|
|
||||||||
Hart and Louise Lyon Laboratory, Division of Clinical Immunology and Allergy, Department of Medicine, David Geffen School of Medicine, University of California, Los Angeles, CA 90095
| Abstract |
|---|
|
|
|---|
germline transcription in a B cell line and in PBMCs. We therefore studied the regulation in B cells of NAD(P)H: quinone oxidoreductase (NQO1) as a typical model phase II enzyme and its role in modulating DEPX-enhanced IgE responses. DEPX increased NQO1 mRNA expression in a dose-dependent manner. NQO1 protein induction by DEPX was confirmed by Western blot. DEPs induced activity of the antioxidant response element located in the NQO1 gene promoter. Induction of both NQO1 mRNA and protein expression could be blocked by coculture with an antioxidant and partly repressed by inhibitors of PI3K and p38 MAPK, but not by inhibitors of MAPK/ERK kinase (MEK/ERK) or protein kinase C. The ability of DEPX to enhance IgE production was blocked by the induction of phase II enzymes, including NQO1 in B cells by the chemical sulforaphane. These findings suggest that a natural protective mechanism in B cells from oxidant pollutants such as diesel particles is the expression of phase II enzymes through induction of antioxidant response elements and support the approach of overexpression of these enzymes as a potential future chemopreventative strategy. | Introduction |
|---|
|
|
|---|
Ng et al. (14) have shown that in monocytes low levels of exposure to chemical extracts of DEP (DEPX) result in the formation of ROS and lead to the activation of antioxidant response elements (AREs). In eukaryotes, ARE is thought to be important in mediating chemical-induced activation of antioxidant genes, a defense mechanism against oxidative stress (15, 16). Activation of these genes can occur by the translocation of the basic leucine zipper transcription factor NF E2 p45-related factor-2 (Nrf2) into the nucleus where it binds the AP1-NFE2 motif (GCTGAGTCATGATGAGTCA) in the ARE (17, 18). Among the genes induced are those for phase II drug-metabolizing enzymes that protect cells against the toxic effects of xenobiotics and oxidatively labile compounds by conjugating them and their byproducts into small hydrophilic moieties, thereby rendering them into less toxic forms (19). The importance of these phase II enzymes in regulating inflammatory responses to pollutants is illustrated by studies showing that individuals with nonfunctioning variants of phase II enzyme genes are highly susceptible to the proallergenic and proallergic effects of DEPs and ozone (20, 21). Thus, in individuals lacking the ability to make GST µ1 (GSTM1), upon challenge with DEPs their allergen-specific IgE responses are 50-fold higher than in individuals whose GSTM1 is present (20).
It is likely that the severity of responses to pollutants is critically dependent on the magnitude of phase II enzyme responses. We believe that a possible future therapeutic strategy to counteract the effects of diesel and other pollutants is through the induction of phase II enzyme genes to high levels. Therefore, it is important to understand how these enzymes are regulated by pollutants in cells that govern allergic responses. Although genes of phase II enzymes are ubiquitously expressed, their induction by oxidant chemicals has been primarily studied in hepatocytes. In this study we examine IgE production in B cells and its association with phase II responses induced by chemical extracts of DEPs. We confirm the ability of DEPX to directly target B cells to enhance IgE production and show that this may be achieved by increased
germline transcription. We have chosen a typical phase II enzyme, NAD(P)H:quinone oxidoreductase (NQO1), as a model member of the family. We show that DEPX can up-regulate NQO1 expression by induction of ARE, identify a putative pathway, and demonstrate that potent induction of the Nrf2 transcription factor will increase production of phase II enzymes in B cells and thereby block DEP-enhanced IgE production.
| Materials and Methods |
|---|
|
|
|---|
RPMI 1640 was obtained from Invitrogen Life Technologies. pGL3 luciferase reporter vectors and the Dual luciferase reporter assay system were purchased from Promega. SB203580 was obtained from A.G. Scientific, and LY294002, calphostin C, and PD98059 were from Calbiochem. N-acetylcysteine (NAC) was purchased from Sigma-Aldrich. Goat anti-NQO1 polyclonal Ab and HRP-labeled donkey anti-goat IgG were purchased from Abcam. Mouse anti-
-actin mAb was obtained from Santa Cruz Biotechnology. A plasmid midi kit was purchased from Qiagen. IsoPrep was obtained from Robbins Scientific. DL-Sulforaphane (1-isothiocyanato-4-(R)-(methylsulfinyl)-butane; CH3S(CH2)4NCS) was obtained from LKT Laboratories and diluted in PBS for addition to cell cultures. DEPs were a generous gift from Dr. M. Sagai (National Institute for Environmental Studies, Tokyo, Japan). These particles were generated by a light duty, four-cylinder diesel engine (4JB1 type; Isuzu Motors) using standard diesel fuel and methanol extracts prepared as previously described (11, 22).
PBMC isolation and B cell purification
PBMCs were prepared by Ficoll-Hypaque density centrifugation using IsoPrep. Briefly, whole blood was diluted by an equal volume of 0.9% NaCl. The diluted blood was carefully layered over IsoPrep and centrifuged at 1900 rpm for 20 min. The lymphocytes at the sample and IsoPrep interface were carefully transferred to a new tube and diluted with medium. After centrifugation at 1100 rpm for 10 min, the cell pellets were resuspended with RPMI 1640, and B cell isolation was performed as previously described (11). Briefly, T cells were depleted by two cycles of rosette formation with sheep RBCs treated with 2-aminoethylisothiouronium bromide (Sigma-Aldrich). Two cycles of adherence to plastic dishes in the presence of serum were performed to remove monocytes/macrophages. The resulting cell populations contained <1% contaminating T cells (CD3+) and >98.5% B cells (CD19+CD20+) as determined by cytofluorographic analysis. The Human Subject Protection Committee of the University of California (Los Angeles, CA) approved all studies, and all subjects gave informed consent.
Cell line determination
PCR-restriction fragment length polymorphism was performed on four human lymphocyte cell lines (DG75, Ramos 2G6, BL2, and CL-01) to determine wild-type, mutant-type, or heterozygous NQO1 polymorphism status (NQO1 C609T mutation). Briefly, the target PCR product of 266 bp was amplified by the sense primer 5'-GAATTGGTTGACTTACCTC-3' and the antisense primer 5'-TTTCTCCTCATCCTGTACCT-3'. The PCR products (20 µl) were digested with 5 U of HinfI restriction endonuclease at 37°C for 4 h (Fermentas Life Sciences) in a total volume of 25 µl, and the products were separated by electrophoresis on an ethidium bromide-stained 2.5% agarose gel. Mutation resulted in smaller fragments of 151 and 78 bp as compared with the wild-type allele (229 bp).
Cell culture, DEPX stimulation, and treatment
PBMCs, purified B cells, and B cell line DG75 were maintained in RPMI 1640 containing 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. The DG75 cell line was chosen because it contained the wild-type (functional) form of the NQO1 gene. Other B cell lines (Ramos 2G6, BL2, and CL-01) were observed to contain variant forms of NQO1, resulting in the nonproduction of fully functional NQO1. To examine the induction of NQO1 gene expression by DEPX, total 1 x 106 PBMCs or 3 x 106 DG75 cells were placed in 24-well plates or in 6-well plates overnight and stimulated by 2.5, 5.0, 10.0, or 20.0 µg of DEPX for 6 h for mRNA analysis or 16 h for protein assay. To investigate the effect of antioxidant NAC and kinase inhibitors on the induction of NQO1 by DEPX, the cells were preincubated with the appropriate concentration of NAC and kinase inhibitors of PD98059, LY294002, SB203580, and calphostin C for 2 h before stimulation with 20 µg of DEPX. After 6 or 16 h of incubation, the cells were collected for real-time quantitative PCR and Western blot assay. Controls were treated with DMSO at a final concentration of 0.1%. To test the effect of sulforaphane on IgE production, PBMCs were cultured at 1 x 106/ml and B cells at 0.5 x 106/ml. B cells (200 µl) were introduced into each well, and quadruplicates were used for each point in each experiment. Cultures were kept at 37°C and 5% CO2 for 14 days. Cells were cultured in the presence of 200 U/ml rIL-4 and anti-CD40 (0.1 µg/ml) with or without DEPX (100 ng/ml). Sulforaphane at 030 µM was added at the start of culture.
Cell RNA extraction and reverse transcription reaction
RNA was extracted from cells by the routine TRIzol method. RNase-free DNase (1 µl) was applied to eliminate genomic DNA contamination in a total volume of 10 µl containing 4 µg of total RNA. cDNAs were synthesized using DNase-treated total RNA (4 µg), 1x first stand buffer (diluted from 5x first strand buffer), 0.01M DTT, 0.5 mM each dNTP, 1 µM oligo(dT), 40 U of RNase inhibitor, and 200 U of Moloney murine leukemia virus reverse transcriptase (Invitrogen Life Sciences) in a 25-µl reaction mixture at 42°C for 2 h.
Real-time quantitative PCR assay
Real-time quantitative PCR (Q-PCR) was performed using the QuantiTect SYBR Green PCR kit (Qiagen) on an iCycler iQ real-time PCR detection system (Bio-Rad) according to manufacturers instruction. The primers for phase II enzymes used in Q-PCR are listed in Table I. The program was conducted under the following conditions. After the initial activation step at 95°C for 15 min, there were 40 cycles of denaturation at 94°C for 15 s and annealing at 60°C for 1 min followed by melting curve analysis consisting of one cycle at 95°C for 1 min, one cycle at 55°C for 1 min, and 80 cycles starting at 55°C with 0.5°C gradient accretion. Data were analyzed by iCycler iQ optical system software (version 3.0a). The average of three independent measurements was used to calculate the relative gene expression levels compared with GAPDH expression levels.
|
The cell pellets were lysed with 150 µl of radioimmune precipitation assay lysis buffer (1% Nonidet P-40, 0.5% sodium deoxycholate, 150 mM NaCl, 50 mM Tris-HCl (pH 7.5), 1 mM PMSF, 4 mM EDTA, 10 mM NaF, and 2 mM Na3VO4). Forty micrograms of total proteins was loaded for electrophoresis on 10% SDS-polyacrylamide gels and transferred to polyvinylidene difluoride membrane. The membrane was incubated with 1/2000 anti-NQO1 Ab for 1 h. After three washes with TBS, the membrane was incubated with 1/5000 anti-goat IgG for 1 h. An ECL (Amersham Biosciences) Western blot kit was used to detect the signals. The membrane was stripped by stripping buffer (2% SDS, 100 mM 2-ME, and 50 mM Tris (pH 6.8)) and reblocked by 5% nonfat milk for 3 h. The same membrane was incubated with 1/2000 anti-
-actin Ab for 1 h. After three washes, the membrane was incubated with 1/2500 secondary Ab.
-Actin was used as internal control of the NQO1 protein assay.
NQO1-ARE construction of plasmid
The NQO1 fragment of 362 bp containing ARE (AAATCGCAGTCACAGTGACTCAGCAGAATCTGAGCCTAGG) located in NQO1 promoter (from 477 to 438 upstream of the transcription start site) was amplified by the sense primer 5'-GGCGGCTAGCCCATTACCTGCCTTGAGGAG-3' with the NheI site and anti-sense primer 5'-GGCGCTCGAGCAAAAATCTGGCTGGGGGTG-3' with the XhoI site. The PCR product and the pGL3 luciferases reporter vectors were digested with the restriction endonuclease enzymes NheI and XhoI (New England Biolabs) at 37°C for 2 h. After purification of the digested PCR product and the pGL3 vector, the PCR product was cloned into NheI and XhoI sites of the pGL3 vectors by using T4 DNA ligase at 16°C overnight. The positive plasmid with NQO1-ARE was extracted and purified by a Qiagen plasmid midi kit.
Cell transfection and luciferase reporter assay
DG75 cells grew in RPMI 1640 and reached 1 x 106/ml concentration. The cells were centrifuged at 1100 rpm for 5 min and resuspended in the medium with 20% FBS. DG75 cells (5 x 106) in 400 µl of medium were cotransfected with 10 µg of the reporter plasmid containing NQO1-ARE and 50 ng of the control plasmid (Renilla) using an electroporator (Bio-Rad) with voltage set at 225 V and capacitance set at 975 µF. Cells were cultured in RPMI 1640 containing 10% FBS and were rested for 24 h before the addition of various stimuli. After treatment, the transfected cells were collected and lysed with the luciferase lysis buffer according to the manufacturers instruction. The Dual luciferase reporter assay kit and a Monolight 2010 luminometer (Analytical Luminescence Laboratory) were used to measure the luciferase activity.
IgH
germline transcription
The human B lymphoma cell line Ramos 2G6 was maintained in RPMI 1640 medium. PBMCs were isolated from healthy volunteers as described in the paragraph PBMC isolation and B cell purification above in this section. Total 2 x 106 Ramos 2G6 cells per well in 6-well plates and 5 x 106 PBMCs per well in 24-well plates were stimulated by various concentrations of DEPX extracts in the presence of IL4 (10 ng/ml) and anti-CD40 (5 µg/ml) for 3 days. The cells were collected for IgH
germline transcription assay. The primer pairs 5'-AGCTGTCCAGGAACCCGACAGGGAG-3' and 5'-GTTGATAGTCCCTGGGGTGTA-3' were used to amply the
germline transcripts (
GTs). GAPDH was used as an internal control.
IgE determination
IgE in the cultured PBMCs and purified B cells was measured by isotype-specific ELISA as previously described (23, 24). Briefly, microtiter plates were coated with mAbs to human IgE mAb, CIA-E-7.12 and CIA-E-4.15, at 2 µg/ml overnight. After washing, 100 µl of samples and standards were added for overnight incubation. After further washing of the detection Ab, alkaline phosphatase-labeled goat anti-IgE was added at 1/3000 (Kirkegaard & Perry Laboratories). Absorbance at 405 nm was read with an ELISA reader (Bio-Tek Instruments). Standard for IgE was the IgE myeloma protein PS. The sensitivity of the IgE assay was 0.2 ng/ml. All samples were run in quadruplicate.
| Results |
|---|
|
|
|---|
DEPX increased mRNA gene expression for NQO1 in both PBLs and the B lymphocyte cell line DG75. When PBMCs were cocultured with DEPX, a distinct dose-response relationship was observed by Q-PCR (Fig. 1). NQO1 expression was increased 12.6- and 16.3-fold over baseline in PBMCs from two individuals after stimulation with 20 µg/ml DEP. A similar dose-response induction in both mRNA and protein levels was observed in DG75 cells (Fig. 2, A and B).
|
|
The ARE is known to regulate the expression and coordinated induction of many detoxifying enzyme genes in responses to antioxidants and xenobiotics. DEPX could induce ARE activity in the NQO1 gene promoter. We cotransfected a reporter gene construct containing the ARE located in the NQO1 promoter and a control reporter gene, Renilla, into the DG75 B cell line. Stimulation of the cells with DEPX for 16 h resulted in a dose-dependent increase of ARE activity in these cells after 36 h of transfection (Fig. 3). A 5.07-fold increase was observed in NQO1 ARE activity induced by 20 µg/ml DEPX compared with control using DMSO.
|
ROS generated by DEP was shown to be involved in multiple DEP-induced kinase activation. The antioxidant NAC is a thiol-reducing agent that can antagonize cellular ROS (25) and block DEP-induced enhanced IgE production in vivo in mice (26). We therefore examined the regulatory role of the cellular redox state in DEP-induced NQO1 gene expression. DG75 B cells were pretreated with 20 µM NAC or control for 2 h and then stimulated with 20 µg/ml DEPX. We observed that whereas ARE activity was partially blocked by NAC (Fig. 4A), induction of mRNA and protein by DEPX was greatly suppressed by NAC (Fig. 4, B and C).
|
|
germline transcription enhanced by DEPX
IgH
germline transcription is required for IgE class switch recombination. Class switch recombination is essential for IgE production. The mechanism of IgE production by DEPX is still not clear. In this study, we examined whether the production of the IgH
germline transcripts was affected by DEPX. Ramos 2G6 cells and PBMCs were stimulated with DEPX at various doses in the presence of IL-4 and anti-CD 40. The spontaneous IgH
germline transcription occurred in Ramos 2G6 cells and PBMCs. The
GTs could be detected in the cells without IL-4 and anti-CD40, but the level was relatively low. The result of Q-PCR showed the DEPX enhanced
GT production in both the B cell line and PBMCs in a dose-response manner (Fig. 6).
|
DEPX can act directly on B cells to increase IgE production. If production of phase II enzymes such as NQO1 is indeed a cytoprotective mechanism, we reasoned that high-level induction of these enzymes should ablate the effect of DEPX. Therefore, we stimulated primary B cells or PBMC with IL-4, anti-CD40, and DEPX in the presence or absence of sulforaphane, a potent phase II inducer. As expected, after 14 days the cells cocultured with DEP-extract had IgE levels 200600% higher than those cultured with IL-4/anti-CD40 alone. Fig. 7 demonstrates that the addition of sulforaphane to B cells resulted in a dose-dependent inhibition of DEP-induced IgE potentiation. At concentrations of sulforaphane of 6 µM and higher, IgE levels from cells stimulated without DEPX and those with DEPX were indistinguishable. The addition of sulforaphane in the B cell line Ramos 2G6 and in PBMCs resulted in increased gene expression of the sentinel phase II enzyme NQO1, and the induction of mRNA levels of the other enzymes such as GSTM1 and GSTP1 was also observed (Table II). No cytotoxicity was observed at any of the concentrations used (data not shown). Similar results were observed with PBMCs (data not shown).
|
|
| Discussion |
|---|
|
|
|---|
DEPs are model particulate pollutants. Both human and animal models have demonstrated that they can exacerbate allergic airway disease (5, 6, 7). In addition, they can also promote de novo allergic sensitization to a neoallergen. In both of these primary and secondary allergic responses IgE is thought to play a critical role. DEP can stimulate IgE production both directly by interacting with an allergen to enhance isotype switching to IgE and indirectly by promoting a Th2 cytokine milieu that favors IgE. Both pathways have been demonstrated in vivo in humans and mice (12, 28, 29, 30). Although the precise mechanisms by which particles such as DEPs mediate their effects are still not fully elaborated, it seems that the principal determinant is the ability to generate ROS and oxidative stress (31). The biological consequences of oxidative stress on the airways include activation of redox-sensitive transcription factors such as MAPK and NF
B, which have been shown to regulate IgE isotype switching (32, 33). In this study we examined the effect of DEPX on the expression of
GTs (Fig. 6). We show that DEPX can directly enhance germline transcription in B cells, a necessary step required for the Sµ-S
class recombination switch that is essential for IgE production. Although it is possible that other mechanisms may also be involved, it is likely that diesel exhaust can augment allergic responses by directly targeting B cells to increase production of
germline transcripts.
DEP consists of a complex structure characterized by a carbon core absorbed with organic chemicals including quinones and polycyclic aromatic hydrocarbons. Polycyclic aromatic hydrocarbon metabolism induced by phase I drug-metabolizing enzymes produces electrophilic reactive metabolites, including ROS. Quinones can directly induce oxidative stress by redox cycling and are suspected of being responsible for the production of O ![]()
Both population-based and experimental challenge studies have suggested that phase II enzymes could be involved in defense against pollution-induced allergic airway disease (20, 36). Individuals with polymorphisms in genes of key phase II enzymes that result in the absence or reduction of the protein are more susceptible to the adjuvant effects of oxidant pollutants (37, 38). For example, we have shown that IgE production in response to nasal challenge with DEPX plus allergen is >10-fold higher in GSTM1-null vs GSTM1-present subjects. In this study we have used NQO1 as a model phase II enzyme. Detoxification of quinones by NQO1 results in the formation of stable hydroquinones that can be readily conjugated and excreted.
In this study we show that the dose-dependent increase of NQO1 mRNA and protein expression in B lymphocytes is via ARE mediation and that p38 and PI3K, but not protein kinase C or the MEK/ERK pathways, are involved in this induction. The role of kinase pathways involved in NQO1 gene expression is controversial. However, our results agree with previous reports in IMR-32 human neuroblastoma cells showing that activation of the human NQO1-ARE by tert-butylhydroquinone is mediated by PI3K, not MEK/ERK (39). Jaiswal and coworkers (40, 41) identified ARE located in the NQO1 promoter (477 to 438) from the transcription start site. ARE is known to regulate the expression and coordinated induction of many detoxifying enzyme genes including NQO1 (19, 42), GST Ya subunit (43), and heme oxygenase-1 (44). The ARE is thus a transcriptional regulatory element that is widely distributed and protects against chemical-induced electrophile and oxidative toxicity through the expression of phase II conjugating enzymes. Several nuclear proteins have been shown to bind to the ARE either as homodimers or heterodimers. Analysis of ARE-nuclear protein complexes revealed a number of nuclear transcription factors including c-Jun, Jun-B, Jun-D, c-Fos, Fra1, Nrf1, Nrf2, and the small Maf protein had been shown to bind the human NQO1 gene ARE (16, 45, 46). There are several reports that NQO1 induction by tert-butylhydroquinone (a quinone and a phenolic antioxidant) is mediated through ARE by the Nrf2 transcription factor activation (47). NQO1 up-regulation induced by DEPX in human airway epithelial cells is most likely through the stress-sensitive Nrf2. DEPX can induce the translocation of Nrf2 to the nucleus and increase protein nuclear binding to the ARE, thereby leading to induction of antioxidant genes expression.
Xiao et al. (48) have suggested that in respiratory tract tissues and cells the biological response to oxidative stress is a hierarchical process in which the induction of the antioxidant effects of phase II enzymes is in competition with the pathways that generate allergic inflammation. In this work we have made use of the potent Nrf2 activator sulforaphane. Originally isolated from cruciferous vegetables, sulforaphane is the most powerful inducer of phase II enzymes identified to date (49, 50, 51, 52). Preculture of B cells or PBMCs with sulforaphane significantly inhibited DEPX-induced IgE production. These results support our view that production of phase II enzymes is the primary defense mechanism of the body against the proallergenic effects of oxidant pollutants. Both in vivo and in vitro DEPX has been shown to target multiple cell types including airway epithelial cells and alveolar macrophages. Currently, studies are underway to determine whether phase II enzyme induction in these cells and in animal models will also ablate the effects of DEPX.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grant P01 AI050495 and Environmental Protection Agency Grant ES-03-004. ![]()
2 Address correspondence and reprint requests to Dr. David Diaz-Sanchez, Division of Clinical Immunology and Allergy, Department of Medicine, UCLA School of Medicine, University of California, Los Angeles, CA 90095. E-mail address: ddiazsa{at}mednet.ucla.edu ![]()
3 Abbreviations used in this paper: DEP, diesel exhaust particle; DEPX, DEP extract; ARE, antioxidant response element; Nrf2, NF E2 p45-related factor-2; NAC, N-acetylcysteine; NQO1, NAD(P)H:quinone oxidoreductase 1; ROS, reactive oxygen species; GSTM1, GST µ1; Q-PCR, quantitative PCR;
GT,
germline transcript. ![]()
Received for publication February 7, 2006. Accepted for publication June 14, 2006.
| References |
|---|
|
|
|---|
B-dependent pathway. Am. J. Physiol. 284: L1055-L1062.
-globin gene locus. Proc. Natl. Acad. Sci. USA 88: 10188-10192. Related articles in The JI:
This article has been cited by other articles:
![]() |
F. D. Gilliland Outdoor Air Pollution, Genetic Susceptibility, and Asthma Management: Opportunities for Intervention to Reduce the Burden of Asthma Pediatrics, March 1, 2009; 123(Supplement_3): S168 - S173. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |