The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thammavongsa, V.
Right arrow Articles by Raghavan, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thammavongsa, V.
Right arrow Articles by Raghavan, M.
Right arrowPubmed/NCBI databases
*Substance via MeSH
*Genetics Home Reference
The Journal of Immunology, 2006, 177: 3150-3161.
Copyright © 2006 by The American Association of Immunologists, Inc.

HLA-B44 Polymorphisms at Position 116 of the Heavy Chain Influence TAP Complex Binding via an Effect on Peptide Occupancy1

Vilasack Thammavongsa{dagger}, Gayatri Raghuraman*, Tracy M. Filzen*, Kathleen L. Collins* and Malini Raghavan2,*

* Department of Microbiology and Immunology and {dagger} Graduate Program in Immunology, University of Michigan Medical School, Ann Arbor, MI 48109-0620


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
A single residue polymorphism distinguishes HLA-B*4402(D116) from HLA-B*4405(Y116), which was suggested to allow HLA-B*4405 to acquire peptides without binding to tapasin-TAP complexes. We show that HLA-B*4405 is not inherently unable to associate with tapasin-TAP complexes. Under conditions of peptide deficiency, both allotypes bound efficiently to TAP and tapasin, and furthermore, random nonamer peptides conferred higher thermostability to HLA-B*4405 than to HLA-B*4402. Correspondingly, under conditions of peptide sufficiency, more rapid peptide-loading, dissociation from TAP complexes, and endoplasmic reticulum exit were observed for HLA-B*4405, whereas HLA-B*4402 showed greater endoplasmic reticulum retention and enhanced tapasin-TAP binding. Together, these studies suggest that position 116 HLA polymorphisms influence peptide occupancy, which in turn determines binding to tapasin and TAP. Relative to HLA-B*4405, inefficient peptide loading of HLA-B*4402 is likely to underlie its stronger tapasin dependence for cell surface expression and thermostability, and its enhanced susceptibility to pathogen interference strategies.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The MHC class I Ag presentation pathway plays a vital role in immune surveillance mediated by CTLs. MHC class I molecules comprise a membrane-linked H chain (46 kDa), a soluble L chain (beta2-microglobulin (beta2m)3), and a short peptide. The peptide is typically derived from the cytosol, and the function of the TAP is required for translocation of cytosolic peptides into the endoplasmic reticulum (ER). During assembly in the ER, MHC class I molecules are transiently associated with TAP, in an interaction that is bridged by the ER resident protein tapasin (1). This complex also contains other generic ER chaperones, including calreticulin and the thiol-disulfide isomerase ERp57. TAP, tapasin, calreticulin, and ERp57 have been suggested to constitute a "MHC class I peptide-loading complex" (2). Tapasin is required for MHC class I binding to the TAP transporter (1). Tapasin enhances MHC class I assembly by enhancing TAP expression and function (3, 4). Additionally, tapasin may function in ER retention of peptide-deficient MHC class I molecules (5, 6), and may also function in editing/optimizing the class I peptide repertoire (7), or in facilitating peptide loading (8, 9, 10). MHC class I allotypes differ in the extent of TAP-tapasin binding as well as in the requirement for tapasin for high cell surface expression. Tapasin strongly enhances cell surface expression of some human MHC class I allotypes, whereas surface expression of other allotypes is relatively unaffected by tapasin (7, 11, 12, 13). These allotypes have been classified as tapasin dependent or tapasin independent, respectively.

HLA-B*4402(D116) and HLA-B*4405(Y116) differ at a single residue in their sequences, at position 116 of the H chain. Residue 116 is located at the base of the F pocket of the peptide-binding groove of MHC class I molecules, thereby contributing to peptide binding and selection. A recent study showed that binding of HLA-B*4405 to TAP was not detectable during HLA-B*4405 assembly in B lymphoblastoid cell lines, whereas HLA-B*4402 is strongly associated with TAP (13). Other studies have also shown correlations between polymorphisms at position 116 and the extent of interactions of class I allotypes with tapasin-TAP complexes (14, 15). An unanswered question in these studies is how position 116 affects tapasin-TAP binding by MHC class I allotypes. As previously suggested, direct binding of tapasin to the class I peptide-binding groove could account for the effect of position 116 polymorphisms upon the class I-TAP interaction, or alternatively, the polymorphisms could affect peptide binding, which in turn could determine interactions with the tapasin-TAP complex (7, 13, 15, 16, 17). Recent studies have indicated that, compared with HLA-B*4405, viral inhibitors of Ag presentation more profoundly influence HLA-B*4402 expression (13, 18), and additionally that HLA-B*4402 is also more tapasin-dependent for its surface expression compared with HLA-B*4405 (7, 13). It was our hypothesis that enhanced tapasin dependence and TAP complex binding of HLA-B*4402, and the high degree of susceptibility of HLA-B*4402 to viral interference strategies were all interrelated and linked to inefficient peptide loading by HLA-B*4402. In support of this possibility, tapasin is thought to interact with empty but not peptide-loaded MHC class I molecules (5), and MHC class I molecules have been shown to dissociate from TAP complexes upon peptide loading (19, 20, 21). In the studies described, we examined HLA-B*44-tapasin-TAP interactions under conditions of peptide deficiency or sufficiency. These studies revealed that HLA-B*4402 and HLA-B*4405 do not differ in their inherent abilities to bind tapasin-TAP complexes, or in their modes of Ag presentation, but rather differ in their efficiencies of peptide loading. The results provide insights into the molecular basis for enhanced binding of HLA-B*4402 to the tapasin-TAP complex, and also the likely molecular basis for the strong tapasin dependence of HLA-B*4402, and its enhanced susceptibility to viral interference strategies.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Cell lines

CEM cells were grown in RPMI 1640 (Invitrogen Life Technologies) supplemented with 10% FBS, penicillin, and streptomycin. SK-MEL-19 (SK19) cells (22) were maintained in DMEM (Invitrogen Life Technologies) supplemented with 10% FBS, penicillin, and streptomycin. SK19 cells expressing wild-type or mutant TAP1 (23) were maintained in DMEM supplemented with 10% FBS, penicillin and streptomycin, and 500 µg/ml hygromycin. Insect Sf21 cells were maintained in Grace’s insect medium (Invitrogen Life Technologies) supplemented with 10% FBS and 500 µg/ml gentamicin (Invitrogen Life Technologies).

DNA constructs and viruses

Baculovirus constructs. Baculovirus constructs encoding tapasin, histidine-tagged TAP1/TAP2 in a single virus obtained from Dr. R. Gaudet (Department of Molecular and Cellular Biology, Harvard University, Cambridge, MA), and HLA-B*4402/beta2m have been previously described (24, 25). HLA-B*4405 (HLA-B*4402(D116Y)) was obtained by site-directed mutagenesis of HLA-B*4402-pAcUW31/beta2m using the Stratagene QuikChange Site-Directed Mutagenesis kit. The following PCR primers were used, which included silent mutations to introduce restriction sites for mutant screening: B*4405, 5' primer CGCGGGTATGAC CAGTACGCATATGACGGCAAG and 3' primer CTTGCCGTCATATGCGTACTGGTCA TACCCGCG. DNA sequences encoding B*4405 were sequenced, excised with BamHI, and religated into pAcUW31/beta2m. Viruses were generated using the BaculoGold kit (BD Pharmingen).

Retroviral constructs. For retroviral constructs encoding hemagglutinin (HA)-tagged HLA-B*44, HLA-B*4402, and HLA-B*4405 from the pAcUW31 vector were digested with NaeI and BamHI. A separate construct encoding the signal sequence and HA epitope tag was purified following EcoRI and NaeI digestion of the murine stem cell virus MSCV 2.1 vector encoding HA-tagged HLA-B*3501 (26). The two sequences were ligated into MSCV 2.1 that had been digested with EcoRI and BglII. The constructs encode class I H chains with a GSYPYDVPDYA insertion at the amino terminus of the mature protein. Viruses were generated as previously described (26) using Bosc cells, and used to infect TAP1-deficient SK19 cells (22), SK19 cells expressing wild-type TAP1 or mutant TAP1 (23), and CEM cells. Cells transduced with retroviruses encoding HLA-B*44 were selected by treatment with 1 mg/ml G418 disulfate (Sigma-Aldrich), and maintained in 0.5 mg/ml G418 disulfate. To generate a retroviral construct encoding tapasin, the tapasin open reading frame was amplified by PCR (5'-GGAAGATCTACCATGAAGTCCCTGTCTCTGCTC-3'; 5'-CCGATATCTCACTCTGCTTTCTTCTTTGA-3'), digested with EcoRV and BglII, and cloned into pMSCVpuro digested with HpaI and BglII. Retroviral supernatant was generated using Bosc cells. CEM cells transduced with the tapasin retrovirus were selected by treatment with 1 mg/ml puromycin, and cells were maintained in 0.5 mg/ml puromycin.

FACS analysis to assess class I cell surface expression and thermostability

A total of 2 x 106 cells was washed three times with PBS containing 1% FBS. Cells were then incubated with anti-HA ascites (Covance Scientific) at a 1/250 dilution for 1 h on ice. Following this incubation, cells were washed three times with PBS with 1% FBS. Cells were then incubated for 1 h on ice with FITC-conjugated goat anti-mouse IgG (The Jackson Laboratory) at 1/250 dilution, followed by washing three times with PBS with 1% FBS. Cells were then analyzed using a BD Biosciences FACSCalibur cytometer and the CellQuest software. For analysis of cell surface thermostability, cells were incubated at the indicated temperatures for 10 min, and immediately put on ice before staining with W6/32 ascites fluid (a human MHC class I heterodimer-specific Ab) (27), which was conducted as described for anti-HA staining.

Assessment of interactions of tapasin-TAP with class I molecules

CEM cells. A total of 25 x 106 CEM cells expressing HLA-B*4402 and HLA-B*4405 was lysed in 10 mM Tris, 10 mM phosphate, 130 mM NaCl, 1% digitonin (pH 7.5), and protease inhibitors. Lysates were incubated overnight with anti-TAP1 antisera obtained from Dr. M. Androlewicz (H Lee Moffitt Cancer Center and Research Institute, Tampa, FL) or PaSta-1 ascites (Ab-directed toward tapasin obtained from Dr. P. Cresswell (Yale University School of Medicine, New Haven, CT) (28). Ab-protein complexes were recovered by incubation with protein G beads for 1 h, and beads were then washed with 10 mM Tris, 10 mM phosphate, 130 mM NaCl, and 0.1% digitonin (pH 7.5). Lysates or immunoprecipitates were separated by 10% SDS-PAGE and transferred to polyvinylidene difluoride membranes. MHC class I H chains were detected using anti-HA ascites (Covance Scientific) and the ECLplus chemiluminescence kit (Amersham Biosciences).

Detection of class I-TAP complexes as a function of time. A total of 80 x 106 CEM cells expressing HLA-B*4402 and HLA-B*4405 was resuspended in 3 ml of DMEM deficient in methionine/cysteine and incubated at 37°C for 45 min. Cells were metabolically labeled with 0.2 mCi [35S]methionine/cysteine for an additional 10 min. Following the labeling, cells were separated into equal aliquots and either placed on ice or incubated with fresh medium for an additional 2 h at 37°C. Lysates were prepared as described using 1% digitonin and were subsequently split into equal aliquots and incubated with anti-TAP1 antisera or anti-HA ascites for 2 h at 4°C. Ab-protein complexes were recovered as described. To detect HLA-B*44 in complex with TAP, washed anti-TAP1 immunoprecipitates were boiled for 5 min in 100 µl of dissociation buffer (1% SDS, 5 mM DTT, 10 mM Tris, and 150 mM NaCl (pH 7.4)) before diluting with 1 ml of 1% Triton X-100, 10 mM iodoacetamide, 10 mM Tris, and 150 mM NaCl (pH 7.4). Beads were centrifuged and supernatants used in secondary immunoprecipitations with anti-HA ascites. Samples were separated by SDS-PAGE before phosphorimaging analyses. Bands were quantified using ImageQuant software (Amersham Biosciences).

SK19 cells. SK19 cells expressing or lacking HLA-B*44 grown to confluency in T-75 flasks were detached with 0.25% trypsin-EDTA, resuspended in 3 ml of DMEM deficient in methionine/cysteine, and incubated at 37°C for 30 min. Detached cells were metabolically labeled with 0.2 mCi [35S]methionine/cysteine for 30 min, and lysed as described for CEM cells. Lysates were split into equal aliquots and immunoprecipitated with anti-HA or PaSta-1 as previously described for CEM cells. Proteins contained in the PaSta-1 immunoprecipitates were dissociated in 1% SDS, followed by a secondary immunoprecipitation with anti-HA. Proteins contained in primary (anti-HA) and secondary (PaSta-1 followed by anti-HA) immunoprecipitates were separated by SDS-PAGE and visualized by phosphorimaging analyses. Bands were quantified using ImageQuant software (Amersham Biosciences).

SK19 cells coexpressing functional (wild-type) or nonfunctional (mutant G646D) TAP1 with HLA-B*44 were grown to confluency in T-150 flasks. Immunoprecipitation analyses with anti-TAP1 antisera were conducted as described for CEM cells. TAP-associated HLA-B*44 was detected by immunoblotting analyses with anti-HA.

Insect cells. For immunoblotting analyses, 1 x 106 sf21 insect cells were cultured in 6-well plates for 24 h, and then coinfected with the desired baculoviruses. Multiplicity of infection (MOI) values were previously optimized to obtain desired protein expression levels. At 36 h postinfection, cells were lysed in 1% digitonin lysis buffer (10 mM Tris, 10 mM phosphate, and 130 mM NaCl (pH 7.5), protease inhibitors). Additionally, 5 mM MgCl2 was present for analysis with ADP-agarose beads. Lysates were incubated for 1 h with preswollen ADP-agarose beads (Sigma-Aldrich). Beads were washed with 0.25% digitonin wash buffer six times and separated by SDS-PAGE. Proteins were transferred to polyvinylidene difluoride membranes, and class I complexes were detected by immunoblotting with the HC10 Ab that detects free class I H chains (29) and visualized with the ECL kit (Pierce). Proteins in lysates were detected using an anti-tapasin antiserum generated against an N-terminal peptide of tapasin obtained from Dr. T. Hansen (Washington University School of Medicine, St. Louis, MO), anti-histidine (Covance Scientific) for TAP1 detection, or HC10 Ab, for class I H chain detection.

For metabolic labeling, 2 x 106 sf21 cells were infected with baculoviruses at preoptimized MOI values. At 36 h postinfection, cells were metabolically labeled and lysed, as previously described (24), in buffer containing 1% Triton X-100. Lysates were incubated with HC10 or control Abs, then protein G beads. A stringent wash buffer (10 mM phosphate buffer, 10 mM Tris, 130 mM NaCl, 0.5% Triton X-100 (pH 7.5), containing 0.25% gelatin) was used before SDS-PAGE, and phosphorimaging analyses. All quantifications were performed using ImageQuant software.

Thermostability assessments in mammalian cells. A total of 4 x 107 CEM cells expressing HLA-B*4402 and HLA-B*4405 or cells from confluent T-150 flasks of SK19 cells expressing or lacking HLA-B*44 was incubated for 30 min in DMEM (lacking methionine/cysteine). Cells were metabolically labeled with 0.2 mCi [35S]methionine/cysteine for 10 min, lysed in 1% Triton X-100 lysis buffer (10 mM Tris, 10 mM phosphate, 130 mM NaCl (pH 7.5), and protease inhibitors) and split into two equal aliquots. One aliquot was incubated at 37°C for 12 min while the other was left on ice. Sequential immunoprecipitations were conducted with W6/32 (primary) and anti-HA ascites (secondary) as described. Following SDS-PAGE, H chain bands recovered under each condition were visualized by phosphorimaging analyses and quantified using ImageQuant.

Thermostability assessments in insect cells. A total of 2 x 106 sf21 cells were infected for 36 h, following which cells was metabolically labeled with 0.2 mCi [35S]methionine/cysteine for 15 min, and lysed as described in the presence or absence of indicated peptides (100–200 µM). Lysates were centrifuged and incubated at either 4°C or 37°C for 12 min, followed by incubation with W6/32 Ab for 1 h, then protein G beads for 1 h. Beads were washed three times with wash buffer containing 0.5% Triton X-100. Proteins were separated by 10% SDS-PAGE, dried, and exposed to a phosphor imager screen. The intensity unit of each H chain signal was quantified using ImageQuant and used for the indicated thermostability assessments.

Endoglycosidase H sensitivity and trafficking rate assessments

To assess the efficiency of MHC class I transport into the medial Golgi compartment, 2 x 106 SK19 cells or 10 x 106 CEM cells expressing the indicated class I molecules were harvested and lysed in 1% Triton X-100 lysis buffer. The lysates were split into two equal aliquots and one of the aliquots was digested with endoglycosidase H (Endo-H) according to the manufacturer’s protocol (New England Biolabs), and based on previously published protocols (30). Proteins were separated by SDS-PAGE, immunoblotted with anti-HA ascites and visualized by the ECLplus chemiluminescence kit. For pulse-chase analyses in CEM cells, 8 x 107 CEM cells were pulsed with 0.2 mCi [35S]methionine/cysteine, followed by incubation with RPMI 1640 medium complete with methionine/cysteine for the indicated time. Cells were lysed in 1% Triton X-100 lysis buffer, and lysates were immunoprecipitated with anti-HA ascites. Immunoprecipitated proteins were split into two equal aliquots, and one of the aliquots was digested with Endo-H as previously described (31). Proteins were separated by SDS-PAGE. Gels were dried and exposed to a phosphorimaging cassette.

Cell surface stability assay

A total of 1.6 x 107 CEM cells expressing HLA-B*4402 and HLA-B*4405 was collected and washed two times with PBS. Cells were then resuspended in 6 ml of biotin-labeling buffer (0.5 mg of EZ-Link sulfo-NHS-LC-biotin (Pierce)/1 ml PBS (pH 7.0)) and incubated at 37°C for 1 h. Cells were then washed three times with PBS plus 50 mM glycine to quench and remove any excess biotin reagent and then lysed in 4 ml of 1% Triton X-100 lysis buffer (10 mM Tris, 10 mM phosphate, and 130 mM NaCl (pH 7.5), protease inhibitors). Lysates were centrifuged, separated into equal aliquots, and incubated at either 4, 45, 50, or 60°C for 12 min, followed by incubation with W6/32 Ab for 1 h, then protein G beads for 1 h. Beads were washed three times with wash buffer containing 0.5% Triton X-100. Proteins were eluted by boiling in the presence of 1% SDS for 5 min. Supernatants were diluted into buffer containing 1% Triton X-100, and then incubated with 30 µl of prewashed immobilized avidin-agarose beads (Pierce) overnight at 4°C. Beads were then washed three times with wash buffer containing 0.5% Triton X-100. Proteins were separated by 10% SDS-PAGE and immunoblotting analysis conducted with anti-HA Ab.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Compared with HLA-B*4405, HLA-B*4402 shows enhanced Endo-H sensitivity, enhanced TAP-tapasin binding, and reduced thermostability when expressed in CEM cells

CEM T cell lines expressing HLA-B*4402 and HLA-B*4405 with N-terminal HA tags were generated following infection of cells with corresponding retroviral constructs. Flow cytometric comparisons of HA-tagged HLA-B*4402 and HLA-B*4405 surface expression revealed ~2- to 3-fold lower mean fluorescence for HLA-B*4402 compared with HLA-B*4405 (Fig. 1A). The HLA-B*4402 cells were then sorted so as to obtain similar surface levels of HLA-B*4402 and HLA-B*4405, and sorted cells were used for further analyses in the initial set of experiments.


Figure 1
View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 1. HLA-B*4402 shows enhanced retention in the ER, where it is found in association with the TAP-tapasin complex. A, Flow cytometric analyses of CEM cells, CEM-HLA-B*4402 (sorted and unsorted), or HLA-B*4405, following staining of cells with anti-HA and FITC-conjugated secondary Abs. Mean fluorescence values: CEM = 1.93, CEM-B*4402 (unsorted) = 19.8, CEM-B*4402 (sorted) = 31.08, CEM-B*4405 = 35.06. B, Lysates from CEM cells expressing the indicated HLA-B*44, or uninfected CEM cells were directly analyzed (top), or proteins in lysates were first immunoprecipitated with anti-tapasin (PaSta-1) Ab (middle), or anti-TAP1 antisera (bottom). Indicated samples were separated by SDS-PAGE, and immunoblotting analyses were undertaken with anti-HA. Data are representative of three independent sets of analyses. C, CEM cells expressing HLA-B*4402, HLA-B*4405, or HLA-B*4402 and human tapasin were metabolically labeled for 10–15 min and lysed. Lysates were incubated at 4°C or 37°C for 12 min, followed by sequential immunoprecipitation analyses with primary W6/32 and secondary anti-HA Abs. Samples were separated by SDS-PAGE and proteins visualized by phosphorimaging analyses. H chain quantification is the average of three to five independent analyses with error bars representing the SEM. D, CEM cells were metabolically labeled for 10 min and chased for the indicated times in fresh media. Lysates were immunoprecipitated with anti-HA, then digested with Endo-H or left undigested, and analyzed by SDS-PAGE and phosphorimaging analyses. Sorted CEM-HLA-B*4402 cells compared with CEM-HLA-B*4405 (top). Unsorted CEM-HLA-B*4402 cells compared with CEM-HLA-B*4405 (bottom). Data at top are representative of two analyses and at bottom from one analysis. E, Lysates from CEM cells expressing HLA-B*4402, HLA-B*4405, or HLA-B*4402 and tapasin as indicated were digested with Endo-H (lanes 2, 4, and 6) or left undigested (lanes 1, 3, 5, and 7–9) and immunoblotting analyses were undertaken with anti-HA (lanes 1–6) or anti-tapasin (lanes 7–9). Blots are representative of five independent analyses (lanes 1–6) or a single analysis (lanes 7–9).

 
We first investigated whether there were differences in the association of HLA-B*4402 and HLA-B*4405 with tapasin and TAP as previously shown in other human cell lines (13). Lysates from an equal number of CEM cells expressing similar steady-state levels of HLA-B*4402 and HLA-B*4405 were immunoprecipitated with the PaSta-1 (anti-tapasin) Ab or anti-TAP1 antisera, followed by immunoblotting with anti-HA. Indeed, compared with HLA-B*4405, significantly higher binding of HLA-B*4402 to tapasin was observed (Fig. 1B, lane 2). HLA-B*4405 was detectable at low levels in immunoprecipitations with anti-tapasin, but not visualized in immunoprecipitations with anti-TAP (Fig. 1B, lane 3). It is likely that a given difference in tapasin binding is amplified to a greater difference in TAP binding, given tapasin’s function as a bridge between class I molecules and the TAP transporter (1).

To compare peptide occupancies of HLA-B*4402 and HLA-B*4405 expressed in CEM cells at early time points postsynthesis, thermostabilities of HLA-B*4402 and HLA-B*4405 heterodimers were assessed by immunoprecipitation analyses with W6/32 (a conformation and heterodimer-specific Ab), following incubations of cell lysates at 37°C or 4°C (7). The amounts of HLA-B*4402 or HLA-B*4405 H chains were quantified using secondary immunoprecipitations with anti-HA-specific Ab. The thermostability of MHC class I H chains is strongly correlated with peptide occupancy (32). At early time points postsynthesis (within 15 min), lower thermostability was observed for HLA-B*4402 compared with HLA-B*4405 (Fig. 1C; lane 2 compared with lane 1 and lane 4 compared with lane 3). This observation suggested that HLA-B*4405 molecules were becoming peptide loaded more rapidly or efficiently compared with HLA-B*4402. Correspondingly, in CEM cells, HLA-B*4405 trafficked to post-ER compartments more rapidly than did HLA-B*4402, as assessed by the acquisition of Endo-H resistance of metabolically labeled proteins as a function of time, in a pulse-chase experiment (Fig. 1D). HLA-B*4405 was largely Endo-H-resistant after 1 h, whereas a high percentage of HLA-B*4402 was still Endo-H-sensitive even 2 h after the pulse, indicating inefficient or slower transport of HLA-B*4402 from the ER. Correlating with this result, under steady-state conditions, the majority of HLA-B*4402 was Endo-H-sensitive, whereas HLA-B*4405 was almost completely Endo-H-resistant (Fig. 1E, lane 4 compared with lane 2). Reduced rate of trafficking of HLA-B*4402 compared with HLA-B*4405 has also previously been described in other cell types (33).

The data in Fig. 1, B–E, were obtained with sorted cells (for HLA-B*4402). Sorting resulted in similar cell surface expression of HLA-B*4402 and HLA-B*4405 (Fig. 1A) and in similar steady-state protein expression in lysates (Fig. 1B, lane 2 compared with lane 3). However, the metabolic labeling analyses revealed that the sorted HLA-B*4402 cells synthesized more HLA-B*4402 compared with HLA-B*4405 (Fig. 1D), to compensate for inefficient peptide loading and ER exit, and achieve similar cell surface expression of HLA-B*4405 and HLA-B*4402. It is likely that some of the unassembled HLA-B*4402 is being degraded. When the analyses shown in Fig. 1D were repeated comparing unsorted HLA-B*4402 to HLA-B*4405, reduced rate of HLA-B*4402 transport (compared with HLA-B*4405) was still observed, indicating that HLA-B*4402 overexpression in the sorted cells is not the basis for its inefficient assembly (Fig. 1D). Furthermore, no significant difference in TAP-tapasin binding was observed in sorted compared with unsorted cells (data not shown). As a result, CEM cells sorted for similar levels of cell surface expression were used for the remainder of the analyses in this study.

Tapasin overexpression does not significantly enhance thermostability of HLA-B*4402 in CEM cells

HLA-B*4402 is highly tapasin dependent for its cell surface expression (7, 11, 12, 13), which brought up a possibility that the endogenous cellular tapasin was insufficient to adequately facilitate HLA-B*4402 assembly, when B*4402 was overexpressed in CEM cells. To examine this question further, the sorted CEM cells expressing HLA-B*4402 were infected with a retrovirus expressing full-length human tapasin. Tapasin overexpression was verified by immunoblotting analyses (Fig. 1E, lane 8 compared with lanes 7 and 9). When the Endo-H sensitivity of HLA-B*4402 was measured, there was no significant enhancement in the percentage Endo-H-resistant HLA-B*4402 molecules in cells that overexpressed tapasin (Fig. 1E, lane 2 compared with lane 6). Furthermore, the thermostability of newly synthesized HLA-B*4402 molecules in cells overexpressing tapasin also was not significantly enhanced relative to that of HLA-B*4402 from cells that did not overexpress tapasin (Fig. 1C), and additionally, cell surface expression of HLA-B*4402 was not significantly altered (data not shown). Thus, tapasin overexpression does not significantly enhance the efficiency of HLA-B*4402-peptide assembly in CEM cells, confirming that tapasin is not the factor that limits assembly of HLA-B*4402-peptide complexes in CEM cells.

Compared with HLA-B*4402-TAP complexes, HLA-B*4405-TAP complexes dissociate more rapidly in CEM cells

Under steady-state conditions, HLA-B*4405-TAP complexes were not observable by immunoblotting analyses of anti-TAP1 immunoprecipitated complexes (Fig. 1B), consistent with a previous report (13). Two possibilities could explain these observations. It is possible 1) that HLA-B*4405 was impaired for TAP binding and 2) that HLA-B*4405 did associate with TAP, but did so more transiently compared with HLA-B*4402. To examine these two possibilities, we metabolically labeled CEM cells expressing HLA-B*4402 and HLA-B*4405, chased with fresh media for 2 h, and quantified HLA-B*44-TAP complexes. Endo-H sensitivity of HLA-B*44 was simultaneously quantified to correlate TAP binding with ER residency. As with the previous pulse-chase analyses (Fig. 1), Fig. 2A, top, shows that both class I proteins were Endo-H sensitive at early time points postsynthesis. By 2 h, HLA-B*4405 was almost completely Endo-H resistant, whereas the majority of HLA-B*4402 was Endo-H sensitive. Correspondingly, HLA-B*4405-TAP complexes were detectable immediately after labeling, although the signal was reduced relative to that for HLA-B*4402-TAP complexes. Correlating with the more rapid maturation of HLA-B*4405, HLA-B*4405-TAP complexes were not significantly observable after 2 h, whereas detection of HLA-B*4402-TAP complexes did not significantly decrease over this time frame (Fig. 2B). These results suggest that HLA-B*4405 indeed associates with TAP, and that the inability to detect HLA-B*4405-TAP complexes under steady-state conditions is probably due to more efficient peptide loading of HLA-B*4405, which resulted in rapid ER exit, and a net reduction in the amount of TAP-associated protein.


Figure 2
View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 2. HLA-B*4405 dissociates from the TAP complex more rapidly than HLA-B*4402. A, Uninfected CEM cells or cells expressing the indicated HLA-B*44 molecules (top) were metabolically labeled for 10 min and chased for the indicated times in fresh media. Lysates were immunoprecipitated with anti-HA, then digested with Endo-H or left undigested, and analyzed by SDS-PAGE and phosphorimaging analyses. TAP binding is also shown (bottom). Lysates from the indicated CEM cells were directly immunoprecipitated with either anti-HA (lanes 1, 3, 5, 7, 9, and 11) or first immunoprecipitated with anti-TAP1 antisera followed by a secondary anti-HA immunoprecipitation (lanes 2, 4, 6, 8, 10, and 12). Arrow denotes class I H chains. B, Quantifications of the ratios of H chains recovered (anti-TAP1/anti-HA) are shown. Data are averaged over two independent experiments and the error bars represent the SEM.

 
Both HLA-B*4402 and HLA-B*4405 form bonafide peptide-loading complexes in cells lacking a functional TAP

If the interaction of HLA-B*4405 with TAP was more transient due to its more efficient peptide loading, the expectation was that conditions of peptide deficiency would stabilize HLA-B*4405-tapasin-TAP complexes. To further examine this possibility, HA-tagged versions of HLA-B*4402 and HLA-B*4405 were expressed in TAP1-deficient SK19 cells (22). Cell surface expression of both HLA-B*4402 and HLA-B*4405 were low in these cells compared with TAP-sufficient SK19 cells (see discussion below) (Fig. 3A), consistent with a role for TAP as the major peptide supplier for both HLA-B*4402 and HLA-B*4405 (13). Additionally, both HLA-B*4402 and HLA-B*4405 were predominantly Endo-H-sensitive (Fig. 3B). Although TAP2 is expressed in the SK19 cells, very low levels of either HLA-B*4402 or HLA-B*4405 were recovered in the anti-TAP2 immunoprecipitates (data not shown), consistent with the likely requirement for TAP1 for stable expression of TAP2 (34). Tapasin binding was quantified by metabolic labeling of cells, PaSta-1 immunoprecipitations, and secondary immunoprecipitations with anti-HA (Fig. 3C). Both HLA-B*4402 and HLA-B*4405 bound to tapasin with similar efficiencies (Fig. 3C, quantification at the bottom). Thermostability of HLA-B*4402 and HLA-B*4405 heterodimers was also assessed by immunoprecipitation analyses with W6/32 as described in Fig. 1C, following incubations of cell lysates at 4°C or 37°C (7). The amounts of coprecipitating HLA-B*4402 or HLA-B*4405 were quantified using secondary immunoprecipitations with anti-HA. Very low protein recovery and thermostability was observed for both HLA-B*4402 and HLA-B*4405 in SK19 cells, suggesting that both proteins were present in their peptide-deficient forms in SK19 cells, as expected from the known TAP1 deficiency of these cells (Fig. 3D). Together, these results indicate that under conditions of peptide deficiency, both HLA-B*4402 and HLA-B*4405 were indeed able to bind tapasin with similar efficiencies and that both proteins were unstable in these cells.


Figure 3
View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 3. Both HLA-B*4402 and HLA-B*4405 are retained in the ER and bind to tapasin under conditions of peptide deficiency. A, Cell surface expression of HLA-B*4402 and HLA-B*4405 is similar in TAP1-deficient SK19 cells. Flow cytometric analyses of SK19 cells and SK19 cells expressing HLA-B*4402 and HLA-B*4405 following staining of cells with anti-HA and FITC-conjugated secondary Abs. Mean fluorescence intensity: SK19 = 4.23, SK19-B*4402 = 17.99, SK19-B*4405 = 26.57. B, HLA-B*4402 and HLA-B*4405 are ER-retained in SK19 cells. Lysates from HLA-B*44 expressing SK19 cells were digested with Endo-H (lanes 2 and 4) or left undigested (lanes 1 and 3), and immunoblotting analyses were undertaken with anti-HA. Data are representative of three independent analyses. C, HLA-B*4402 and HLA-B*4405 bind tapasin similarly in SK19 cells. SK19 cells were metabolically labeled for 10 min (top) and lysed. Lysates were directly immunoprecipitated with either anti-HA (lanes 1, 3, and 5) or first immunoprecipitated (IP) with PaSta-1 followed by a secondary anti-HA immunoprecipitation (lanes 2, 4, and 6). Arrow denotes class I H chain, and nonspecific bands (*) are also denoted. Samples were separated by SDS-PAGE and proteins visualized by phosphorimaging analyses. Quantifications of the ratios (bottom) of H chains recovered (PaSta-1/anti-HA) are shown. Data are averaged over three independent experiments and the error bars represent the SEM ratios. D, Low thermostability of HLA-B*4402 and HLA-B*4405 in SK19 cells. SK19 cells expressing HLA-B*4402 or HLA-B*4405 were metabolically labeled for 10 min (top) and lysed, and lysates were incubated at 4°C or 37°C for 12 min, followed by sequential immunoprecipitations with primary W6/32 and secondary anti-HA Abs. Samples were separated by SDS-PAGE and proteins visualized by phosphorimaging analyses. The quantification of the percentage (bottom) of H chains recovered at 37°C relative to 4°C. Data are averages of three independent analyses with error bars representing the SEM.

 
To verify the formation of bonafide peptide-loading complexes by HLA-B*4405 under conditions of peptide deficiency, SK19 cells expressing wild-type TAP1 or a functionally defective mutant G646D TAP1 (23) were infected with retroviruses encoding either HLA-B*4402 or HLA-B*4405. Cell surface expression of both HLA-B*4402 and HLA-B*4405 were enhanced by the presence of wild-type TAP1 compared with mutant G646D TAP1, although enhancement in surface expression of HLA-B*4405 was much more significant (Fig. 4A). We further investigated HLA-B*44 binding to mutant G646D or wild-type TAP1 in these cells. HLA-B*4405 bound quite efficiently to mutant G646D TAP1, whereas complexes between HLA-B*4405 and wild-type TAP1 were barely detectable (Fig. 4B, compare lane 1 and lane 4). Because HLA-B*4405 was expressed at a slightly higher level in cells expressing wild-type TAP1 as compared with mutant G646D TAP1, these results indicate that TAP1 binding by HLA-B*4405 was diminished by the presence of TAP translocated peptides. In comparing efficiencies of TAP binding by HLA-B*4402 and HLA-B*4405, we observed that both HLA-B*4402 and HLA-B*4405 were able to form complexes with mutant G646D TAP1, with efficiencies of complex formation correlating with the expression level of HLA-B*44 (Fig. 4B, compare lane 1 and lane 2). Additionally, as expected, complexes of HLA-B*4402 and wild-type TAP1 were clearly detectable, whereas complexes of HLA-B*4405 and wild-type TAP1 were not, even though expression of HLA-B*4405 in wild-type TAP1 expressing cells was significantly higher than HLA-B*4402 (Fig. 4B, compare lane 4 and lane 5). Correspondingly, under steady-state conditions, the majority of HLA-B*4405 had exited the ER in wild-type TAP1-expressing cells (Fig. 4C, lane 8). However, in cells coexpressing HLA-B*4402 with either wild-type or mutant G646D TAP1, there was nearly complete retention of HLA-B*4402 molecules in the ER (Fig. 4C, lane 2 and lane 4). Enhanced ER retention of HLA-B*4402 molecules also correlated with significant levels of HLA-B*4402-wild-type TAP1 and HLA-B*4402-mutant G646D TAP1 complexes (Fig. 4B, lane 2 and lane 5) and only a small increase in HLA-B*4402 surface expression in cells expressing wild-type TAP1 (Fig. 4A, left). Thus, HLA-B*4402 peptide loading and transport appears to be quite inefficient in this melanoma cell line, as was observed in the CEM T cell line. Together, these analyses suggest that the association HLA-B*4405 with the "peptide-loading" complex is strongly affected by the availability of TAP-translocated peptides, whereas HLA-B*4402 assembly and surface expression are inefficient even in the presence of TAP-translocated peptides.


Figure 4
View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 4. Both HLA-B*4402 and HLA-B*4405 bind to TAP in SK19 cells that express a TAP1 mutant (G646D) that is impaired in peptide transport activity. A, Flow cytometric analyses with anti-HA primary Ab and FITC-conjugated secondary Ab. SK19 cells expressing wild-type TAP1 (WT TAP1) or mutant G646D TAP1 (MUT TAP1) were left uninfected or were each infected with viruses encoding HLA-B*4402 or HLA-B*4405 H chain. HLA-B*4402-expressing cells (left) and HLA-B*4405-expressing cells (right) are shown. Mean fluorescence intensity: mutant G646D TAP1 = 8.01, wild-type TAP1 = 10.20, B*4402-mutant G646D TAP1 = 11.29, B*4402-wild-type TAP1 = 21.55, B*4405-mutant G646D TAP1 = 24.15, B*4405-wild-type TAP1 = 255.14. B, Lysates from the indicated SK19 cells were directly immunoblotted with anti-HA or anti-TAP1 Abs, or proteins in lysates were first immunoprecipitated (IP) with anti-TAP1 antisera followed by anti-HA immunoblotting. Data are representative of three independent sets of analyses. SK19 cells (left) expressed HLA-B*4405 and mutant G646D TAP1 (lane 1), HLA-B*4402 and mutant G646D TAP1 (lane 2), or mutant G646D TAP1 alone (lane 3). SK19 cells (right) expressed wild-type TAP1 and HLA-B*4405 (lane 4), wild-type TAP1 and HLA-B*4402 (lane 5), or wild-type TAP1 alone (lane 6). Parent SK19 cells were also immunoblotted to show absence of TAP1 (lane 7). C, Proteins in lysates from SK19 cells expressing HLA-B*4402 and mutant G646D TAP1 (lanes 1 and 2), or HLA-B*4402 and wild-type TAP1 (lanes 3 and 4), or HLA-B*4405 and mutant G646D TAP1 (lanes 5 and 6) or HLA-B*4405 and wild-type TAP1 (lanes 7 and 8) were digested with Endo-H or left undigested, and immunoblotting analyses were undertaken with anti-HA. Data are representative of three independent analyses.

 
Both HLA-B*4402 and HLA-B*4405 bind efficiently to TAP and tapasin in insect cells

Insect cells have previously been used to assess TAP-tapasin-MHC class I complex formation and to reconstitute MHC class I peptide loading (5, 25, 35). Tapasin and HLA-B*44 molecules were coexpressed in insect cells with the TAP1 and TAP2 subunits of the TAP transporter. The formation of tapasin-TAP-MHC class I complexes was assessed by the indirect association of MHC class I H chains to ADP-conjugated agarose beads. These analyses compared binding of HLA-B*4402 and HLA-B*4405 to TAP, via interaction of TAP with the ADP-agarose beads (25). In coinfections with TAP-tapasin-HLA-B*4402 or TAP-tapasin-HLA-B*4405, both class I molecules efficiently bound to ADP-agarose beads (Fig. 5A, lane 1 and lane 4). For both HLA-B*4402 and HLA-B*4405, significantly higher levels of H chains were found associated with ADP-agarose beads when both TAP and tapasin were present, compared with TAP alone, or class I alone (Fig. 5A, compare lane 1 with lane 2 and lane 3, and compare lane 4 with lane 5 and lane 6). It has recently been suggested that the absence of ERp57 impacts the efficiency of MHC class I binding to tapasin and TAP (36), although this result was not observed in another study that used small inhibitory RNA directed against ERp57 to deplete ERp57 (37). ERp57 was not detectable in insect cell lysates (data not shown) by immunoblotting analyses with any of three different mammalian ERp57-specific Abs that were used (38, 39, 40). Whether this result reflects the absence of ERp57 in insect cells, or the lack of reactivity of insect ERp57 toward the mammalian ERp57-specific Abs is unclear. Additionally, it is also unclear whether the TAP-tapasin-MHC class I complexes observed in insect cells are fully representative of the peptide-loading complexes described in mammalian cells, which additionally include calreticulin and ERp57. Nevertheless, our results (Fig. 5A) indicate that, minimally, assembly of TAP-tapasin-HLA-B*44 complexes can be observed in insect cells and that HLA-B*4402-TAP and HLA-B*4405-TAP complex formation is mediated by the expression of tapasin in insect cells. Thus, in insect cells as in mammalian cells, tapasin appears to function as an obligatory bridge of the class I-TAP interaction (1).


Figure 5
View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 5. Both HLA-B*4402 and HLA-B*4405 bind to tapasin and TAP-tapasin complexes when expressed in insect cells. A, sf21 cells were coinfected with baculoviruses encoding HLA-B*44/beta2m constructs, tapasin, and TAP (lanes 1 and 4), or HLA-B*44/beta2m and TAP (lanes 2 and 5) or HLA-B*44/beta2m alone (lanes 3 and 6). Cells were lysed, proteins incubated with ADP agarose beads, complexes separated by SDS-PAGE, and proteins visualized by immunoblotting analyses with HC10. Lysates were directly immunoblotted with HC10 or anti-tapasin as indicated to assess expression of class I and tapasin. The amount of TAP bound to the ADP-agarose beads was assessed by immunoblotting with anti-histidine. Data are representative of three independent sets of analyses. B, Metabolically labeled sf21 cells (left) were infected with baculoviruses encoding HLA-B*44/beta2m alone (lanes 1 and 2 and lanes 5 and 6) or coinfected with separate viruses encoding HLA-B*44/beta2m and tapasin (lanes 3 and 4 and lanes 7 and 8) or infected with viruses encoding tapasin alone (lanes 9 and 10). Cells were lysed. Proteins were immunoprecipitated with the HC10 Ab or nonspecific control Ab and separated by SDS-PAGE. A representative phosphorimaging analysis is shown. NS, Nonspecific background band. To assess tapasin expression, lysates used in the immunoprecipitations in B (upper right panel) were directly immunoblotted with anti-tapasin antisera. Ratios of tapasin and H chain bands (lower right panel) were quantified from lanes 3 and 7 of the analyses on the left. Data are the average of six independent analyses for HLA-B*4402-tapasin and eight independent analyses for HLA-B*4405-tapasin complexes.

 
Different class I-specific Abs were also used to directly assess the tapasin-class I binding in insect cells (in the absence of TAP expression). In these analyses, the HC10 Ab was most efficient at coprecipitating tapasin-class I complexes, although tapasin was also detectable at low levels in immunoprecipitations with beta2m-specific Abs (data not shown). The HC10 Ab has previously also been used to compare tapasin binding by position 116 variants of HLA-B allotypes (13, 15). HC10 was therefore used for further comparisons of HLA-B*44-tapasin binding in insect cells. When similar levels of tapasin were expressed (Fig. 5B, upper right panel) complexes of both HLA-B*4402-tapasin and HLA-B*4405-tapasin were detectable with high efficiency (Fig. 5B, left panel, lane 3 and lane 7), and no significant differences were discerned in tapasin to H chain ratio quantifications averaged over multiple independent analyses (Fig. 5B, lower right panel). There was also no evidence from these analyses for the presence of other proteins that were coprecipitating at significant levels with tapasin and MHC class I, suggesting that if insect cell ERp57 is a component of the tapasin-MHC class I complexes, it is present in low to substoichiometric amounts

Exogenous peptides confer higher thermostability to HLA-B*4405 than to HLA-B*4402

To explain the observed differences in HLA-B*4402 and HLA-B*4405 trafficking under conditions of peptide sufficiency (Refs. 13 and 33 and Fig. 1), we next examined the possibility that the position 116 polymorphisms directly influenced peptide-loading efficiencies. The amino acid residue at position 116 of the class I H chain is situated within the F pocket of the MHC class I peptide-binding grove. Thus, changes at this position could influence specificity as well as kinetics of peptide loading.

Insect cells lack endogenous TAP and tapasin, and MHC class I molecules expressed in these cells are generally peptide deficient. Baculoviruses encoding HLA-B*44 were used to express HLA-B*4402 or HLA-B*4405 in insect cells, and the abilities of different exogenous peptides to bind HLA-B*4402 and HLA-B*4405 were compared using thermostability assays. Two HLA-B*44-specific peptides, SEIDTVAKY (41) and EEFGRAFSF (42) were synthesized, and additionally, two nonapeptide libraries were synthesized, one of which was completely random at each position while the other was synthesized with a HLA-B*44 glutamic acid anchor at position 2. Metabolically labeled insect cells expressing the two class I heterodimers were lysed in the presence or absence of excess exogenous peptide, and lysates were heated to 37°C for 12 min or maintained at 4°C, followed by immunoprecipitation analyses with the W6/32 Ab. H chains recovered at 37°C or 4°C were visualized (Fig. 6A) and quantified (Fig. 6, B and C). In the first analysis of the data, ratios of H chains recovered at 37°C relative to 4°C were quantified and averaged across several independent experiments (Fig. 6B). In the absence of exogenous peptide, both HLA-B*4402 and HLA-B*4405 were thermally unstable (Fig. 6B, no peptide). SEIDTVAKY and EEFGRAFSF significantly enhanced thermostability of both HLA-B*4402 and HLA-B*4405 to similar levels (Fig. 6). However, when HLA-B*4402 and HLA-B*4405 expressing sf21 cells were lysed in the presence of 200 µM of a completely random peptide mix, significantly higher thermostability was observed for HLA-B*4405 compared with HLA-B*4402 (ratio of H chains recovered at 37°C relative to the 4°C incubation was ~0.39 ± .04 for HLA-B*4405 compared with ~0.24 ± .03 for HLA-B*4402) (Fig. 6B, xxx). When these cells were lysed in the presence of the random peptide mix containing a glutamic acid at position P2, an even greater enhancement of HLA-B*4405 thermostability was observed, whereas the thermostability of HLA-B*4402 increased slightly (ratio of H chains recovered at 37°C relative to 4°C was ~0.76 ± 0.04 for HLA-B*4405 compared with 0.42 ± 0.04 for HLA-B*4402) (Fig. 6B, xEx). In a different analysis of the same data, enhancement of the 37°C to 4°C ratio by each peptide (relative to no peptide) was computed within individual experiments and averaged across several experiments (Fig. 6C). This analysis in Fig. 6C showed that higher peptide-induced thermostability was observed for HLA-B*4405 compared with HLA-B*4402, for all four peptides tested, with the most significant difference observed with xExxxxxxx.


Figure 6
View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 6. Differential thermostability of HLA-B*4402 and HLA-B*4405 induced by exogenous peptides. sf21 cells were infected with baculoviruses encoding the indicated HLA-B*44/beta2m constructs and metabolically labeled. Thermostability analyses were conducted in the absence (–) or presence of 100 µM SEIDVTAKY (SEI) and EEFGRAFSF (EEF), or 200 µM of the randomized peptide mixture xxx (xxxxxxxxx), xEx (xExxxxxxx), or 100 µM xExx(L) (xExxxxxxL), xExx(M) (xExxxxxxM), and xExx(F) (xExxxxxxF) with leucine (L), methionine (M), or phenylalanine (F). Lysates were incubated at 4°C or 37°C for 12 min, followed by immunoprecipitation analyses with W6/32. Samples were separated by SDS-PAGE and proteins visualized by phosphorimaging analyses. A and D, Representative images of H chains recovered at 4°C and 37°C, following SDS-PAGE. B and E, Quantifications of ratios of H chains recovered at 37°C relative to 4°C under the indicated condition. Data in B and C are the average of at least seven analyses under each condition, except for the EEF peptide analyses, which was the average of five experiments. Data in E and F are the average of four analyses. Error bars represent the SEM of the percentages. C and F, Results are plotted to quantify the fold increase in thermostability (37°C/4°C) induced by the indicated peptide relative to that observed in the absence of peptide. Error bars represent the SEM fold increase.

 
Differences in peptide-induced thermostability between HLA-B*4402 and HLA-B*4405 that were observed in the presence of random peptides (Fig. 6, A–C) might arise by the more rapid peptide loading of HLA-B*4405, or due to a broader repertoire of peptides that are permissive for HLA-B*4405 compared with HLA-B*4402. To better distinguish these possibilities, we synthesized three additional random nonapeptide libraries that were fixed with glutamic acid at position P2, and additionally fixed with a leucine, methionine, or phenylalanine at position P9 (the C terminus) of the library. Each of these C-terminal residues has been identified as a preferred C-terminal anchor for HLA-B*4402 (43), and each of these anchors is also expected to be a permissive C-terminal residue for HLA-B*4405 binding, although the presence of phenylalanine may be sterically less favorable for HLA-B*4405 due to the presence of Y116 in the HLA-B*4405 F pocket. The ability of each library to enhance HLA-B*44 thermostability was assessed. Consistent with the prevalence of phenylalanine as a predominant C-terminal residue in HLA-B*4402-eluted peptides (44), 100 µM xExxxxxxF enhanced thermostability of HLA-B*4402 very efficiently (Fig. 6, D–F). Although the xExxxxxxF library is expected to be sterically less favorable for HLA-B*4405 than for HLA-B*4402, similar levels of thermostability of both HLA-B*4402 and HLA-B*4405 were induced. Furthermore, two libraries that included other C-terminal anchor residues favorable for HLA-B*4402 binding (xExxxxxxL and xExxxxxxM) induced higher thermostability of HLA-B*4405 compared with HLA-B*4402. Together, these results suggest that kinetic differences in loading, rather than repertoire (selectivity) differences, were responsible for differential peptide induced thermostability of HLA-B*4402 and HLA-B*4405. Consistent with this interpretation, Zernich et al. (13) did not observe a significant quantitative difference in relative peptide repertoires between HLA-B*4402 and HLA-B*4405. More significant kinetic differences in loading were not strongly apparent with the specific peptides used (SEIDVTAKY (SEI) and EEFGRAFSF (EEF)), most likely due to the less favorable interactions of the peptide P9 residues with the HLA-B*4405 F pocket, and/or due to higher efficiency loading of the specific peptides compared with random libraries (only a subset of peptides contained in the libraries are expected to be specific for either HLA-B*44 molecule).

Similar cell surface stability of HLA-B*4402 and HLA-B*4405 in CEM cells

HLA-B*4402 and HLA-B*4405 display dramatic differences in their maturation rates in CEM and SK19 cells (Figs. 1 and 4). We asked whether more rapid loading of HLA-B*4405 would result in reduced stability of cell surface HLA-B*4405 compared with HLA-B*4402, which was loaded much more slowly and may therefore be subject to more rigorous quality control. To assess cell surface thermostability, CEM cells expressing HLA-B*4402 and HLA-B*4405 were heated at various temperatures for 10 min, stained with W6/32 ascites and analyzed by FACS (Fig. 7A, left). Control CEM cells were also treated and stained simultaneously to assess the background signal originating from class I molecules endogenous to these cells. Fig. 7A, middle and right, shows a reduction in W6/32 staining for all three cell populations as a function of temperature. The extent of reduction is similar for CEM cells, CEM-HLA-B*4402, and CEM-HLA-B*4405. Furthermore, ratios of HLA-B*4402 to HLA-B*4405 fluorescence intensities were maintained at each temperature. More rapid loss of stability of HLA-B*4405 would have resulted in an increase in the HLA-B*4402 to HLA-B*4405 fluorescence intensity ratios at the higher temperatures, but this result was not observed, indicating comparable stabilities of the two proteins at each temperature


Figure 7
View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 7. Similar cell surface stability of HLA-B*4402 and HLA-B*4405. A, Flow cytometric analyses with W6/32 and FITC-conjugated secondary Abs of CEM, CEM-HLA-B*4402, or CEM-HLA-B*4405 cells (left) following 10 min incubations at the indicated temperatures. Percentage recovery of thermostable class I molecules (middle) at each temperature. H chains recovered after no heat treatment were set at 100%. Error bars represent the SEM. Ratio of HLA-B*4402 to HLA-B*4405 mean fluorescence (right) at the indicated temperature. Data are average of three independent sets of analyses with error bars that represent the SEM of fluorescence ratios. B, CEM cells expressing HLA-B*4402 and HLA-B*4405 were biotinylated for 1 h and cells were lysed. Lysates were incubated at the indicated temperatures for 10 min. Proteins were immunoprecipitated with W6/32 ascites, followed by an additional round of incubation with streptavidin-conjugated agarose beads. Proteins were then separated by SDS-PAGE, and thermostable HLA-B*44 molecules were then visualized by immunoblotting analyses with anti-HA Abs. Data are representative of two independent sets of analyses.

 
As an additional assay for the relative stabilities of cell surface HLA-B*4402 and HLA-B*4405, we biotinylated surface proteins on CEM cells expressing HLA-B*4402 and HLA-B*4405. Cell lysates were prepared and incubated at 45°C, 50°C, or 60°C. Immunoprecipitation analysis with W6/32 was then conducted on the lysates, and cell surface proteins were specifically isolated using streptavidin-conjugated agarose beads. The recovery of thermostable HLA-B*44 molecules was visualized by anti-HA immunoblotting. Cell surface versions of both HLA-B*4402 and HLA-B*4405 were both remarkably stable to the heat incubations, and reduced recovery of both proteins was observed only following the 60°C incubation (Fig. 7B). Together, these results suggest that, although HLA-B*4405 exits the ER more rapidly, it is not unstable at the cell surface. No significant differences in cell surface stabilities of HLA-B*4405 and HLA-B*4402 were measurable.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In human cells under steady-state conditions, HLA-B*4405 binding to tapasin was barely detectable, and TAP binding was undetectable (Fig. 1), consistent with the observations of Zernich et al. (13). It was a possibility that HLA-B*4405 is able to load peptides efficiently without the requirement for association with the peptide-loading complex, which could explain the higher thermostability and more rapid intracellular maturation of HLA-B*4405. Fig. 2 shows that HLA-B*4405-TAP complexes were indeed observable, but that these complexes appear to be more transient, and dissociate more rapidly compared with HLA-B*4402-TAP complexes.

Although we cannot rule out the possibility of small affinity differences between HLA-B*4402 and HLA-B*4405 for tapasin-TAP binding, the data shown in Figs. 2–5 suggest that position 116 is not likely to be a major determinant of the inherent tapasin-binding affinity. Therefore, our data suggest that HLA-B*4405 is not structurally unsuited to incorporation into the tapasin-TAP complex, but is in fact incorporated quite efficiently, when ER peptide supply is blocked (Figs. 3, 4, and 5). Our analyses used TAP1-deficient cells or insect cells to compare HLA-B*4402 and HLA-B*4405 binding to TAP, tapasin, or TAP-tapasin complexes under conditions of limited peptide supply. Only small increases in class I surface fluorescence intensities were observed in insect cells that coexpress TAP-tapasin, compared with cells lacking these components (25, 35), indicating that peptide translocation and/or class I assembly is generally inefficient in insect cells due to the absence of other components of the Ag presentation pathway. This is the likely explanation for why HLA-B*4405 remains partly associated with tapasin-TAP in insect cells, even when the cells express all of the known components required for pumping peptides into the ER. Efficient association of HLA-B*4405 with TAP was also observed in mammalian cells expressing a nonfunctional TAP1, and binding was significantly reduced when a functional wild-type TAP1 was expressed (Fig. 4). Taken together, we infer that the pathway of Ag presentation by HLA-B*4405 is not fundamentally different from that of HLA-B*4402; rather, HLA-B*4405 appears to simply be more efficient in its peptide loading. Interactions of HLA-B*4405 with tapasin-TAP complexes are highly dependent on availability of peptides. When peptides are available, HLA-B*4405 binding to the TAP complex is more transient than that of HLA-B*4402 due to the more rapid peptide loading of HLA-B*4405. It is possible that other mutations and polymorphisms that have been suggested to influence class I binding to tapasin-TAP complexes (for example, (12, 14, 15, 45, 46)) could also influence binding via an effect on class I peptide loading, as previously suggested (7, 15, 16). Single amino acid differences can change the specificity and loading kinetics of class I-peptide binding, which can in turn influence the extent of TAP-tapasin binding, efficiencies of Ag presentation, and consequent T cell responses. What mechanisms account for more efficient trafficking of HLA-B*4405 when expressed under conditions of peptide sufficiency? We observed a small difference in the ability of known HLA-B*44-specific peptides to enhance the thermostability of peptide-deficient HLA-B*4402 vs HLA-B*4405, but a more significant difference in thermostability induced by random peptides, including those with preferred HLA-B*4402 anchor residues at the C terminus (xxxxxxxxx, xExxxxxxx, xExxxxxxL, xExxxxxxM) (Fig. 6). These results suggest that the single site mutation of HLA-B*4405 to HLA-B*4402 impacts the peptide-loading kinetics. Thus, trafficking differences between HLA-B*4402 and HLA-B*4405 may be largely determined by differences in peptide-loading kinetics. This ease of peptide loading in B*4405 might be attributed to the need to shield the greater hydrophobicity of the F pocket in this allotype compared with B*4402, as previously suggested (13).

Assembly of HLA-B*4402 has previously been shown to be deficient in cells that are deficient in human tapasin (7, 11, 12, 13). In this study, we show that HLA-B*4402 assembly is incomplete in some cell types (CEM and SK19), even when tapasin is not limiting (Fig. 1). CEM cells and primary T cells generally appear to mature MHC class I molecules at a slower rate compared with other cell types (e.g., at 60 min postsynthesis, HLA-A2 was largely Endo-H resistant in HeLa cells, but significantly Endo-H sensitive in CEM cells (31)). It is possible that peptide supply into the ER is low in CEM and SK-19 cells, compared with other cell types, which may result in enhanced differences between HLA-B*4402 and HLA-B*4405 trafficking profiles in CEM cells. However, enhanced tapasin-TAP binding by HLA-B*4402 compared with HLA-B*4405, and more rapid ER exit of HLA-B*4405 compared with HLA-B*4402, was also observed in 721.220 cells that were transfected with tapasin (13), in C1R cells (13), as well as in CEM cells (our report) and B lymphoblastoid cell lines (33). Thus, the differences described for HLA-B*4402 and HLA-B*4405 in Figs. 1 and 2 appear to be general features of these two allotypes, rather than cell type-specific effects, although HLA-B*4402 maturation may be more efficient in APCs than in the cell types described here. It is a formal possibility that the N-terminal HA epitope tag further impacts the rate of HLA-B*4402 trafficking; however, both HLA-B*4402 and HLA-B*4405 were HA-tagged in some of the analyses described in our study. Furthermore, previous analyses of the trafficking rates of HA-tagged and untagged HLA-A2 have revealed no discernible differences (31).

We suggest that inefficient peptide loading of HLA-B*4402 is likely to be largely responsible for its strong tapasin dependence (7, 11, 12, 13). Inefficient peptide loading of HLA-B*4402 must also underlie its enhanced susceptibility to viral immune evasion molecules that diminish peptide supply into the ER, or that inhibit tapasin function (13, 18). Any non-ideal condition for Ag presentation would be predicted to further diminish the low peptide occupancy levels of HLA-B*4402 and more profoundly influence HLA-B*4402 assembly compared with HLA-B*4405 assembly. We found that when HLA-B*4402 was expressed in insect cells, tapasin was essential for effecting a TAP-mediated increase in its surface expression. Furthermore, TAP mutants impaired in tapasin binding had reduced ability to enhance HLA-B*4402 cell surface expression (25). Thus, in both insect and mammalian cells, tapasin is required for efficient binding of TAP-translocated peptides to HLA-B*4402. By its effect on TAP stability and function (3, 4), tapasin must increase the low ER peptide concentrations above a critical level required for loading of HLA-B*4402. Additional independent mechanisms must explain the ability of soluble tapasin (that does not bind TAP or enhance TAP function) to enhance HLA-B*4402 surface expression in the tapasin-deficient 721.220 cell line (47). For example, a previous report has suggested that tapasin stabilizes the peptide-free conformation of class I MHC molecules in the ER, which results in an increase in the number and variety of peptides bound to MHC class I molecules (8). Other studies have suggested that tapasin enhances MHC class I presentation according to the half-lives of MHC-peptide complexes (48). Although the precise mechanisms of tapasin function remains to be elucidated, there is general agreement that tapasin can enhance peptide loading of MHC class I molecules via mechanisms independent of the effect of tapasin on TAP function.

An important question that arises is how the differential rates of trafficking might impact the stabilities of HLA-B*44 molecules on the cell surface. Our assessments of HLA-B*44 cell surface stability in CEM cells did not reflect reduced stability of cell surface HLA-B*4405 compared with HLA-B*4402 (Fig. 7). In our studies of surface stability, cell surface expression of HLA-B*4402 and HLA-B*4405 were matched to within 2-fold (Fig. 7). A previous report by Williams et al. (7) showed that in a B lymphoblastoid cell line, at 30 min postsynthesis in the presence of tapasin, HLA-B*4402 was more thermostable than HLA-B*4405. Increased thermostability of HLA-B*4402 compared with HLA-B*4405 in the presence of tapasin correlated with significantly higher cell surface expression of HLA-B*4402 compared with HLA-B*4405 in tapasin-sufficient cells. It was suggested that the use of a tapasin-independent pathway by HLA-B*4405 may be counterbalanced by less optimal overall peptide selection for HLA-B*4405. It is likely that the apparent discrepancies between the surface stability results described in our study and the thermostability assays described by Williams et al. (7) are explained by cell line and/or protein expression level differences within and between the two sets of studies. Thermostability profiles can be influenced by the amounts of class I H chains expressed, and relative stabilities of different molecular populations are perhaps better compared under conditions of similar expression, as undertaken in the analyses of Fig. 7. Overall, the assembly and cell surface stability characteristics we observe with HLA-B*4405 are consistent with the previously reported possibility that HLA class I allotypes, which are capable of binding peptides more efficiently from the intracellular pool and are assembled and transported more rapidly, can confer a protective advantage against infection (33). At least in the case of HLA-B*4405, rapid peptide loading does not appear to result in a significant cell surface stability cost.

In summary, our studies demonstrate that peptide occupancy is a critical parameter to consider in interpretations of MHC class I-tapasin-TAP-binding analyses. At least two mechanisms could account for differences in tapasin-TAP binding by MHC class I variants: inherent differences in binding affinity, or differences in relative peptide occupancy. The latter consideration is particularly important for a better understanding of the effects of variations in and around the class I peptide-binding groove upon tapasin-TAP binding. Tapasin-TAP complexes preferentially associate with peptide-deficient class I either because peptide loading of class I enhances the dissociation of class I from tapasin-TAP complexes or because peptide loading of class I directly inhibits binding of class I to tapasin-TAP complexes. At steady state, the extent of tapasin-TAP binding by a class I allotype could be generally reflective of the extent of class I peptide occupancy, with high binding indicative of low occupancy, and vice versa. It might also be generally true that allotypes that are strongly associated with tapasin-TAP at steady state will be more dependent on tapasin for their efficient cell surface expression, but this may not be due to inherent difference in class I-binding affinities for tapasin as previously implied (12), but rather due to differences in peptide-loading efficiencies. An allotype that is strongly associated with tapasin-TAP due to low peptide occupancy is more likely to require tapasin for its assembly because the presence of tapasin enhances the concentrations of translocated peptides (3). It is then also not very surprising that allotypes that are strongly associated with tapasin-TAP (due to low peptide occupancy) will be more sensitive to the effects of viral immune evasion molecules, compared with allotypes that are poorly associated with tapasin-TAP (because of high peptide occupancy), as has been observed recently (13, 18).


    Acknowledgments
 
We thank Dr. Rachelle Gaudet for the baculovirus encoding TAP1-histidine/TAP2, Dr. Anthony W. Purcell for the HLA-B44 cDNA, Dr. Peter Cresswell for the PaSta-1 Ab, Dr. Ted Hansen for the anti-tapasin N-terminal Ab, Dr. Matt Androlewicz for anti-TAP1 antisera, Dr. Pan Zheng for the SK19 cells expressing mutant (G646D) TAP1 and wild-type TAP1, Dr. Soldano Ferrone for the TO-2 anti-ERp57 Ab, Dr. Tom Wileman for the anti-ERp57 antiserum, and Dr. Reiko Urade for the anti-rat ER-60 antiserum. We also thank the University of Michigan’s biomedical research core facilities (Ann Arbor, MI) for peptide synthesis and purification and its Hybridoma Core for Ab production.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Grant AI44115 (to M.R.) from the National Institutes of Health, fellowships from the American Heart Association (to V.T. and G.R.), and financial support from the Michigan Diabetes Research and Training Center and the University of Michigan Rheumatic Diseases Core Center. Back

2 Address correspondence and reprint requests to Dr. Malini Raghavan, Department of Microbiology and Immunology, 5641 Medical Science Building II, University of Michigan Medical School, Ann Arbor, MI 48109-0620. E-mail address: malinir{at}umich.edu Back

3 Abbreviations used in this paper: beta2m, beta2-microglobulin; ER, endoplasmic reticulum; HA, hemagglutinin; MOI, multiplicity of infection; Endo-H, endoglycosidase H. Back

Received for publication March 8, 2006. Accepted for publication June 16, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Ortmann, B., J. Copeman, P. J. Lehner, B. Sadasivan, J. A. Herberg, A. G. Grandea, S. R. Riddell, R. Tampe, T. Spies, J. Trowsdale, P. Cresswell. 1997. A critical role for tapasin in the assembly and function of multimeric MHC class I-TAP complexes. Science 277: 1306-1309. [Abstract/Free Full Text]
  2. Cresswell, P., N. Bangia, T. Dick, G. Diedrich. 1999. The nature of the MHC class I peptide loading complex. Immunol. Rev. 172: 21-28. [Medline]
  3. Lehner, P. J., M. J. Surman, P. Cresswell. 1998. Soluble tapasin restores MHC class I expression and function in the tapasin-negative cell line. 220. Immunity 8: 221-231. [Medline]
  4. Garbi, N., N. Tiwari, F. Momburg, G. J. Hammerling. 2003. A major role for tapasin as a stabilizer of the TAP peptide transporter and consequences for MHC class I expression. Eur. J. Immunol. 33: 264-273. [Medline]
  5. Schoenhals, G. J., R. M. Krishna, A. G. Grandea, III, T. Spies, P. A. Peterson, Y. Yang, K. Fruh. 1999. Retention of empty MHC class I molecules by tapasin is essential to reconstitute antigen presentation in invertebrate cells. EMBO J. 18: 743-753. [Medline]
  6. Grandea, A. G., III, T. N. Golovina, S. E. Hamilton, V. Sriram, T. Spies, R. R. Brutkiewicz, J. T. Harty, L. C. Eisenlohr, L. Van Kaer. 2000. Impaired assembly yet normal trafficking of MHC class I molecules in Tapasin mutant mice. Immunity 13: 213-222. [Medline]
  7. Williams, A. P., C. A. Peh, A. W. Purcell, J. McCluskey, T. Elliott. 2002. Optimization of the MHC class I peptide cargo is dependent on tapasin. Immunity 16: 509-520. [Medline]
  8. Zarling, A. L., C. J. Luckey, J. A. Marto, F. M. White, C. J. Brame, A. M. Evans, P. J. Lehner, P. Cresswell, J. Shabanowitz, D. F. Hunt, V. H. Engelhard. 2003. Tapasin is a facilitator, not an editor, of class I MHC peptide binding. J. Immunol. 171: 5287-5295. [Abstract/Free Full Text]
  9. Chun, T., A. G. Grandea, III, L. Lybarger, J. Forman, L. Van Kaer, C. R. Wang. 2001. Functional roles of TAP and tapasin in the assembly of M3-N-formylated peptide complexes. J. Immunol. 167: 1507-1514. [Abstract/Free Full Text]
  10. Lybarger, L., Y. Y. Yu, T. Chun, C. R. Wang, A. G. Grandea, III, L. Van Kaer, T. H. Hansen. 2001. Tapasin enhances peptide-induced expression of H2–M3 molecules, but is not required for the retention of open conformers. J. Immunol. 167: 2097-2105. [Abstract/Free Full Text]
  11. Peh, C. A., S. R. Burrows, M. Barnden, R. Khanna, P. Cresswell, D. J. Moss, J. McCluskey. 1998. HLA-B27-restricted antigen presentation in the absence of tapasin reveals polymorphism in mechanisms of HLA class I peptide loading. Immunity 8: 531-542. [Medline]
  12. Park, B., S. Lee, E. Kim, K. Ahn. 2003. A single polymorphic residue within the peptide-binding cleft of MHC class I molecules determines spectrum of tapasin dependence. J. Immunol. 170: 961-968. [Abstract/Free Full Text]
  13. Zernich, D., A. W. Purcell, W. A. Macdonald, L. Kjer-Nielsen, L. K. Ely, N. Laham, T. Crockford, N. A. Mifsud, M. Bharadwaj, L. Chang, et al 2004. Natural HLA class I polymorphism controls the pathway of antigen presentation and susceptibility to viral evasion. J. Exp. Med. 200: 13-24. [Abstract/Free Full Text]
  14. Neisig, A., R. Wubbolts, X. Zang, C. Melief, J. Neefjes. 1996. Allele-specific differences in the interaction of MHC class I molecules with transporters associated with antigen processing. J. Immunol. 156: 3196-3206. [Abstract]
  15. Turnquist, H. R., H. J. Thomas, K. R. Prilliman, C. T. Lutz, W. H. Hildebrand, J. C. Solheim. 2000. HLA-B polymorphism affects interactions with multiple endoplasmic reticulum proteins. Eur. J. Immunol. 30: 3021-3028. [Medline]
  16. Elliott, T.. 1997. How does TAP associate with MHC class I molecules?. Immunol. Today 18: 375-379. [Medline]
  17. Turnquist, H. R., S. E. Vargas, E. L. Schenk, M. M. McIlhaney, A. J. Reber, J. C. Solheim. 2002. The interface between tapasin and MHC class I: identification of amino acid residues in both proteins that influence their interaction. Immunol. Res. 25: 261-269. [Medline]
  18. Park, B., Y. Kim, J. Shin, S. Lee, K. Cho, K. Fruh, K. Ahn. 2004. Human cytomegalovirus inhibits tapasin-dependent peptide loading and optimization of the MHC class I peptide cargo for immune evasion. Immunity 20: 71-85. [Medline]
  19. Suh, W. K., E. K. Mitchell, Y. Yang, P. A. Peterson, G. L. Waneck, D. B. Williams. 1996. MHC class I molecules form ternary complexes with calnexin and TAP and undergo peptide-regulated interaction with TAP via their extracellular domains. J. Exp. Med. 184: 337-348. [Abstract/Free Full Text]
  20. Carreno, B. M., J. C. Solheim, M. Harris, I. Stroynowski, J. M. Connolly, T. H. Hansen. 1995. TAP associates with a unique class I conformation, whereas calnexin associates with multiple class I forms in mouse and man. J. Immunol. 155: 4726-4733. [Abstract]
  21. Ortmann, B., M. J. Androlewicz, P. Cresswell. 1994. MHC class I/beta2-microglobulin complexes associate with TAP transporters before peptide binding. Nature 368: 864-867. [Medline]
  22. Yang, T., B. A. McNally, S. Ferrone, Y. Liu, P. Zheng. 2003. A single-nucleotide deletion leads to rapid degradation of TAP-1 mRNA in a melanoma cell line. J. Biol. Chem. 278: 15291-15296. [Abstract/Free Full Text]
  23. Yang, T., P. E. Lapinski, H. Zhao, Q. Zhou, H. Zhang, M. Raghavan, Y. Liu, P. Zheng. 2005. A rare transporter associated with antigen processing polymorphism overpresented in HLAlow colon cancer reveals the functional significance of the signature domain in antigen processing. Clin. Cancer Res. 11: 3614-3623. [Abstract/Free Full Text]
  24. Raghuraman, G., P. E. Lapinski, M. Raghavan. 2002. Tapasin interacts with the membrane-spanning domains of both TAP subunits and enhances the structural stability of TAP1 x TAP2 Complexes. J. Biol. Chem. 277: 41786-41794. [Abstract/Free Full Text]
  25. Procko, E., G. Raghuraman, D. C. Wiley, M. Raghavan, R. Gaudet. 2005. Identification of domain boundaries within the N-termini of TAP1 and TAP2 and their importance in tapasin binding and tapasin-mediated increase in peptide loading of MHC class I. Immunol. Cell Biol. 83: 475-482. [Medline]
  26. Roeth, J. F., M. Williams, M. R. Kasper, T. M. Filzen, K. L. Collins. 2004. HIV-1 Nef disrupts MHC-I trafficking by recruiting AP-1 to the MHC-I cytoplasmic tail. J. Cell Biol. 167: 903-913. [Abstract/Free Full Text]
  27. Parham, P., C. J. Barnstable, W. F. Bodmer. 1979. Use of a monoclonal antibody (W6/32) in structural studies of HLA-A,B,C, antigens. J. Immunol. 123: 342-349. [Abstract/Free Full Text]
  28. Dick, T. P., N. Bangia, D. R. Peaper, P. Cresswell. 2002. Disulfide bond isomerization and the assembly of MHC class I-peptide complexes. Immunity 16: 87-98. [Medline]
  29. Stam, N. J., H. Spits, H. L. Ploegh. 1986. Monoclonal antibodies raised against denatured HLA-B locus heavy chains permit biochemical characterization of certain HLA-C locus products. J. Immunol. 137: 2299-2306. [Abstract]
  30. Blanco-Gelaz, M. A., B. Suárez-Alvarez, S. González, A. López-Vázquez, J. Martínez-Borra, C. López-Larrea. 2006. The amino acid at position 97 is involved in folding and surface expression of HLA-B27. Int. Immunol. 18: 211-220. [Abstract/Free Full Text]
  31. Kasper, M. R., J. F. Roeth, M. Williams, T. M. Filzen, R. I. Fleis, K. L. Collins. 2005. HIV-1 Nef disrupts antigen presentation early in the secretory pathway. J. Biol. Chem. 280: 12840-12848. [Abstract/Free Full Text]
  32. Fahnestock, M. L., I. Tamir, L. Narhi, P. J. Bjorkman. 1992. Thermal stability comparison of purified empty and peptide-filled forms of a class I MHC molecule. Science 258: 1658-1662. [Abstract/Free Full Text]
  33. Khanna, R., S. R. Burrows, A. Neisig, J. Neefjes, D. J. Moss, S. L. Silins. 1997. Hierarchy of Epstein-Barr virus-specific cytotoxic T-cell responses in individuals carrying different subtypes of an HLA allele: implications for epitope-based antiviral vaccines. J. Virol. 71: 7429-7435. [Abstract]
  34. Furukawa, H., S. Murata, T. Yabe, N. Shimbara, N. Keicho, K. Kashiwase, K. Watanabe, Y. Ishikawa, T. Akaza, K. Tadokoro, et al 1999. Splice acceptor site mutation of the transporter associated with antigen processing-1 gene in human bare lymphocyte syndrome. J. Clin. Invest. 103: 755-758. [Medline]
  35. Lauvau, G., B. Gubler, H. Cohen, S. Daniel, S. Caillat-Zucman, P. M. van Endert. 1999. Tapasin enhances assembly of transporters associated with antigen processing-dependent and -independent peptides with HLA-A2 and HLA-B27 expressed in insect cells. J. Biol. Chem. 274: 31349-31358. [Abstract/Free Full Text]
  36. Garbi, N., S. Tanaka, F. Momburg, G. J. Hammerling. 2006. Impaired assembly of the major histocompatibility complex class I peptide-loading complex in mice deficient in the oxidoreductase ERp57. Nat. Immunol. 7: 93-102. [Medline]
  37. Zhang, Y., E. Baig, D. B. Williams. 2006. Functions of ERp57 in the folding and assembly of MHC Class I molecules. J. Biol. Chem. 281: 14622-14631. [Abstract/Free Full Text]
  38. Ogino, T., X. Wang, S. Kato, N. Miyokawa, Y. Harabuchi, S. Ferrone. 2003. Endoplasmic reticulum chaperone-specific monoclonal antibodies for flow cytometry and immunohistochemical staining. Tissue Antigens 62: 385-393. [Medline]
  39. Rouiller, I., S. M. Brookes, A. D. Hyatt, M. Windsor, T. Wileman. 1998. African swine fever virus is wrapped by the endoplasmic reticulum. J. Virol. 72: 2373-2387. [Abstract/Free Full Text]
  40. Otsu, M., R. Urade, M. Kito, F. Omura, M. Kikuchi. 1995. A possible role of ER-60 protease in the degradation of misfolded proteins in the endoplasmic reticulum. J. Biol. Chem. 270: 14958-14961. [Abstract/Free Full Text]
  41. DiBrino, M., K. C. Parker, D. H. Margulies, J. Shiloach, R. V. Turner, W. E. Biddison, J. E. Coligan. 1995. Identification of the peptide binding motif for HLA-B44, one of the most common HLA-B alleles in the Caucasian population. Biochemistry 34: 10130-10138. [Medline]
  42. Macdonald, W., D. S. Williams, C. S. Clements, J. J. Gorman, L. Kjer-Nielsen, A. G. Brooks, J. McCluskey, J. Rossjohn, A. W. Purcell. 2002. Identification of a dominant self-ligand bound to three HLA B44 alleles and the preliminary crystallographic analysis of recombinant forms of each complex. FEBS Lett. 527: 27-32. [Medline]
  43. Sidney, J., S. Southwood, V. Pasquetto, A. Sette. 2003. Simultaneous prediction of binding capacity for multiple molecules of the HLA B44 supertype. J. Immunol. 171: 5964-5974. [Abstract/Free Full Text]
  44. Fleischhauer, K., D. Avila, F. Vilbois, C. Traversari, C. Bordignon, H. J. Wallny. 1994. Characterization of natural peptide ligands for HLA-B*4402 and -B*4403: implications for peptide involvement in allorecognition of a single amino acid change in the HLA-B44 heavy chain. Tissue Antigens 44: 311-317. [Medline]
  45. Lewis, J. W., T. Elliott. 1998. Evidence for successive peptide binding and quality control stages during MHC class I assembly. Curr. Biol. 8: 717-720. [Medline]
  46. Paquet, M. E., D. B. Williams. 2002. Mutant MHC class I molecules define interactions between components of the peptide-loading complex. Int. Immunol. 14: 347-358. [Abstract/Free Full Text]
  47. Tan, P., H. Kropshofer, O. Mandelboim, N. Bulbuc, G. J. Hammerling, F. Momburg. 2002. Recruitment of MHC class I molecules by tapasin into the transporter associated with antigen processing-associated complex is essential for optimal peptide loading. J. Immunol. 168: 1950-1960. [Abstract/Free Full Text]
  48. Howarth, M., A. Williams, A. B. Tolstrup, T. Elliott. 2004. Tapasin enhances MHC class I peptide presentation according to peptide half-life. Proc. Natl. Acad. Sci. USA 101: 11737-11742. [Abstract/Free Full Text]

Related articles in The JI:

IN THIS ISSUE

The JI 2006 177: 2737-2738. [Full Text]  



This article has been cited by other articles:


Home page
J. Immunol.Home page
H. Escobar, D. K. Crockett, E. Reyes-Vargas, A. Baena, A. L. Rockwood, P. E. Jensen, and J. C. Delgado
Large Scale Mass Spectrometric Profiling of Peptides Eluted from HLA Molecules Reveals N-Terminal-Extended Peptide Motifs
J. Immunol., October 1, 2008; 181(7): 4874 - 4882.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. R. Schaefer, M. Williams, D. A. Kulpa, P. K. Blakely, A. Q. Yaffee, and K. L. Collins
A Novel Trafficking Signal within the HLA-C Cytoplasmic Tail Allows Regulated Expression upon Differentiation of Macrophages
J. Immunol., June 15, 2008; 180(12): 7804 - 7817.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Garstka, B. Borchert, M. Al-Balushi, P. Praveen, N. Kuhl, I. Majoul, R. Duden, and S. Springer
Peptide-receptive Major Histocompatibility Complex Class I Molecules Cycle between Endoplasmic Reticulum and cis-Golgi in Wild-type Lymphocytes
J. Biol. Chem., October 19, 2007; 282(42): 30680 - 30690.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. L. Perria, V. Rajamanickam, P. E. Lapinski, and M. Raghavan
Catalytic Site Modifications of TAP1 and TAP2 and Their Functional Consequences
J. Biol. Chem., December 29, 2006; 281(52): 39839 - 39851.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. M. Rizvi and M. Raghavan
Direct peptide-regulatable interactions between MHC class I molecules and tapasin
PNAS, November 28, 2006; 103(48): 18220 - 18225.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thammavongsa, V.
Right arrow Articles by Raghavan, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thammavongsa, V.
Right arrow Articles by Raghavan, M.
Right arrowPubmed/NCBI databases
*Substance via MeSH
*Genetics Home Reference


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS