| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Regulates Donor CD8 T Cell Expansion, Migration, and Leads to Apoptosis of Cells of a Solid Tumor1
* Trudeau Institute, Saranac Lake, NY 12983; and
Cell and Molecular Biology Program, University of Vermont, Burlington, VT 05405
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
secreted by donor cytotoxic T cell 1 (Tc1) cells was the most important factor in promoting EG7 (an OVA transfection the EL4 thymoma) rejection in mice. In this study, we show that the ability of the host to respond to Tc1-secreted IFN- is critical for promoting acute tumor rejection, while host production of IFN- is not important. CFSE-labeled wild-type and IFN--deficient Tc1 cells divide rapidly in secondary lymphoid organs, indicating no defect in rate of cell division. However, wild-type Tc1 cells accumulate to significantly greater numbers in the tumor than deficient Tc1 cells. Hosts injected with wild-type Tc1 effectors had more T cells within the tumor at day 4, had higher levels of MCP-1, IFN--inducible protein-10, MIP-1
, and MIP-1
mRNA transcripts, had greater numbers of CD11b+ and Gr-1+ cells within the tumor, and had massive regions of tumor cell apoptosis as compared with IFN- knockout Tc1 cell-treated hosts. NO has a cytostatic effect on EG7 growth in vitro, and NO is important for tumor eradication by day 22. These observations are compatible with a model in which the donor CD8 Tc1 effectors expand rapidly in the host, migrate to the tumor site, and induce the secretion of a number of chemokines that in turn recruit host cells that then attack the tumor. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
We have used the experimental transplantable tumor model E.G7OVA (EG7) (13) to study the role of adoptively transferred OT-1-transgenic CD8 cells in solid tumor rejection (14, 15). The adoptive transfer of in vitro-polarized IFN--secreting OT-1 CD8 cytotoxic T cell 1 (Tc1)4 cells were 25 times more therapeutic than IL-4-secreting OT-1 Tc2 and IFN--deficient Tc1 effectors at rejecting 7-day established tumors (14, 15).
IFN- is important for tumor rejection. It can directly act on different tumor cells to facilitate apoptosis (16, 17, 18). It can regulate angiogenesis and promote vasculature destruction leading to tumor necrosis (19, 20). Moreover, IFN--inducible NO synthetase (iNOS) generates NO, which has been shown to contribute to tumor growth and tumor destruction (21, 22, 23). Our previous findings showed that IFN- and TNF- caused apoptosis of B16 melanoma in vitro (18).
For the EG7 tumor model, we demonstrated that tumor rejection started days 2–4 after the transfer of Tc1 effectors by an initial rapid reduction in tumor size (acute phase) that lasted until days 7–14, and it was followed by a second, later phase (days 15–22) where the tumor was either eliminated or regrew (15). Adoptively transferred perforin-, Fas ligand (FasL)-, TNF-/lymphotoxin- (LT-)-, perforin/FasL-, and perforin/TNF-/LT--deficient Tc1 cells were therapeutically comparable to wild-type Tc1 cells at reducing tumor burden at day 6 after transfer and promoting tumor eradication by day 22 (15). In contrast, decreased performance of IFN--deficient Tc1 effectors was apparent starting at day 6 (15). From our previous studies, we concluded that IFN- was critical for eliminating the tumor and that contact-mediated cytolysis by the donor CD8 cells played no significant role under these conditions.
In this study, we further examine the role of donor CD8-derived IFN- in EG7 rejection and show that the host must be able to respond to IFN- for acute tumor rejection by wild-type Tc1 cells, but the host production of IFN- is not required. Adoptively transferred IFN--deficient Tc1 cells are significantly impaired at expanding in the secondary lymphoid organs and trafficking into the tumor as compared with an equivalent number of transferred wild-type Tc1 cells. Tumors from hosts treated with wild-type Tc1 cells have greater levels of MCP-1, IFN--inducible protein-10 (IP-10), MIP-1, and MIP-1 chemokine mRNAs, increased numbers of CD11b+ and Gr-1+ cells within the tumor and massive regions of apoptosis or necrosis within the center of the tumor as compared with hosts treated with IFN--deficient Tc1 cells. In this study, we show that EG7 is not sensitive to IFN- and TNF--mediated apoptosis in vitro. NO produced by iNOS can inhibit tumor growth in vitro, but is not critical for CD8-mediated acute tumor rejection. However, NO is important for solid tumor eradication by day 22. This study demonstrates that IFN- is required for efficient donor Tc1 cell expansion in secondary lymphoid organs and migration into the tumor, and that an IFN--dependent mechanism(s) induces tumor cell death leading to tumor elimination.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
C57BL/6J, B6.129S7-Ifn (IFN-–/–), B6.129P2-NOS2 (NOS2–/–) were obtained from The Jackson Laboratory or bred at the Trudeau Institute and used as recipients. The OT-1 CD8-transgenic mice were originally obtained from Dr. S. Hedrick (University of California at San Diego, La Jolla, CA). They were maintained as heterozygotes backcrossed to C57BL/6J and were used as the source of donor CD8 T cells for all experiments.
Intradermal tumor establishment
The E.G7OVA (EG7) cell line was purchased from the American Type Culture Collection. A frozen aliquot of EG7 was thawed and grown for every experiment. Cells were harvested at mid-log phase and 3 x 106 EG7 were injected intradermally into the shaved right flank of mice to establish the tumor (15).
Tumor measurement and conditional survival
Every 2 days, tumors were measured on two perpendicular axes using a Vernier caliper. A measure of tumor size was calculated by multiplying the measured lengths. Mice were considered moribund and were sacrificed when tumor sizes reached 19 mm in diameter.
Tc1 cell generation
CD8 Tc1 cells were generated as previously described (15). In short, naive OT-1 cells were isolated using the MACS system (Miltenyi Biotec) and cultured in RPMI 1640 (Invitrogen Life Technologies) supplemented with penicillin, glutamine, 2-ME, and 7% FCS (HyClone) with 3-day LPS-stimulated B cell blasts loaded with the SIINFEKL peptide (11 µM) and treated mitomycin c (Sigma-Aldrich). Tc1 cells were 98–99% CD8+V8+ at day 4. Varying numbers of OT-1 Tc1 cells were injected i.v. via tail vein in 0.5-ml volumes of sterile PBS.
EG7 in vitro cultures
Peritoneal cells from wild-type and NOS2–/– hosts were isolated in PBS and allowed to adhere to flasks for 30 min at 37°C. Flasks were washed three times with PBS and 1 x 105 EG7 cells were cultured in ± 1000 U of IFN- and 25 ng of TNF- (PeproTech). The Griess assay, for nitrite detection, was performed on supernatants at 24-h intervals from the above cultures. Fifty microliters of supernatants was incubated in the presence of 50 µl of 1% sulfanilamide (Sigma-Aldrich) in 2.5% phosphoric acid (Sigma-Aldrich) and 50 µl of 0.1% naphthylethylenediamine dihydrochloride (Sigma-Aldrich) in 2.5% phosphoric acid. Samples were analyzed at OD550.
FACS analysis
Secondary lymphoid organs were isolated, processed into single-cell suspensions, counted using a Coulter AcT10 (Beckman Coulter), and stained with Thy1.1-PE or CD45.2-PE and CD8-allophycocyanin (BD Biosciences). Propidium iodide (Sigma-Aldrich) was added to each sample before flow analysis using a FACSCalibur (BD Biosciences) to identify live cells. For cell division studies, Tc1 cells were labeled with CFSE (Molecular Probes). Flow data were analyzed using FlowJo software (Tree Star).
Histology
For frozen sections, tumors were excised, embedded in Tissue-Tek OTC compound (Sakura Finetek) and quickly frozen with liquid nitrogen. Five- to 7-µm frozen tissue sections were acetone fixed, washed three times with PBS, and blocked with a Vector avidin/biotin blocking kit (Vector Laboratories). Normal serum was used to block nonspecific Ab binding. Tissue sections were stained with anti-Thy1.1-biotin (BD Biosciences) for detecting donor T cells. Anti-CD11b (eBioscience) and anti-Gr-1 (Ly6G; RB6-8C5 clone) Abs were used with rat anti-mouse H+L-biotin (Jackson ImmunoResearch Laboratories). Vectastain Elite ABC and AEC peroxidase kits (Vector Laboratories) were used for histochemistry. Images were captured using a Zeiss Axiophot 2 microscope with Axiophan 4.4 software (Zeiss Microscopes). For donor T cells, x100 magnification photographs were analyzed using MetaMorph Image Analysis software (Universal Imaging) at the University of Vermont (24). For paraffin sections, tumors from wild-type hosts were treated with various concentrations of wild-type or IFN--deficient Tc1 cells. Tumors were excised, formalin fixed, and embedded. Five- to 7-µm sections were stained with H&E Y (Sigma-Aldrich).
TaqMan analysis
Total RNA was isolated from tumor tissue using a phenol-chloroform (Sigma-Aldrich) extraction method. Samples were RQ1 DNase (Promega) treated and phenol-chloroform extracted. Three micrograms of total RNA was reverse transcribed into cDNA using SuperScript II reverse transcriptase (Invitrogen Life Technologies). The ABI Prism 7700 Sequence Detector was used to collect raw data for different primer and probe sets, and data were analyzed using Sequence Detection System version 1.7a software (Applied Biosystems). Drs. S. Smiley and P. S. Adams designed the primers and probes (Trudeau Institute, Saranac Lake, NY). MCP-1 (CCL2) forward primer: CAGCAGCAGGTGTCCCAAA, reverse primer: TGTCTGGACCCATTCCTTCTTG and probe TAGTTTTTGTCACCAAGCTCAAGAGAGAGGTCTGT. MIP-1 (CCL3) forward primer: TTTTGAAACCAGCAGCCTTTG, reverse primer: TTGGAGTCAGCGCAGATCTG and probe: TCCCAGCCAGGTGTCATTTTCCTGA. MIP-1 (CCL4) forward primer: ACCAGCAGTCTTTGCTCCAAG, reverse primer: TGTACTCAGTGACCCAGGGCT and probe TGTGGTATTCCTGACCAAAAGAGGCAGACAG. IP-10 (CXCL10) forward primer CTGCCGTCATTTTCTGCCTC, reverse primer CACTGGCCCGTCATCGATAT and probe CGCAAGGACGGTCCGCTGC. GAPDH forward primer CTCGTCCCGTAGACAAAATGG, reverse primer AATCTCCACTTTGCCACTGCA and probe CGGATTTGGCCGTATTGGGCG.
Graphing and statistics
Data were imported into Prism 4 (GraphPad Software) for graphing and statistical analyses using the Student paired t and Fisher’s exact tests.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
KO hosts
Our previous finding showed that wild-type Tc1 cells rejected 7-day established EG7 tumors in a dose-dependent manner (14, 15). We now investigated whether host IFN- production was important for rejection. Seven-day tumor-bearing wild-type and IFN-KO C57BL/6 hosts were injected with various numbers of Tc1 cells or PBS and monitored for reduction in tumor size. The transfer of 3 x 106, 1 x 106, and 3 x 105 Tc1 effectors (Fig. 1, A–C, respectively) promoted acute tumor rejection, while 1 x 105 Tc1 cells (Fig. 1D) slowed tumor growth as compared with PBS-treated hosts (Fig. 1E). Donor Tc1 cell performance was comparable over the titration range for wild-type or IFN-KO hosts at day 6 after transfer as shown by taking the tumor averages for each group and dividing them by the PBS control group (Fig. 1F). We detected between 50 and 65% decreases in tumor burdens as compared with PBS control (Fig. 1F). We conclude that host-secreted IFN- plays no essential role in tumor rejection.
|
is important for tumor rejection
Next, we investigated whether the host needed to respond to IFN- for tumor rejection. Seven-day tumor-bearing wild-type and IFN-RKO hosts were injected with various numbers of wild-type Tc1 cells or PBS and monitored for the reduction in tumor size. Tumor rejection by donor Tc1 cells was impaired in IFN-RKO hosts over the entire titration range. Injection of 3 x 106 Tc1 cells (Fig. 2A) into IFN-RKO hosts provided the greatest reduction in tumor size, but was still significantly different (**, p < 0.01) from wild-type hosts. Adoptively transferred 1 x 106, 3 x 105, and 1 x 105 Tc1 effectors (Fig. 2, B–D) provided no protection with inhibiting tumor growth and a vast majority of the IFN-RKO hosts were conditionally sacrificed by day 6 after treatment, preventing a statistical analysis with the wild-type hosts groups. Moreover, we observed that tumor growth was significantly faster (*, p < 0.05) for IFN-RKO hosts as compared with wild-type hosts, with six of seven mice being euthanized by day 6, the one remaining mouse caused the dip in the tumor growth curve (Fig. 2E). Overall, IFN-RKO hosts injected with Tc1 cells were less able to promote reduction in tumor burden at day 6 as compared with wild-type hosts (Fig. 2F). We conclude that IFN-RKO hosts are inherently less able to control tumor growth, and donor Tc1 cell therapy is significantly compromised at initiating acute tumor rejection when the host is unable to respond to CD8-secreted IFN-.
|
Hamaoka’s group (25) demonstrated that tumor-specific CD8 T cells were generated in tumor-bearing IFN-KO hosts, but the T cells failed to enter the tumor. Our previous findings showed that IFN--deficient Tc1 cells were 25 times less effective than wild-type Tc1 effectors at promoting tumor rejection (14, 15). We postulated that donor IFN-KO Tc1 effectors were unable to enter the tumor or they were unable to initiate the IFN--dependent acute tumor rejection mechanism(s) once within the tumor.
To test this hypothesis, 7-day tumor bearing wild-type hosts (Thy1.2) were injected with 1 x 106 or 3 x 105 Tc1 cells (Thy1.1), and spleen and draining lymph nodes (DLN) were harvested at days 1, 2, 4, and 6 after treatment to determine the absolute donor T cell numbers in each organ. The injection of 1 x 106 wild-type Tc1 (
) cells expanded significantly better (**, p < 0.01) in the spleen (Fig. 3A), but not in the DLN (Fig. 3C), as compared with IFN--deficient Tc1 cells (
) at day 4. Both donor T cell populations were not significantly different from one another at day 6. The injection of 3 x 105 wild-type Tc1 cells (•) expanded significantly better (Fig. 3B, spleen, and D, DLN, p < 0.01) than did IFN--deficient Tc1 cells (
) at day 4, but both donor T cells groups were not significantly different at day 6. Moreover, wild-type Tc1 cells peaked at day 4 and then declined, while IFN--deficient Tc1 effectors continued to accumulate in the secondary lymphoid organs. The number of donor T cells within the DLN after the transfer of 3 x 105 donor T cells was not always significantly different between the wild-type and IFN-KO Tc1 effectors (three independent experiments), but the two donor T cell populations were significantly different in the spleens in these studies.
|
KO Tc1 cell numbers could be due to their failure to divide or failure to survive. To address this, CFSE-labeled donor Tc1 cell populations were adoptively transferred into 7-day tumor-bearing hosts, and cell division, indicated by the reduction in intensity of CFSE dye, was monitored by flow analysis. As shown in Fig. 3, E–H, both wild-type (line) and IFN-KO (filled) Tc1 effectors divide rapidly in secondary lymphoid organs. There appeared to be a slight slowing of cell division for IFN-KO Tc1 cells for one of the two experiments (Fig. 3), but this was not statistically significant. Moreover, donor T cells transferred into non-tumor-bearing hosts also undergo rapid cell division and become CFSE negative comparable to being injected into tumor-bearing hosts (Fig. 3, I and J). We conclude that CD8-secreted IFN- is important for the accumulation of donor T cells in secondary lymphoid organs, but it is not because of an altered rate of cell division.
More wild-type Tc1 cells are within the tumor than IFN-KO Tc1 cells
We next investigated the rate of trafficking of donor T cells into the tumor, using immunohistochemical analysis on frozen tissue sections. The average areas of four to six different tissue sections were semiquantitatively measured using Metamorph software. At day 2, donor T cells were absent from the tumor, which is consistent with the kinetic data showing that very low numbers of donor T cells are detected in secondary lymphoid organs by flow analysis (Fig. 3). Tumors from hosts treated with 1 x 106 wild-type Tc1 cells had an average area of 285 ± 11 µm2 at day 4 (Fig. 4A) and 216 ± 120 µm2 at day 6 (data not shown), while tumors from hosts treated with 1 x 106 IFN--deficient Tc1 effectors had 65 ± 25 µm2 at day 4 (Fig. 4C) and 39 ± 39 µm2 at day 6 (data not shown). Transfer of 3 x 105 wild-type Tc1 cells had 85 ± 30 µm2 at day 4 (Fig. 4B) and 46 ± 31 µm2 at day 6 (data not shown), while the transfer of 3 x 105 IFN--deficient Tc1 cells had 3 ± 2 µm2 at day 4 (Fig. 4D) and no detectable amount over PBS control tumors at day 6 (data not shown). However, we detected trace numbers of donor Tc1 cells within the tumor by visual inspection.
|
, and MIP-1 mRNA transcripts detected as compared with similar treatments with IFN--deficient Tc1 effectors. Maximum induction of chemokine mRNAs occurred at day 4 after transfer and correlates with maximum number of donor T cells within the tumor (Fig. 4). Recipients injected with 1 x 106 wild-type Tc1 cells had 2- to 5-fold increases in the four different chemokine transcripts as compared with hosts injected with 1 x 106 IFN- Tc1 cells. Moreover, hosts treated with 3 x 105 wild-type Tc1 effectors had 4- to 27-fold increases in chemokine transcripts as compared with injection of similar number of IFN-KO Tc1 cells. The induction of chemokine synthesis may be crucial for the recruitment of donor T cells and host antitumor cells to the tumor, and to bring about tumor rejection. However, we cannot rule out the possibility that induction of chemokine transcripts is a secondary result caused by the tumor rejection process, because the tumor is undergoing involution.
|
-deficient Tc1 group, while the concentration of CD11b+ cells within the tumor for the 3 x 105 IFN--deficient Tc1 cell treatment group appears similar to PBS treatment (Fig. 5, A–E). Gr-1+ cells appear throughout the tumor mass, but high concentrations of Gr-1+ cells appear at the bottom of the tumor in all of the groups, and they appear to be causing tumor destruction (Fig. 5, F–J).
|
KO Tc1 cells (Fig. 5, N and S), and 3 x 105 IFN-KO Tc1 cells (Fig. 5, O and T) had large tumors, and the tumor cells were large in size, very closely packed together, and their nuclear chromatin was spread out. However, hosts treated with wild-type Tc1 cells showed signs of involution (Fig. 5, G, L, and M). Hosts injected with 1 x 106 wild-type Tc1 cells had tumor cells that were small in size, rounded up with highly dense nuclei (Fig. 5Q). Apoptotic debris was located throughout the dark blue-stained mass, while lighter stained regions appeared to be tumor free. Hosts injected with 3 x 105 wild-type Tc1 cells had tumor cells still very closely packed together, and nuclear chromatin spread out without signs of cell death juxtaposed regions with tumor cell death (Fig. 5R). The changes in cell morphology were observed starting at day 4 for the wild-type Tc1 cell-treated groups, but showed little tumor involution at this time (Fig. 5, A–E). At day 6, clear evidence of massive tumor destruction is present for the wild-type Tc1-treated groups (Fig. 5, Q and R).
In summary, IFN-KO Tc1 cells divide to a similar extent as wild-type Tc1 cells, are impaired in their ability to accumulate in secondary lymphoid organs, and are reduced in cell numbers within the tumor. Wild-type Tc1 cells induce greater quantities of MCP-1, IP-10, MIP-1, and MIP-1 chemokine mRNAs than IFN-KO Tc1 effectors. Moreover, wild-type Tc1 cells induce a mechanism leading to cell death within the tumor, which is not observed in hosts injected with IFN-KO Tc1 cells. We conclude that all of these factors contribute to why IFN-KO Tc1 effectors are 25 times less effective than wild-type Tc1 effectors at promoting EG7 rejection.
EG7 growth is slowed by NO in vitro
We investigated whether IFN- and TNF- can directly act on EG7 to inhibit its growth in vitro. As shown in Fig. 6, EG7 growth was not compromised when grown in the presence of 1000 U of IFN- and 25 ng of TNF- () as compared with EG7 cells alone (). We cultured EG7 cells in the presence of peritoneal adherent cells (PAC) from normal C57BL/6 hosts (•) and with IFN- (), TNF- (
), or IFN- and TNF- (
). EG7 growth is significantly impaired (p < 0.05) when cultured in the presence of PAC, IFN-, and TNF-, while all other groups were not significantly different (Fig. 6A). The Griess assay was used to determine nitrite, a by-product of NO (Fig. 6B). We detected nitrite levels for EG7, PAC, and IFN- () and EG7, PAC, IFN-, and TNF- (), but not for any other group including EG7, IFN-, and TNF- (), indicating that our tumor cell line does not generate NO under these conditions.
|
, and TNF- (), but not with NOS2–/– PAC with () and without IFN- and TNF- (•) or wild-type PAC without cytokines (). EG7 cells cultured with wild-type PAC, IFN-, and TNF- was the only sample that produced nitrite (Fig. 6D). We conclude from these analyses that NO can slow tumor growth in vitro. Host NO is important after acute tumor rejection to prevent tumor regrowth
We next tested the importance of NO for acute tumor rejection by treating wild-type () and NOS2–/– () hosts with various concentrations of Tc1 cells and found that transfer of 3 x 106 Tc1 cells were comparable at promoting acute tumor rejection (Fig. 7A). However, NOS2–/– hosts treated with 1 x 106 Tc1 cells showed significant impairment (p < 0.05) in tumor rejection at days 8 and 10 as compared with wild-type hosts (Fig. 7B). Wild-type and NOS2–/– hosts treated with 3 x 105 Tc1 cells (Fig. 7C) showed slowing of tumor growth as compared with PBS-treated hosts (Fig. 7D).
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
, or LT- or combinations, such as perforin and FasL, perforin/FasL, and perforin/TNF were as effective as wild-type Tc1 cells and direct lytic effects on the tumor target did not seem to be involved, except perhaps at very high numbers of Tc1 effectors (15). In contrast, CD8 T cell-mediated tumor rejection was dependent on IFN- secretion by the adoptively transferred T cells (14, 15).
In the studies presented here, we have established the following additional facts. First, the host must be able to respond to IFN- because tumor rejection is severely compromised in IFN-RKO recipients, suggesting that a direct action of IFN- on the tumor cells themselves is not sufficient for rejection (Fig. 2). The fact that high concentrations of IFN- or IFN- plus TNF- did not affect tumor growth in vitro further reinforces this conclusion (Fig. 6A). This is in contrast to our previous findings with B16 melanoma (18) and the findings of other investigators in some other tumor models (19, 29, 30, 31, 32). Second, the donor CD8 T cell-mediated rejection is not dependent on host-secreted IFN- because tumor rejection was as effective in IFN-KO hosts as in wild-type hosts (Fig. 1). Third, the expansion of IFN-KO Tc1 cells in the host appeared to be somewhat compromised. The numbers of donor T cells found in the spleen 4 days after transfer was significantly depressed compared with wild-type cells (Fig. 3, A and B). This did not appear to be due to a difference in the rate of cell division because CFSE-labeled IFN-KO Tc1 cells divided as fast as wild-type Tc1 cells (Fig. 3, E–J). There was a marked reduction in the numbers of donor Tc1 cells that entered the tumor when IFN-KO Tc1 effectors were used (Fig. 4), and this can clearly contribute to the reduced therapeutic efficacy of the deficient T cells. Adoptively transferred wild-type and IFN-KO Tc1 effectors divide rapidly even in the absence of tumor Ag (Fig. 3, I and J), consistent with our previous finding in the influenza model (33). However, it is unclear why IFN-KO Tc1 effectors enter the tumor less rapidly, because this does not occur in the influenza model (34). Fourth, there was a marked reduction in the induction of message for a number of chemokines, including the IFN-inducible IP-10 (Table I). This could be consequence of two factors: 1) the lower number of Tc1 effectors migrating to the tumor site and 2) the inability of the Tc1 effectors to secrete IFN- once they arrived. It is also possible, however, that the chemokine message came from cells recruited to the tumor following tumor cell damage and were thus a more indirect result of the donor T cell deficiency. All three mechanisms could be operating, but our data does not allow us to resolve this issue.
These four observations are compatible with a model in which the donor CD8 Tc1 effectors expand rapidly in the host, migrate to the tumor site and induce the secretion of a number of chemokines that in turn recruit host cells that then attack the tumor.
Compatible with this model was the fact that large numbers of CD11b+ (expressed on macrophages, Fig. 5, A–E) and Gr-1+ cells (expressed on neutrophils, Fig. 5, F–J) are recruited to the tumor, and that fewer cells are seen following adoptive therapy with IFN-KO Tc1 effectors. It is very difficult to quantitate these differences, as the recruited Gr-1+ and CD11b+ cells are not distributed uniformly throughout the tumor mass. We observe Gr-1+ cells at the bottom of the tumor in all the tumor sections and they appear to be destroying the tumors (Fig. 5, F–J). Our preliminary studies using Ab depletion of Gr-1+ cells (RB6-8C5 clone) indicate that timing of Ab administration is critical, with day 4 appearing to be the most effective in blocking CD8-mediated acute tumor rejection (data not shown). However, we also observed a reduction in donor T cells in secondary lymphoid organs, which could account for the decrease in therapeutic efficacy of the donor Tc1 cells. Therefore, our data are inconclusive as to how important Gr-1+ cells are for EG7 rejection. We see pockets of normal and dead tumor tissues in mice treated with 3 x 105 wild-type Tc1 effectors (Fig. 5R). We speculate that these regions of nonapoptotic tumor cells lead to the tumor regrowth seen after treatment with low numbers of effectors.
The actual mechanism of tumor destruction remains unclear. NO plays many different biological roles including stimulation of cell growth, apoptosis, and angiogenesis, and inhibits blood clotting (22, 35, 36, 37). Brindle’s group (38) recently reported that tumor-derived NO was an important mechanism for rejection of their EG7 cell line, and that other reactive oxygen species including peroxynitrite can be generated and might be involved. Our EG7 cell line does not produce NO in the presence of 1000 U of IFN- and 25 ng of TNF- (Fig. 6B, ), yet under these same conditions PAC are activated to generate NO (Fig. 6B, ). We observed that host-derived NO through iNOS is important for tumor eradication (Table II). CD11b+ and Gr-1+ cells have the ability to generate NO in addition to superoxide, hydrogen peroxide, and hydrogen chloride (39), and they might be the host cells responsible for NO production.
At least three distinct EG7 tumor cell lines can be identified upon careful review of the literature. One EG7 cell line was unable to stimulate CFSE-labeled naive OT-1 cells to divide, but hosts injected with naive OT-1 cells and SIINFEKL-pulsed dendritic cells promoted rejection (27, 40). Mescher’s groups (28, 41) have shown that the injection of naive OT-1 CD8 T cells expand in the peritoneal cavity, where their EG7 cell line (CD4–) was implanted. The donor CD8 T cells reduce the tumor burden before migrating to the DLN, but fail to reject the tumor unless the hosts are treated with IL-2 or anti-CTLA-4 therapy. The EG7 tumor (CD4–) was not rejected when the host was treated with naive OT-1 cells and SIINFEKL-pulsed dendritic cells (40). A third EG7 cell line, which expresses CD4 and was used in these studies, can stimulate naive OT-1 cells to divide, but fails to be rejected by 107 naive OT-1 cells (our unpublished observation). Our finding demonstrates that a robust expansion of donor Tc1 effectors occurs in the spleen and DLN, and the highest numbers of donor T cells enter the tumor at day 4, which is at the peak time of the donor T cell accumulation in secondary lymphoid organs (Figs. 3 and 4). We speculate that the anatomical site of tumor growth is very important in determining what host antitumor cells are involved in assisting donor T cells in controlling and eradicating the tumor. The ability to expand in secondary lymphoid organs, and T cell trafficking and recruitment of host cells to the tumor site might explain the difference observed in therapeutic efficacy of CD8 T cell therapy when using different EG7 cell lines.
The principal conclusion from our study is that multiple mechanisms contribute to EG7 tumor eradication. Compromising IFN- production by donor Tc1 cells decreases the therapeutic efficacy of treatment in the initiation of acute tumor rejection and the ability of the host to eliminate the solid tumor through several IFN--dependent mechanisms. Our data suggest that a clearer understanding of the type of malignancy and site of growth and immune competence of the host is required for the successful use of adoptive CD8 cell immunotherapy in cancer patients.
|
Acknowledgments |
|---|
|
Disclosures |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
Footnotes |
|---|
1 This work was supported by National Institutes of Health Grant CA71833 and the Trudeau Institute. 
2 Current address: Department of Immunology, Sidney Kimmel Cancer Center, San Diego, CA 92131.
3 Address correspondence and reprint requests to Dr. Richard W. Dutton, Trudeau Institute, 154 Algonquin Avenue, Saranac Lake, NY 12983. E-mail address: dutton{at}northnet.org
4 Abbreviations used in this paper: Tc, cytotoxic T cell; iNOS, IFN--inducible NO synthase; IP-10, IFN--inducible protein-10; FasL, Fas ligand; LT-, lymphotoxin-; KO, knockout; DLN, draining lymph node; PAC, peritoneal adherent cell.
Received for publication March 16, 2006. Accepted for publication June 7, 2006.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
(TNF-) and interferon- (IFN-) on human pancreatic tumor cell lines. Pancreas 3: 180-188. [Medline] in cancer immunotherapy. Immunol. Res. 24: 201-210. [Medline] in early and late stages of type 1 CD8 effector cell-mediated tumor rejection. Clin. Immunol. 98: 70-84. [Medline]-mediated angiostasis for tumor rejection by CD8+ T cells. Cancer Res. 63: 4095-4100. (IFN-) in tumor immunity: T cells with the capacity to reject tumor cells are generated but fail to migrate to tumor sites in IFN--deficient mice. Cancer Res. 61: 3399-3405. in CD8 T cell-mediated immune responses against B16.F10 melanoma cells expressing a viral antigen. Eur. J. Immunol. 30: 2507-2515. [Medline] can promote tumor evasion of the immune system in vivo by down-regulating cellular levels of an endogenous tumor antigen. J. Immunol. 165: 5502-5508. in protection against tumor development and cancer immunoediting. Cytokine Growth Factor Rev. 13: 95-109. [Medline] is required for successful antigen-specific immunotherapy of a transplantable mouse tumor model for HPV-transformed tumors. Cancer Immunol. Immunother. 54: 477-488. by influenza hemagglutinin-specific CD8 effector T cells influences the development of pulmonary immunopathology. Am. J. Pathol. 158: 119-130. This article has been cited by other articles:
|
|
 |
|
  C. M. Capitini, S. Herby, M. Milliron, M. R. Anver, C. L. Mackall, and T. J. Fry Bone marrow deficient in IFN-{gamma} signaling selectively reverses GVHD-associated immunosuppression and enhances a tumor-specific GVT effect Blood, May 14, 2009; 113(20): 5002 - 5009. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Y. Gerner and M. F. Mescher Antigen Processing and MHC-II Presentation by Dermal and Tumor-Infiltrating Dendritic Cells J. Immunol., March 1, 2009; 182(5): 2726 - 2737. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Simma, E. Zebedin, N. Neugebauer, C. Schellack, A. Pilz, S. Chang-Rodriguez, K. Lingnau, E. Weisz, E. M. Putz, W. F. Pickl, et al. Identification of an Indispensable Role for Tyrosine Kinase 2 in CTL-Mediated Tumor Surveillance Cancer Res., January 1, 2009; 69(1): 203 - 211. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Tatum, L. M. Mylin, S. J. Bender, M. A. Fischer, B. A. Vigliotti, M. J. Tevethia, S. S. Tevethia, and T. D. Schell CD8+ T Cells Targeting a Single Immunodominant Epitope are Sufficient for Elimination of Established SV40 T Antigen-Induced Brain Tumors J. Immunol., September 15, 2008; 181(6): 4406 - 4417. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. B. Swann, M. D. Vesely, A. Silva, J. Sharkey, S. Akira, R. D. Schreiber, and M. J. Smyth Demonstration of inflammation-induced cancer and cancer immunoediting during primary tumorigenesis PNAS, January 15, 2008; 105(2): 652 - 656. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Zhang, A. Barber, and C. L. Sentman Chimeric NKG2D Modified T Cells Inhibit Systemic T-Cell Lymphoma Growth in a Manner Involving Multiple Cytokines and Cytotoxic Pathways Cancer Res., November 15, 2007; 67(22): 11029 - 11036. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Hwang, J. R. Lukens, and T. N. J. Bullock Cognate Memory CD4+ T Cells Generated with Dendritic Cell Priming Influence the Expansion, Trafficking, and Differentiation of Secondary CD8+ T Cells and Enhance Tumor Control J. Immunol., November 1, 2007; 179(9): 5829 - 5838. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Boissonnas, L. Fetler, I. S. Zeelenberg, S. Hugues, and S. Amigorena In vivo imaging of cytotoxic T cell infiltration and elimination of a solid tumor J. Exp. Med., February 19, 2007; 204(2): 345 - 356. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) hosts were injected with 3 x 106 (A) 1 x 106 (B), 3 x 105 (C), 1 x 105 (D) Tc1 cells or PBS (E). The percent reduction in tumor volume measured at day 6 is plotted against the log10 of the number of Tc1 cells transferred (F). Mean ± SD are plotted; n = 7. *, p < 0.05; **, p < 0.01. The p values refer to the differences observed on day 6. Data are representative of one of two experiments.
