solid line) as compared with staining with the isotype control mAb (dotted line). The x-axis shows the intensity of signal generated with each mAb; the y-axis portrays the relative proportion of cells within the sample across the range of signal intensity. c–e, Inflammation in Ag-challenged lung is increased in the TIM-2-deficient mouse. Lung tissue was harvested 48 h after the 3-day period of nebulization, and Formalin-fixed paraffin-embedded sections were stained with H&E stain (c) or with Ab to CD3 (d). Mononuclear cell infiltrates (arrows) were larger in TIM-2-deficient mice and included numerous CD3+ T cells. Periodic acid-Schiff (PAS) stain revealed extensive mucus hyperproduction in the TIM-2-deficient mice (e).

 
To determine whether TIM-2 plays a role in atopic immune responses, TIM-2-deficient mice were sensitized with OVA in alum i.p., then challenged with repeated exposure to OVA aerosol in PBS to elicit an inflammatory response in the lung. We measured the extent of granulocyte and lymphocyte infiltration into the lung by immunohistochemistry and analysis of BALF cellularity. Immunohistochemical staining revealed interstitial mononuclear cell infiltrates in the wild-type mice, which were consistently larger in size in the TIM-2-deficient mice (Fig. 4c). These infiltrates contained numerous T cells, as shown by staining with anti-CD3 (Fig. 4d). However, we did not perform whole lung cell counts, and therefore cannot formally conclude that the extent of lung parenchymal inflammation was different between wild-type and TIM-2-deficient cohorts. Evidence of increased inflammation was further suggested by the extent of mucus staining in TIM-2-deficient mice, which was generally more extensive and more intensely stained than in wild-type mice (Fig. 4e).

We could not consistently detect TIM-2 staining in lung or bronchial LN paraffin sections. Robust mononuclear cell infiltration into lung tissue is associated with a pronounced inflammatory response that attracts granulocytes. As expected, therefore, analysis of cell infiltration into BALF revealed an increase in the number of eosinophils and lymphocytes present in the TIM-2-deficient animals as compared with wild-type mice, or wild-type mice not sensitized to OVA (Fig. 5a).


Figure 5
View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 5. TIM-2-deficient mice have an enhanced Th2 T cell response to lung Ag challenge. a, BALF cellularity was determined for nonsensitized wild-type mice, and for wild-type and TIM-2-deficient mice after aerosolization with OVA. TIM-2-deficient mice had significantly higher percentages of eosinophils and lymphocytes than did wild-type mice. Means and SD are shown; n = 8. *, p < 0.02. b, Bronchial LN were isolated 48 h after the 3-day nebulization period with OVA aerosol. LN cells were rechallenged ex vivo with OVA in PBS for 72 h, and thymidine incorporation was measured. The anti-CD3 controls were wild-type LN cells or TIM-2-deficient LN cells stimulated with 1 µg/ml soluble anti-CD3, without Ag. Means and SE are shown; n = 3. **, p < 0.001. c, TIM-2-deficient LN cells produce highly elevated levels of Th2 cytokines after restimulation with OVA ex vivo. LN cells were challenged with 100 µg/ml OVA for 48 h, and cytokine secretion into supernatant was measured. Very high levels of IL-5, IL-10, and IL-13 were measured (c, left), and levels of IL-4, IL-6, and IFN-{gamma} were also elevated (c, right). Means and SE are shown; n = 3. *, p < 0.02; **, p < 0.001. The data are representative of multiple experiments.

 
To investigate the mechanism underlying the aggravated response in TIM-2-deficient mice, bronchial LN cells were restimulated with OVA ex vivo. TIM-2-deficient LN cells proliferated more in response to OVA stimulation than did wild-type LN cells, while the response to anti-CD3 stimulation was similar (Fig. 5b). LN cells from TIM-2-deficient mice stimulated with OVA secreted markedly higher levels of IL-5, IL-10, and IL-13 (8- to 12-fold increases), and modestly higher levels of IL-4 and IL-6 than wild-type LN cells (Fig. 5c). Of interest, expression of IFN-{gamma} was higher in the TIM-2-deficient cultures than in the wild-type cultures, although levels of this cytokines remained below 10 pg/ml (Fig. 5c). Similarly, the expression of TNF approximately doubled in the TIM-2-deficient culture (40 pg/ml) as compared with the wild-type culture (18 pg/ml), but remained low on average. Therefore, lymphocytes from TIM-2-deficient mice displayed an enhanced response to Ag stimulation characterized by the predominant expression of Th2 cytokines.

T cells are responsible for the TIM-2-deficient phenotype

To determine whether T cells were responsible for the phenotype caused by TIM-2 deficiency, we performed adoptive transfer experiments. TIM-2-deficient or wild-type littermates were immunized with i.p. administration of OVA in alum, and splenic CD4+ T cells were then isolated and transferred into naive TIM-2-deficient, wild-type, or BALB/c mice. The recipient mice were then exposed to nebulized OVA. Consistent with the TIM-2 defect impacting T cell activity, transfer of TIM-2-deficient T cells into wild-type littermates or into BALB/c recipients transferred hypersensitivity to OVA aerosol, as measured by the influx of eosinophils into the BALF (Fig. 6a). To confirm the mechanism underlying this inflammatory response, lymphocytes were isolated from lung tissue of recipient mice after nebulization. Lung tissue was used because we reasoned that this would be a source of effector T cells. Cells isolated from mice that had been adoptively transferred from TIM-2-deficient mice secreted higher levels of IL-5, IL-6, and IL-13 than did cells isolated from mice that had been adoptively transferred from wild-type mice, which produced only modest amounts of cytokines, at or just above background levels, as measured by cultures derived from the unsensitized control (Fig. 6b). Higher levels (~2-fold) of IL-4, IL-10, and IFN-{gamma} were also noted, while IL-2 and TNF levels remained unchanged (data not shown). These results identify CD4+ T cells as the critical cell type imparting the TIM-2-deficient phenotype. Furthermore, the results are consistent with the hypothesis that regulation of Th2 effector cell activity, resulting in altered cytokine production, is the mechanism underlying the hyperimmune responses seen in TIM-2-deficient mice.


Figure 6
View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 6. TIM-2-deficient CD4+ T cells are responsible for the enhanced lung inflammation. a, TIM-2-deficient or wild-type mice were immunized with OVA/alum, spleens from each mouse strain were harvested, and splenic CD4+ T cells were isolated. These cells were then transferred into naive wild-type (a, right panel) or BALB/c (a, left panel) recipients, which then were exposed to OVA aerosol by nebulization. PBS aerosol of OVA-immunized mice was used as controls. Forty-eight hours postnebulization, BALF was harvested from the recipient mice. Lung inflammation as measured by eosinophil influx into BALF was highest in naive wild-type or BALB/c mice receiving TIM-2-deficient CD4+ T cells. Means and SD are shown; n = 8. *, p < 0.001 as compared with the corresponding value for transfer of wild-type cells and nebulization with OVA. b, Forty-eight hours postnebulization with OVA or PBS, lung tissue was harvested from recipient mice, and lymphocytes were isolated by collagenase digestion and column selection. The purified cells were restimulated with 200 µg/ml OVA ex vivo for 48 h, and cytokines secreted into the supernatant were measured. The secretion of IL-5, IL-6, and IL-13 was highest in those cultures derived from mice that received CD4+ T cells from immunized TIM-2-deficient mice. Means and SE are shown; n = 3. *, p ≤ 0.001, as compared with the corresponding value for transfer of wild-type cells and nebulization with OVA. The experiment was repeated three times, and the results are representative.

 
TIM-2 affects established effector T cell activity

The TIM-2 protein has the hallmarks of a receptor, including a cytoplasmic domain with both serine and tyrosine phosphorylation sites (7). We sought to antagonize TIM-2 activity in wild-type mice by treatment with a soluble TIM-2-Fc fusion protein. BALB/c mice were treated with TIM-2-Fc fusion protein during the sensitization and challenge phases in the OVA model. Similar to the TIM-2-deficient mice, TIM-2-Fc-treated mice had increased eosinophil counts in BALF (35% increase over human IgG control; p < 0.001) and enlarged mononuclear cell infiltrates containing CD3+ lymphocytes in the lung tissue (Fig. 7). In addition, there was enhanced proliferation by LN cells in response to Ag stimulation, and cytokine production, particularly of IL-5 and IL-13, was increased (Fig. 7). Secretion of other cytokines was also increased, including IL-6 and IL-10 (2- to 3-fold) and IFN-{gamma} (1.6-fold), while there was no increase in IL-2 or TNF (data not shown).


Figure 7
View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 7. Treatment of BALB/c mice with TIM-2-Fc fusion protein induces a phenotype similar to that of TIM-2 deficiency. Mice were given TIM-2-Fc fusion protein of polyclonal human IgG control protein during the immunization with OVA/alum, and again just before the nebulization period. Mice nebulized with PBS served as the negative control ("control"). a, Lung tissue harvested 48 h after the nebulization period shows robust mononuclear cell infiltrates containing numerous CD3+ T cells present in the TIM-2-Fc-treated mice. b, Bronchial LN cells were harvested 48 h after the OVA nebulization period and were restimulated with OVA in PBS ex vivo. LN cells isolated from mice treated with TIM-2-Fc showed greatly enhanced proliferation in response to OVA stimulation. Mean and SE are shown; n = 4. *, p < 0.001. c, Bronchial LN cells were harvested 48 h after the nebulization period and restimulated with 250 µg/ml OVA in PBS. LN cells isolated from mice treated with TIM-2-Fc showed greatly enhanced production of Th2 cytokines, including IL-5 and IL-13, in response to OVA stimulation. Mean and SE are shown; n = 4. *, p < 0.001. The experiment was repeated three times, and these data are representative.

 
To determine at which point in the development of the immune response TIM-2 can exert its influence, we again used the TIM-2-Fc fusion protein in the OVA-induced lung inflammation model, but delayed dosing with the TIM-2-Fc fusion protein until just before the challenge phase, in which OVA is repeatedly presented to the sensitized mice using nebulization. The impact of this protocol of TIM-2-Fc treatment on lung inflammation and Th2 cytokine secretion was very similar to that seen using the TIM-2-deficient mice, and to treatment with TIM-2-Fc throughout the sensitization and challenge phases in the OVA model. Eosinophil numbers were increased in bronchial lavage; bronchial LN proliferation in response to OVA ex vivo was increased; and the production of IL-4, IL-5, IL-10, and IL-13 was heightened (Fig. 8). Production of IL-6 and IFN-{gamma}, although low (<100 pg/ml), was modestly enhanced also (2- to 3-fold), while levels of IL-2 and TNF were unchanged from the isotype control (data not shown). Therefore, TIM-2-Fc treatment appeared to influence the activity of OVA-specific effector T cells.


Figure 8
View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 8. Treatment of BALB/c mice with TIM-2-Fc fusion protein before allergen rechallenge induces a phenotype similar to that of TIM-2 deficiency. Using the OVA-induced lung inflammation model, mice were given TIM-2-Fc fusion protein or polyclonal human IgG control protein just before the nebulization period. As a further control, wild-type mice were immunized with OVA, but received PBS in the nebulizer; the percentage of eosinophils present in this control group was <1%. a, Eosinophil percentage in the BALF of TIM-2-Fc-treated mice was higher than that of isotype control-treated mice. Mean and SD are shown; n = 8. **, p < 0.02. b, Bronchial LN cells were harvested 48 h after the OVA nebulization period and were restimulated with OVA in PBS. LN cells isolated from mice treated with TIM-2-Fc ({blacktriangleup}) showed greater proliferation in response to OVA stimulation than did mice treated with isotype control protein ({blacksquare}). LN cells from mice that were immunized with OVA, but received PBS nebulization ({diamondsuit}), did not proliferate in this assay. Mean and SE are shown; n = 3. *, p < 0.001. c, Bronchial LN cells were harvested 48 h after the nebulization period and restimulated with OVA in PBS. LN cells isolated from mice treated with TIM-2-Fc ({blacktriangleup}) showed enhanced production of Th2 cytokines, including IL-4, IL-5, IL-10, and IL-13, in response to OVA stimulation than did mice treated with isotype control protein ({blacksquare}). LN cells from mice that were immunized with OVA, but received PBS nebulization ({diamondsuit}), did not produce cytokines in this assay. Mean and SE are shown; n = 3. *, p < 0.001.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Allergen-induced airway inflammation has been considered a prototypical Th2 immune response. The TIM gene family resides in a genomic region associated with a variety of Th2 cytokine-driven disorders, including familial eosinophilia, bronchial asthma, rhinitis, and atopic dermatitis (12). In this regard, it is striking that TIM-2 deficiency leads to pronounced up-regulation of an array of Th2-associated cytokines, including IL-4, IL-5, IL-6, IL-10, and IL-13. The phenotype was observed in the context of the Th2-dependent lung inflammation model, but also after stimulation with KLH in CFA, a protocol that generally elicits a strong Th1 response. This effect appears to be due to a preferential expansion of the Th2 T cell response, as the Th1-associated cytokine IFN-{gamma} was not specifically down-regulated, but was either unaffected, as seen in the Th2-dominated response to OVA/alum, or even elevated, as seen in the Th1-dominated response to KLH/CFA. In the KLH model, the generally elevated immune response may have driven further IFN-{gamma} expression indirectly (i.e., a bystander effect), but this requires additional study. To directly test whether Ag-driven Th2 differentiation is affected by TIM-2 deficiency will require crossing the TIM-2-deficient mouse onto a TCR-specific background. However, it is possible that the TIM-2 pathway regulates Th2 T cell activity downstream of Th1/Th2 differentiation. Thus, rather than skewing of Th1 or Th2 T cell responses, as is seen in mice deficient in critical T cell differentiation factors such as t-bet or GATA-3 (13, 14), TIM-2 deficiency may instead preferentially support the expansion or survival of the Th2 subset. This hypothesis is consistent with the effect of TIM-2-Fc treatment just before the challenge phase in the OVA model, that is, after T cell subsets have been established during the immunization phase. Therefore, the dramatic increase in the expression of Th2 cytokines does not occur at the expense of the expression of Th1 cytokines, but both responses are present. Such a mixed cytokine response is often present in asthmatic patients, and models in mice suggest that complex interactions between Th1 and Th2 cytokines can augment disease severity and lead to increased lung injury and fibrosis (15, 16, 17). Chronic models of lung inflammation will be used to examine the effect of TIM-2 deficiency on the extent of airway remodeling and airway resistance.

The analyses of the TIM-2 gene-deficient mouse clearly show that TIM-2 normally functions to down-regulate specific effector T cell responses, in particular those conferring a Th2 phenotype. It should be noted that expression of IFN-{gamma} was similarly modulated, albeit to a lesser extent, and therefore TIM-2 may generally regulate T cell activation and impact both Th1 and Th2 cytokines. The results that we obtained treating wild-type BALB/c mice with TIM-2-Fc fusion protein were very similar to those obtained using the TIM-2-deficient mice. Treatment of SJL/J mice with TIM-2-Fc during immunization with proteolipid apoprotein peptide also enhanced Th2 cytokine production (8), although in that study this response was associated with a pronounced decline in IFN-{gamma} production, a result at odds with the genetic data presented in this work. It may be that differences in the immunization protocols or background strain of mice account for the different effect on IFN-{gamma} expression. If we assume that TIM-2-Fc fusion protein blocks normal ligand/receptor interaction, then the data suggest that ligand engagement of TIM-2 normally transduces a negative regulatory signal. Notably, it has been proposed that APCs express a TIM-2 ligand (8), and it is reasonable to hypothesize that APCs themselves regulate effector T cell activity through this and other TIM pathways. Semaphorin4a, which is expressed by DC and activated B cells, was recently identified as a ligand for mouse TIM-2. However, semaphorin4a interaction with TIM-2 enhanced T cell responses in various in vitro and in vivo models (7), a finding inconsistent with the genetic data presented in this study. It is possible that multiple ligands for TIM-2 exist, which have divergent effects upon binding to the receptor.

Studies of the TIM-3-deficient mouse have shown that TIM-3 is a negative regulator of T cell effector activity, in particular of Th1 T cell activity (18, 19). We therefore can consider the hypothesis that TIM-2 and TIM-3 serve to regulate effector T cell activity to control Th2 and Th1 responses, respectively, in the mouse. Because both pathways have down-regulatory function, it appears that expression of these TIM proteins serves to block differentiation or expansion of specific effector T cell subsets, thus regulating immune responses. The results obtained from the studies in which TIM-2-Fc treatment was delayed until just before OVA challenge to the lung suggest that this pathway can impact T cell responses after differentiation has occurred during the sensitization phase.

TIM-2 is highly homologous to TIM-1, and appears to have arisen as a gene duplication in the rodent lineage, as only TIM-1 is found in primates. Functional studies of TIM-1 have been complicated by the varying effects that different mAbs have on TIM-1 activity. Anti-TIM-1 mAbs have been reported to enhance or block immune responses in a number of models (20, 21, 22). One recent study has demonstrated direct costimulatory activity of an anti-TIM-1 mAb, which was not reproduced with the Fab form of the molecule, strongly suggesting a direct signaling event might underlie the costimulatory activity (20). Furthermore, overexpression of TIM-1 resulted in increased T cell proliferation and expression of cytokines, and required an intact tyrosine phosphorylation motif (23). However, data derived from studies in which soluble TIM-1-Fc fusion proteins were shown to enhance immune responses suggest that TIM-1 would itself normally transduce a negative signal, one blocked when TIM-1-Fc interrupts the interaction of TIM-1 with its ligand(s) (21). As this last result is similar to that observed upon treatment with TIM-2-Fc and TIM-3-Fc (8, 18, 19), it may be that these three family members function similarly to down-regulate specific immune responses. Indeed, some signaling motifs present in the cytoplasmic domains of TIM-1, TIM-2, and TIM-3 appear well conserved (Fig. 9). Although the cytoplasmic domains of TIM-2 and TIM-3 are longer than that of TIM-1, it is not yet known whether the additional tyrosines found in these longer domains are functionally phosphorylated.


Figure 9
View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 9. Cytoplasmic sequences of murine TIM-1, TIM-2, and TIM-3, and human TIM-1. Potential serine and tyrosine phosphorylation sites were identified using Scansite (<http://scansite.mit.edu>), and the target amino acids are shown in highlighted bold letters. A putative tyrosine phosphorylation site adjacent to the transmembrane junction is shown in bold letters only; it is assumed that this site is not physically accessible by kinases.

 
One complication in understanding the function of TIM family members is that they are reported to have disparate ligands. Semaphorin4a reportedly only bound to TIM-2, and not TIM-1 (7), while TIM-4, another family member, has been identified as a ligand for TIM-1 (18), but fails to interact with TIM-2 in ELISA or surface plasmon resonance assays (data not shown). Finally, galectins have been described as TIM-3 ligands (24). This complicated picture of TIM-protein interactions may partly reflect the variability of the mucin domains and their arrays of O- and N-glycosylation sites. Of course, all of these TIM family proteins may have as yet unidentified alternative ligands. Finally, the role of TIM-2 expression on B cells requires further investigation, although B cells do not play a role in the lung inflammation model used in these studies (25). The expression and function of other TIM family members outside of the T cell compartment also require additional study.

The striking phenotypes observed in the TIM-2-deficient mouse provide genetic evidence of the critical role that TIM-2 plays in regulating Th2 T cell activity and associated immune responses. The importance of the TIM gene family to immunity and disease is shown by the linkage of the TAPR locus to multiple diseases in human patient populations. Our investigations of the role of TIM-2 in murine lung immunity suggest that human immune responses will be influenced by the activity of TIM family members, including the TIM-2 homologue TIM-1, and that the TIM proteins will emerge as important therapeutic targets in airway inflammation and other atopic disorders.


    Acknowledgments
 
We thank Juanita Campos and Jose Sancho for FACS analyses; Chris Tonkin, Michelle McAuliffe, Richard Tizard, and Eileen O’Leary for DNA sequence analysis; Greg Thill for mammalian cell line development; Mohammad Zafari for surface plasmon resonance analyses; Tom Crowell and colleagues for immunohistochemistry; and Rich Cate, John Carulli, and their groups for genomic and bioinformatic analyses of the TAPR locus.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
P. D. Rennert, I. D. Sizing, V. Bailly, Z. Li, R. Rennard, P. McCoon, L. Pablo, S. Miklasz, and L. Tarilonte are stockholding employees of Biogen Idec Incorporated.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 J.V.B. and T.I. were supported by National Institutes of Health Grants DK-39773, DK-72381, and DK-46267. Back

2 Address correspondence and reprint requests to Dr. Paul D. Rennert, Biogen Idec, 12 Cambridge Center, Cambridge, MA 01746. E-mail address: paul.rennert{at}biogenidec.com Back

3 Abbreviations used in this paper: TIM, T cell, Ig domain, mucin domain; BALF, bronchial lavage fluid; DC, dendritic cell; ES, embryonic stem; KLH, keyhole limpet hemocyanin; LN, lymph node; mIL, murine IL; RT, reverse transcriptase. Back

Received for publication March 14, 2006. Accepted for publication July 4, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. McIntire, J. J., S. E. Umetsu, O. Akbari, M. Potter, V. K. Kuchroo, G. S. Barsh, G. J. Freeman, D. T. Umetsu, R. H. DeKruff. 2001. Identification of Tapr (an airway hyperreactivity regulatory locus) and the linked Tim gene family. Nat. Immunol. 2: 1109-1116. [Medline]
  2. McIntire, J. J., S. E. Umetsu, C. Macaubas, E. G. Hoyte, C. Cinnioglu, L. L. Cavalli-Sforza, G. S. Barsh, J. F. Hallmayer, P. A. Inderbill, N. J. Risch, et al 2003. Hepatitis A virus link to atopic disease. Nature 425: 576[Medline]
  3. Gao, P. S., R. A. Mathias, B. Plunkett, A. Togias, K. C. Barnes, T. H. Beaty, S. K. Huang. 2005. Genetic variants of the T-cell immunoglobulin mucin 1 but not the T-cell immunoglobulin mucin 3 gene are associated with asthma in an African American population. J. Allergy Clin. Immunol. 115: 982-988. [Medline]
  4. Ichimura, T., J. V. Bonventre, V. Bailly, H. Wei, C. A. Hession, R. L. Cate, M. Sanicola. 1998. Kidney injury molecule-1 (KIM-1), a putative epithelial cell adhesion molecule containing a novel immunoglobulin domain, is up-regulated in renal cells after injury. J. Biol. Chem. 273: 4135-4142. [Abstract/Free Full Text]
  5. Kaplan, G., A. Tetsuka, P. Thompson, T. Akatsuku, Y. Moritsugu, S. M. Feinstone. 1996. Identification of a surface glycoprotein on African green monkey kidney cells as a receptor for hepatitis A virus. EMBO J. 15: 4282-4296. [Medline]
  6. Wills-Karp, M., J. Santeliz, C. L. Karp. 2001. The germless theory of allergic disease: revisiting the hygiene hypothesis. Nat. Rev. Immunol. 1: 69-75. [Medline]
  7. Kumanogoh, A., S. Marukawa, K. Suzuki, N. Takegahara, C. Watanbe, E. Ch’ng, I. Ishida, H. Fujimura, S. Sakoda, K. Yoshida, H. Kikutani. 2002. Class IV semaphorin Sema4a enhances T-cell activation and interacts with Tim-2. Nature 419: 629-633. [Medline]
  8. Chakravarti, S., C. A. Sabatos, S. Xiao, Z. Illes, E. K. Cha, R. A. Sobel, X. X. Zheng, T. B. Strom, V. K. Kuchroo. 2005. Tim-2 regulates T helper type 2 responses and autoimmunity. J. Exp. Med. 202: 437-444. [Abstract/Free Full Text]
  9. Lloyd, C. M., J. A. Gonzalo, A. J. Coyle, J. C. Gutierrez-Ramos. 2001. Mouse models of allergic airway disease. Adv. Immunol. 77: 263-295. [Medline]
  10. Murphy, K. M., A. B. Heimberger, D. Y. Loh. 1990. Induction by antigen of intrathymic apoptosis of CD4+CD8+TCRlo thymocytes in vivo. Science 250: 1720-1723. [Abstract/Free Full Text]
  11. Mosmann, T. R., S. Subash. 1996. The expanding universe of T-cell subsets: Th1, Th2 and more. Immunol. Today 17: 138-146. [Medline]
  12. Wills-Karp, M., S. L. Ewart. 2004. Time to draw breath: asthma-susceptibility genes are identified. Nat. Rev. Genet. 5: 376-387. [Medline]
  13. Finotto, S., M. F. Neurath, J. N. Glickman, S. Qin, H. A. Lehr, F. H. Y. Green, K. Ackerman, K. Haley, P. R. Galle, S. J. Szabo, et al 2002. Development of spontaneous airway changes consistent with human asthma in mice lacking T-bet. Science 295: 336-338. [Abstract/Free Full Text]
  14. Zhu, J., B. Min, J. Hu-Li, C. J. Watson, A. Grinberg, Q. Wang, N. Killeen, J. F. Urban, Jr, L. Guo, W. E. Paul. 2004. Conditional deletion of Gata3 shows its essential function in TH1-TH2 responses. Nat. Immunol. 5: 1157-1165. [Medline]
  15. El Biaze, M., S. Boniface, V. Koscher, E. Mamessier, P. Dupuy, F. Milhe, M. Ramadour, D. Vervloet, A. Magnan. 2003. T cell activation, from atopy to asthma: more a paradox than a paradigm. Allergy 58: 844-853. [Medline]
  16. Dahl, M. E., K. Dabbach, D. Liggit, S. Kim, D. B. Lewis. 2004. Viral-induced T helper type 1 responses enhance allergic disease by effects on lung dendritic cells. Nat. Immunol. 5: 337-343. [Medline]
  17. Holtzman, M. J., J. D. Morton, L. P. Shornick, J. W. Tyner, M. P. O’Sullivan, A. Antao, M. Lo, M. Castro, M. J. Walter. 2002. Immunity, inflammation, and remodeling in the airway epithelial barrier: epithelial-viral-allergic paradigm. Physiol. Rev. 82: 19-46. [Abstract/Free Full Text]
  18. Sanchez-Fueyo, A., J. Tian, D. Picarella, C. Domenig, X. X. Zheng, C. A. Sabatos, N. Manlongat, O. Bender, T. Kamradt, V. K. Kuchroo, et al 2003. Tim-3 inhibits T helper 1-mediated auto- and alloimmune responses and promotes immunological tolerance. Nat. Immunol. 4: 1093-1101. [Medline]
  19. Sabatos, C. A., S. Chakravarti, E. Cha, A. Schubart, A. Sánchez-Fueyo, X. X. Zheng, A. J. Coyle, T. B. Strom, G. J. Freeman, V. K. Kuchroo. 2003. Interaction of Tim-3 and Tim-3 ligand regulates T helper type 1 responses and induction of peripheral tolerance. Nat. Immunol. 4: 1102-1110. [Medline]
  20. Umetsu, S. E., W. L. Lee, J. J. McIntire, L. Downey, B. Sanjanwala, O. Akbari, G. J. Berry, H. Nagumo, G. J. Freeman, D. T. Umetsu, R. H. DeKruyff. 2005. TIM-1 induces T cell activation and inhibits the development of peripheral tolerance. Nat. Immunol. 6: 447-454. [Medline]
  21. Meyers, J. H., S. Chakravarti, D. Schlesinger, Z. Illes, H. Waldner, S. E. Umetsu, J. Kenny, X. X. Zheng, D. T. Umetsu, R. H. DeKruyff, et al 2005. TIM-4 is the ligand for TIM-1, and the TIM-1-TIM-4 interaction regulates T cell proliferation. Nat. Immunol. 6: 455-464. [Medline]
  22. Encinas, J. A., E. M. Janssen, D. B. Weiner, S. A. Calarota, D. Nieto, T. Moll, D. J. Carlo, R. B. Moss. 2005. Anti-T-cell Ig and mucin domain-containing protein 1 antibody decreases TH2 airway inflammation in a mouse model of asthma. J. Allergy Clin. Immunol. 116: 1343-1349. [Medline]
  23. De Souza, A. J., T. B. Oriss, K. J. O’Malley, A. Ray, L. P. Kane. 2005. T cell Ig and mucin 1 (TIM-1) is expressed on in vivo-activated T cells and provides a costimulatory signal for T cell activation. Proc. Natl. Acad. Sci. USA 102: 17113-17118. [Abstract/Free Full Text]
  24. Zhu, C., A. C. Anderson, A. Schubart, H. Xiong, J. Imitola, S. J. Khoury, X. X. Zheng, T. B. Strom, V. K. Kuchroo. 2005. The Tim-3 ligand galectin-9 negatively regulates T helper type 1 immunity. Nat. Immunol. 6: 1245-1252. [Medline]
  25. Maclean, J. A., A. Sauty, A. D. Luster, J. M. Drazen, G. T. De Sanctis. 1999. Antigen-induced airway hyperresponsiveness, pulmonary eosinophilia, and chemokine expression in B cell-deficient mice. Am. J. Respir. Cell Mol. Biol. 20: 379-387. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
R. Rodriguez-Manzanet, J. H. Meyers, S. Balasubramanian, J. Slavik, N. Kassam, V. Dardalhon, E. A. Greenfield, A. C. Anderson, R. A. Sobel, D. A. Hafler, et al.
TIM-4 Expressed on APCs Induces T Cell Expansion and Survival
J. Immunol., April 1, 2008; 180(7): 4706 - 4713.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Nakae, M. Iikura, H. Suto, H. Akiba, D. T. Umetsu, R. H. DeKruyff, H. Saito, and S. J. Galli
TIM-1 and TIM-3 enhancement of Th2 cytokine production by mast cells
Blood, October 1, 2007; 110(7): 2565 - 2568.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. L. Binne, M. L. Scott, and P. D. Rennert
Human TIM-1 Associates with the TCR Complex and Up-Regulates T Cell Activation Signals
J. Immunol., April 1, 2007; 178(7): 4342 - 4350.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. D. Sizing, V. Bailly, P. McCoon, W. Chang, S. Rao, L. Pablo, R. Rennard, M. Walsh, Z. Li, M. Zafari, et al.
Epitope-Dependent Effect of Anti-Murine TIM-1 Monoclonal Antibodies on T Cell Activity and Lung Immune Responses
J. Immunol., February 15, 2007; 178(4): 2249 - 2261.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. E. Knickelbein, A. J. de Souza, R. Tosti, P. Narayan, and L. P. Kane
Cutting Edge: Inhibition of T Cell Activation by TIM-2
J. Immunol., October 15, 2006; 177(8): 4966 - 4970.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rennert, P. D.
Right arrow Articles by Bonventre, J. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rennert, P. D.
Right arrow Articles by Bonventre, J. V.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS