|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

* Institut National de la Santé et de la Recherche Médicale, Unité 620, Détoxication et Réparation Tissulaire, Université de Rennes-1, and
Département Hématologie, Immunologie et Therapie cellulaire, Centre Hospitalier Universitaire Pontchaillou, Rennes, France
| Abstract |
|---|
|
|
|---|
and IL-8 induced by LPS. Finally, like monocytes, As2O3-treated macrophages can be differentiated into dendritic-like cells. Impairment of macrophage function by As2O3 mainly resulted from activation of a RhoA/Rho-associated kinase pathway; indeed, pretreatment of macrophages with the Rho-associated kinase inhibitor Y-27632 prevented metalloid effects on cytoskeleton and phagocytosis. Moreover, As2O3 was found to increase level of the active GTP-bound form of RhoA and that of phosphorylated-Moesin, a major cytoskeleton adaptor protein involved in RhoA regulation. Taken together, our results demonstrated that human macrophages constitute sensitive targets of inorganic arsenic, which may contribute to immunotoxicity of this environmental contaminant. | Introduction |
|---|
|
|
|---|
Besides lymphocytes, monocytes/macrophages may also constitute major targets of iAs. Indeed, we and others have recently demonstrated that low micromolar concentrations of iAs inhibit in vitro macrophagic differentiation of human blood-derived monocytes (11, 12). Particularly, we showed that arsenic trioxide (As2O3), an iAs trivalent form, triggers apoptosis of human monocytes during their differentiation by down-regulating NF-
B-dependent survival pathways (11). In addition, in vivo experiments have reported that iAs can alter macrophage functions. Thus, treatment of Swiss albino mice with arsenite (0.5 mg/kg) for 15 days significantly increased bacterial load in blood and delayed bacterial clearance by spleen (13); these effects were associated with marked reduction of adhesion property, chemotactic migration, and phagocytic activity of splenic macrophages. Mice exposure to gallium arsenide affected proteolytic cathepsin activities and Ag processing of splenic macrophages (14). Together, these results suggest that, in addition to lymphocytes, human macrophages may constitute by themselves sensitive targets of iAs. The present study was designed to investigate this hypothesis.
In this work, we demonstrate that low concentrations of As2O3 (0.251 µM), in the range of arsenic blood levels measured in chronically exposed humans (1060 µg/L) (15, 16), alter differentiation features of human primary macrophages such as morphology, surface marker expression, or phagocytic activity. These effects were initiated by a rapid reorganization of F-actin cytoskeleton, resulting from a sustained and persistent activation of a RhoA-Rho-associated kinase (ROCK) pathway. Our results highlight human macrophages as marked sensitive targets of iAs, which may contribute to the immunosuppressive properties of this environmental contaminant.
| Materials and Methods |
|---|
|
|
|---|
As2O3, FITC-conjugated dextran (molecular mass, 40,000 kDa), FITC-phalloidin, and LPS were purchased from Sigma-Aldrich. The WST-1 tetrazolium salt 4-[34(iodophenyl)-2-(4-nitrosophenyl)-2H-5-tetrazole]-1,3-benzene disulfonate was purchased from Roche Diagnostics. Y-27632 was from Calbiochem (VWR). GM-CSF (specific activity, 1.2 x 108 UI/mg) was obtained from Shering Plough, whereas IL-4 (specific activity, 2 x 108 UI/ml) was from Promocell. Rabbit polyclonal Abs against phospho- and total Ezrin/Radixin/Moesin (ERM) proteins were purchased from Cell Signaling Technology (Ozyme). Mouse mAb raised against Rho guanine dissociation inhibitors (RhoGDI) was from Santa Cruz Biotechnology (Tebu-bio). FITC-conjugated mAbs against CD1a, CD11c, CD14, CD29, and CD71, and PE-conjugated mAb against CD11b were purchased from Immunotech. Fluorescent latex microspheres were provided by Polysciences.
Cell cultures
PBMC were first isolated from bloody buffy coats of healthy donors through Ficoll gradient centrifugation. Human monocytes were then prepared by a 2-h adhesion step, which routinely obtained >90% of adherent CD14-positive cells as assessed by immunostaining. These monocytic cells were next cultured for 6 days in RPMI 1640 medium supplemented with 10% FCS, 2 mM L-glutamine, 20 UI/ml penicillin, and 20 µg/ml streptomycin, in the presence of 800 UI/ml GM-CSF to get macrophages as previously reported (17, 18, 19). To obtain dendritic cells, monocytic cells were differentiated in the presence of 800 UI/ml GM-CSF and 500 UI/ml IL-4, as previously reported (20). Once differentiated, macrophages were cultured in GM-CSF-free RPMI 1640 medium in the absence or presence of As2O3 for indicated time intervals. In some experiments, macrophages were first pretreated with 20 µM Y-27632 for 2 h, and then exposed to As2O3. Y-27632 was dissolved in distilled water. For cell death assays and flow cytometric studies, both floating and adherent macrophages were analyzed. Adherent macrophages were collected after 15 min of incubation at 37°C in PBS supplemented with 100 µM EDTA.
Cellular adhesion assay
Adherence of macrophages was analyzed using the WST-1 assay in 96-well microplates, as previously described (18). The yellow formazan product formed by viable adherent cells was quantified by detection of its absorbance at 450 nm using a Titertek Multiskan spectrophotometer (Flow Laboratories).
Determination of apoptosis and necrosis
To analyze alterations of the plasma membrane structure linked to apoptosis, exposition of phosphatidylserine to the extracellular environment was studied. We determined binding of annexin V (A5), a calcium-dependent protein with high affinity for phosphatidylserine, using A5 conjugated to the fluorescent label Alexa 568 (Roche Diagnostics). Simultaneously, necrotic cells, which have lost their plasma membrane integrity, were detected with the green fluorescent DNA dye sytox green (SG) (Interchim). After treatment, cells were collected, washed, and incubated with dyes as previously described (21). Apoptotic (A5+SG) and necrotic (A5SG+ and A5+SG+) cells were quantified using a fluorescence Olympus BX60 microscope, in comparison with living cells. At least 200 cells were counted for each cell suspension.
Flow cytometric immunolabeling assays
After treatments, macrophages were collected and centrifuged. Then, phenotypic analysis of cells was performed using flow cytometric direct immunofluorescence assays (20); cells were first incubated for 30 min in PBS with 5% human AB serum at 4°C to avoid nonspecific mAb binding, and then incubated with appropriate FITC- or PE-conjugated mAbs for 20 min at 4°C. Fluorescence related to immunolabeling was measured using a FACSCalibur flow cytometer (BD Biosciences).
Endocytosis assay
Cells were incubated with 1 mg/ml FITC-dextran for 30 min at 37°C. Cellular uptake of FITC-dextran was then monitored by flow cytometry at 525 nm. A negative control was performed in parallel by incubating cells with FITC-dextran at 4°C instead of 37°C. Uptake of FITC-dextran was expressed as
mean fluorescence intensity (MFI), i.e., MFI (uptake at 37°C) MFI (uptake at 4°C).
Phagocytosis of latex microspheres and FITC-labeled Escherichia coli
Cells were incubated with 15 µl of fluorescent latex microspheres for 30 min at 37°C. Cellular phagocytosis of latex beads was then monitored by flow cytometry at 525 nm. A negative control was performed in parallel by incubating cells with latex beads at 4°C instead of 37°C.
For studying uptake of E. coli bacteria by macrophages, a Phagotest (BD Biosciences) was used according to the instructions of manufacturer. Briefly, 20 µl of precooled FITC-labeled E. coli bacteria were added to a 100-µl suspension of macrophages. The resulting cell suspension was next incubated for 3 h at 37°C or at 4°C (controls). Cells were then washed, and 100 µl of quenching solution was added. After washings, cells were analyzed on FACSCalibur. Phagocytosis of latex microspheres or FITC-labeled E. coli was expressed as
MFI, i.e., MFI (uptake at 37°C) MFI (uptake at 4°C).
Total RNA isolation and reverse transcription-real-time quantitative PCR (RT-qPCR) assay
Total RNAs were extracted from macrophages using the TRIzol method (Invitrogen Life Technologies) and then subjected to RT-qPCR analyses as described previously (22). RT-qPCR assays were performed using the fluorescent dye SYBR Green methodology and an ABI Prism 7000 detector (Applied Biosystem). Specific primers were as follows: TNF
, forward, AACCTCCTCTCTGCCATCAA; TNF
, reverse, ATGTTCGTCCTCCTCACAGG; IL-8, forward, AAGAAACCACCGGAAGGAAC; IL-8, reverse, AAATTTGGGGTGGAAAGGTT. The specificity of each gene amplification was checked up at the end of qPCR through analysis of dissociation curves of the PCR products. Amplification curves were read with ABI Prism 7000 SDS software using the comparative cycle threshold method. Relative quantification of the steady-state target mRNA levels was calculated after normalization of the total amount of cDNA to an 18S RNA endogenous reference.
Determination of cytokine levels
Levels of TNF
and IL-8 in the supernatants of macrophage cultures were quantified using Duoset ELISA development system kits obtained from R&D Systems. Briefly, 96-well plates, initially coated with 1 µg/ml mouse anti-human TNF
or IL-8 Ab overnight at room temperature, were incubated for 2 h with macrophage culture supernatants or recombinant human TNF
or IL-8 standard. After washing, plates were processed according to the manufacturers instructions.
Analysis of F-actin expression
Monocytes were first differentiated with GM-CSF into macrophages on glass coverslips for 6 days, and then treated with As2O3. After washing, cells were fixed on coverslips with 3% paraformaldehyde in PBS for 30 min at 4°C and washed three times with PBS. Fixed cells were subsequently incubated with a blocking and permeabilizing solution (PBS, 2 mg/ml BSA, 0.2 mg/ml saponin) for 1 h at room temperature. Cells were then incubated with FITC-phalloidin (1.5 µM), to detect F-actin filaments, in blocking solution for 2 h at room temperature and washed in blocking solution. Thereafter, cells were costained with blocking solution containing 1 µg/ml 4',6'-diamidino-2-phenylindole, a fluorescent dye specific for DNA, during 15 min. After washings, coverslips were mounted with PBS-glycerol-Dabco. Fluorescent-labeled cells were captured with a DMRXA2 Leica microscope and a COOLSNAP HQ CCD camera, using Metavue software (Molecular Devices).
RhoA-GTP pull-down assay
RhoA-GTP levels were measured using the RhoA activation assay kit from Cytoskeleton (Tebu-bio). Briefly, cells were rapidly lysed at 4°C and incubated with Rhotekin-RBD affinity beads to specifically pull-down RhoA-GTP. After washing, RhoA levels were quantified by running bead/protein complexes in Laemmli buffer containing 0.1 M DTT and probing with the mouse monoclonal anti-RhoA Ab as recommended by manufacturers.
Western blot immunoassays
After treatment, macrophages were harvested and lysed on ice with lysis buffer (60 mM
-glycerophosphate, 15 mM paranitrophenylphosphate, 25 mM MOPS (pH 7.2), 15 mM EGTA, MgCl2, 1 mM NaF, 1 mM phenylphosphate, 2 mM DTT, 1 mM sodium orthovanadate, 1% protease inhibitor mixture (Roche)). Then, lysates were sonicated on ice. Protein concentration was quantified using the Bradfords method (23). A total of 50 µg of each sample was heated for 5 min at 100°C, and then analyzed by 12% SDS-PAGE, and electroblotted overnight onto nitrocellulose membranes (Bio-Rad). After blocking, membranes were hybridized with primary Abs overnight at 4°C and incubated with appropriate HRP-conjugated secondary Ab (DakoCytomation). Immunolabeled proteins were visualized by chemiluminescence.
Statistical analysis
The results are presented as means ± SEM. Significant differences were evaluated with the Students t test. Criterion of significance of the difference between means was p < 0.05.
| Results |
|---|
|
|
|---|
Blood monocyte-derived macrophages are tightly adherent cells displaying a "fried-egg"-like morphology, i.e., large spread cells with distinct nuclei (17) (Fig. 1A); these macrophages survived in GM-CSF-free culture medium for several days without alteration of their morphology. In contrast, a 6-day treatment of cultures with 1 µM As2O3 induced a time-dependent rounding of the macrophage (Fig. 1A); rounded and contracted morphology was first observed in some macrophages after 8 h; the amount of rounded macrophages was nearly maximal and stable after 72 h. Morphological effects of arsenic were dose-dependent and detectable from 0.25 µM (Fig. 1B). After a 6-day treatment with As2O3, macrophage rounding was associated with a loss of adhesion as assessed by the WST-1 assay; indeed, only 63.2 ± 6.2 and 31.3 ± 4.5% of macrophages, comparatively to untreated cells, were still adherent after treatment with 0.5 and 1 µM As2O3, respectively. Adhesion and spreading of macrophages are mainly related to reorganization of the actin cytoskeleton. In our cellular model, untreated macrophages displayed extended F-actins resembling filopodia, in their periphery, as previously reported (24). Interestingly, As2O3 induced a time-dependent reorganization of F-actin cytoskeleton in macrophages treated for 72 h (Fig. 1C). Peripheral extensions of F-actin began to retract after 8 h and formed a cortical actin ring after 24 h. As2O3-induced reorganization of F-actin was then stable for at least 72 h.
|
Contribution of direct cytotoxicity to morphological effects of As2O3 was then evaluated using the fluorescent A5 and SG probes, which detected apoptosis and necrosis, respectively. As shown in Fig. 2A, >85% of macrophages were viable after 6, 12, and 18 days of cultures in the absence or presence of 1 µM As2O3. In contrast, higher concentrations of metalloid (24 µM) decreased cell viability and specifically increased the percentage of apoptotic macrophages (A5+SG) after a 6-day treatment (Fig. 2B).
|
Besides morphology and adhesion, we next determined whether As2O3 could affect other specific features of differentiated macrophages. We first analyzed expression of some typical surface markers. Table I shows that treatment of macrophages for 6 days with 1 µM As2O3, markedly reduced expression of CD11b and CD29, two integrins involved in macrophage adhesion and spreading (25). As2O3 also decreased expression of CD71, a well-known macrophagic differentiation marker (18). In contrast, it markedly increased that of CD14, a typical marker of human blood monocytes, down-regulated by GM-CSF during macrophagic differentiation (26). However, a concentration of 1 µM As2O3 failed to modify CD11c levels, which indicates that metalloid effects were not due to a general alteration of surface markers. We then evaluated effects of As2O3 on endocytosis and phagocytosis, two major functions of macrophages. Exposure of macrophages to 1 µM As2O3 for 6 days markedly reduced endocytosis of FITC-dextran (Fig. 3A) and phagocytosis of fluorescent microspheres (Fig. 3B), when compared with untreated cells. Effect of metalloid on macrophagic functions was also evaluated using Phagotest, a true functional assay investigating phagocytosis of bacteria. As expected, uptakes of FITC-labeled E. coli by macrophages incubated at 4°C were negligible (MFI = 2). Fig. 3C demonstrates that 1 µM As2O3 significantly decreased the uptake of FITC-labeled E. coli after a 4- or 6-day treatment. We next determined whether metalloid could alter the ability of macrophages to secrete inflammatory cytokines in response to LPS, which constitutes another major function of APCs. LPS markedly enhanced secretion of both TNF
and IL-8 after 8 and 24 h (Fig. 4); concomitantly, treatment with LPS for 8 h strongly induced TNF
and IL-8 mRNA levels, as assessed using RT-qPCR assays (Table II). A treatment of 6 days with 1 µM As2O3 had no obvious effect on cytokine secretion, whereas it marginally increased TNF
mRNA levels of untreated macrophages. By contrast, it strongly potentiated secretion and mRNA level of TNF
and IL-8 induced by LPS (Fig. 4, Table II).
|
|
|
|
To determine whether effects of metalloid were reversible, we first treated macrophages with 1 µM As2O3 for 6 days; cells were then washed and cultured with GM-CSF in arsenic-free medium for another 6 days. Fig. 5A shows that withdrawal of iAs, associated with addition of GM-CSF, induced readhesion and spreading of As2O3-treated macrophages. Moreover, reversion of cell rounding was also associated with changes in surface marker expression (Fig. 5, BE). Indeed, after withdrawal of iAs and addition of GM-CSF, expressions of CD11b, CD29, and CD71, decreased in As2O3-treated macrophages, returned to levels observed in untreated macrophages; in addition, CD14 levels, up-regulated in As2O3-treated cells, were concomitantly reduced.
|
Monocytes are not only able to differentiate into macrophages but also into immature dendritic cells, in response to appropriate stimuli such as treatment with GM-CSF and IL-4 (20). Because the above results suggest that As2O3 "de-differentiated" macrophages into monocytic cells, we next analyzed whether As2O3-treated macrophages could be differentiated into dendritic cells as monocytic cells. Fig. 6A shows that macrophages previously exposed to As2O3 for 6 days and then cultured with GM-CSF and IL-4 in iAs-free medium for an additional 6 days, expressed high levels of the typical dendritic marker CD1a. This CD1a expression was similar to that found in blood monocyte-derived dendritic cells (Fig. 6A); in contrast, treatment of control macrophages with GM-CSF and IL-4 did not significantly increased CD1a expression, indicating that fully differentiated macrophages failed to yield dendritic-like cells. In addition, like blood monocyte-derived dendritic cells, and in contrast to untreated macrophages, macrophages first exposed to As2O3 and next cultured with GM-CSF and IL-4 in the absence of iAs were nonadherent (Fig. 6B).
|
The Rho-associated kinase ROCK is a major target of the small GTP-binding protein RhoA and a key signaling molecule involved in cytoskeleton regulation (27). Pretreatment of cultures with Y-27632, a specific inhibitor of ROCK (28), prevented both F-actin reorganization and cellular rounding in macrophages treated with As2O3 for 24 h (data not shown) and 72 h (Fig. 7A). In addition, Fig. 7B indicates that the ROCK inhibitor significantly prevented, although partially, alteration of phagocytosis due to As2O3 treatment. We next evaluated the effect of As2O3 on levels of the active GTP-bound form of RhoA and found that 1 µM As2O3 strongly increased its level after a treatment of 8 h (Fig. 8A). RhoA-GTP levels remained increased for at least 72 h. We finally analyzed expression of RhoGDI and ERM proteins, which are involved in the regulation of RhoA activity (29, 30). Fig. 8B shows that As2O3 did not alter protein levels of RhoGDI; in contrast, it increased levels of phospho-Moesin without affecting those of total ERM proteins (Fig. 8C). In fact, ezrin and radixin are only slightly expressed in macrophages and their phosphorylated forms were barely detected, if at all, by Western blotting. Effects of metalloid on phospho-Moesin levels were rapid and detectable as soon as 4 h.
|
|
| Discussion |
|---|
|
|
|---|
First, our results show that treatment of macrophages with 0.51 µM As2O3, two noncytotoxic concentrations, induced rapid cellular rounding and thereafter loss of adhesion. Cell rounding was tightly associated with a time-dependent reorganization of F-actin in macrophages. In fact, As2O3 induced retraction of peripheral F-actin extensions and stable formation of a cortical actin ring; interestingly, organization of F-actin cytoskeleton in arsenic-treated macrophages was very similar to that observed in freshly adherent monocytes (31). In addition, As2O3 decreased expression of the CD11b and CD29 integrins, which play a major role in adhesion, spreading, and differentiation of monocytes (32). As2O3 also decreased expression of the CD71 macrophagic marker, increased that of the CD14 monocyte marker, and markedly reduced both endocytosis and phagocytosis. Finally, like blood monocytes, As2O3-treated macrophages could be differentiated into dendritic-like cells by GM-CSF and IL-4. Our study therefore clearly demonstrated that metalloid effects on morphology and surface marker expression were reversible, thus confirming that they did not reflect a general unspecific toxicity toward macrophages.
Macrophages are known to possess functional plasticity, which allows them to adapt to changing microenvironment, notably after cytokine or LPS treatment (33). The present results suggest that human macrophages can also "de-differentiate" into monocyte-like cells when exposed to an appropriate chemical compound. This study and other recent reports highlight a marked influence of iAs on cell differentiation. Besides macrophages, iAs partially de-differentiates murine adipocytes (34); arsenite inhibits differentiation of preadipocytes and human epidermal cells likely by maintaining proliferative cell capacity during differentiation program (35, 36). We have also recently demonstrated that As2O3 totally blocks differentiation of human blood monocytes into macrophages through down-regulation of survival pathways (11). On the other hand, As2O3 was shown to promote differentiation of breast cancer cells (37) and that of acute promyelocytic leukemia cells (38). Together, these results demonstrate that iAs exerts complex effects on differentiation according to the cell type.
Different arguments support the idea that As2O3 impaired human macrophage function, at least in part, through activation of a RhoA/ROCK signaling pathway. First, our results demonstrate that the ROCK inhibitor Y-27632 prevented F-actin reorganization, cell rounding and phagocytosis inhibition in As2O3-exposed macrophages. In addition, we report that As2O3 activates the small G protein RhoA, a potent ROCK inducer. Indeed, As2O3 induces a rapid and sustained increase of RhoA-GTP levels which preceded its effects on morphology and cytoskeleton. Involvement of RhoA/ROCK in As2O3 toxicity is further strengthened by the fact that this pathway is known 1) to induce cell contraction through reorganization of actin cytoskeleton, notably in macrophages (24) and 2) to constitute a negative regulator of monocyte spreading (39). In addition, the recent observation that RhoA-activated ROCK negatively regulated phagocytosis of apoptotic cells (40) argues for a role of ROCK in As2O3-induced down-regulation of phagocytic activity. RhoA is regulated by several proteins and particularly by RhoGDI proteins, which maintain RhoA in its inactive GDP-bound form (30). DNA microarrays have revealed that arsenite can down-regulate mRNA levels of RhoGDI proteins (41, 42). However, our results show that As2O3 had no effect on RhoGDI protein levels in macrophages; in contrast, it increased those of phospho-Moesin, a member of the ERM protein family. Phosphorylation of ERM proteins favors their activation by stabilizing the active open conformation (29). Once phosphorylated, these proteins can promote dissociation of RhoGDI from RhoA and subsequent activation of RhoA (29, 30). The fact that phosphorylation of Moesin seems to precede increase of RhoA-GTP levels suggests that this ERM protein was involved in RhoA activation in As2O3-treated macrophages. Besides its effects on RhoA, iAs was also recently demonstrated to regulate actin organization through activation of the small G protein Cdc42 in murine vascular cells (43). These results thus indicate that such small G proteins constitute new molecular targets of iAs which merit further exploration.
Together with our previous study (11), the present results suggest that low micromolar concentrations (0.251 µM) of As2O3, which are relevant of arsenic blood levels measured in chronically exposed humans (15), can target the monocyte/macrophage system in humans. Indeed, our data likely indicate that iAs can reduce the pool of human functional macrophages by 1) inhibiting macrophagic differentiation of blood monocytes (11) and 2) impairing features of differentiated monocyte-derived macrophages, notably endocytosis and phagocytosis; at higher concentrations (4 µM), As2O3 also induces apoptosis of differentiated macrophages. Relevance of these mechanisms is strengthened by in vivo studies reporting a decrease of phagocytic activity and antibacterial response in mice treated with arsenite (13). However, toxicity of iAs toward macrophages appears to be complex, because As2O3 strongly increases the macrophage response to LPS. In fact, although it had no significant effect on untreated macrophages, As2O3 appears to "prime" macrophages for LPS-induced secretion of TNF
and IL-8, two major proinflammatory cytokines. The superinduction of TNF
and IL-8 mRNA levels in macrophages coexposed to LPS and iAs suggests that iAs can modulate LPS intracellular signals. Such effects may contribute to the development of iAs-related inflammation observed in chronically exposed humans (15).
Interestingly, iAs, used under its trioxide form, is an effective antileukemic drug and its concentrations in blood patients are close to those acting in vitro on macrophages (44). This indicates that macrophages, in addition to malignant cells, may also constitute targets in As2O3-treated patients, and therefore supports the idea that a careful analysis of the monocyte/macrophage compartment may be of interest in such subjects.
In conclusion, our results demonstrate that noncytotoxic concentrations of As2O3 down-regulate differentiation features of human primary macrophages likely through activation of a RhoA/ROCK pathway. Moreover, they show that human macrophages constitute by themselves sensitive targets of iAs, which may contribute to immunotoxicity of this major environmental contaminant.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by grants from Association pour la Recherche sur le Cancer and Ligue Contre le Cancer (Comité dIlle-et-Vilaine). A.L. and E.B. are recipients of a fellowship from Ligue Nationale Contre le Cancer and Ligue Contre le Cancer (Comité dIlle-et-Vilaine), respectively. ![]()
2 Address correspondence and reprint requests to Dr. Laurent Vernhet, Institut National de la Santé et de la Recherche Médicale, Unité 620, Faculté des Sciences Pharmaceutiques et Biologiques, Institut Fédératif de Recherche 140, Université de Rennes-1, 2 avenue du Professeur Léon Bernard, 35043 Rennes, France. E-mail address: Laurent.Vernhet{at}rennes.inserm.fr ![]()
3 Abbreviations used in this paper: iAs, inorganic arsenic; ERM, Ezrin/Radixin/Moesin; RhoGDI, Rho guanine dissociation inhibitor; A5, annexin V; SG, sytox green; MFI, mean fluorescence intensity; RT-qPCR, reverse transcription-real-time quantitative PCR; ROCK, Rho-associated kinase. ![]()
Received for publication November 29, 2005. Accepted for publication June 8, 2006.
| References |
|---|
|
|
|---|
B-related survival pathway down-regulation. J. Pharmacol. Exp. Ther. 316: 304-314.
expression by the environmental contaminant benzo(a)pyrene in primary human macrophages. FEBS Lett. 579: 1904-1910. [Medline]Related articles in The JI:
This article has been cited by other articles:
![]() |
A. Lemarie, E. Bourdonnay, C. Morzadec, O. Fardel, and L. Vernhet Inorganic Arsenic Activates Reduced NADPH Oxidase in Human Primary Macrophages through a Rho Kinase/p38 Kinase Pathway J. Immunol., May 1, 2008; 180(9): 6010 - 6017. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Bornhauser, L. Bonapace, D. Lindholm, R. Martinez, G. Cario, M. Schrappe, F. K. Niggli, B. W. Schafer, and J.-P. Bourquin Low-dose arsenic trioxide sensitizes glucocorticoid-resistant acute lymphoblastic leukemia cells to dexamethasone via an Akt-dependent pathway Blood, September 15, 2007; 110(6): 2084 - 2091. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |