The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, X. S.
Right arrow Articles by Frazer, I. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, X. S.
Right arrow Articles by Frazer, I. H.
The Journal of Immunology, 2006, 177: 2873-2879.
Copyright © 2006 by The American Association of Immunologists, Inc.

Overcoming Original Antigenic Sin to Generate New CD8 T Cell IFN-{gamma} Responses in an Antigen-Experienced Host1

Xiao Song Liu2, Joanne Dyer, Graham R. Leggatt, Germain J. P. Fernando, Jie Zhong, Ranjeny Thomas and Ian H. Frazer

Centre for Immunology and Cancer Research, Princess Alexandra Hospital, University of Queensland, Woolloongabba, Brisbane, Australia


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The failure to mount effective immunity to virus variants in a previously virus-infected host is known as original antigenic sin. We have previously shown that prior immunity to a virus capsid protein inhibits induction by immunization of an IFN-{gamma} CD8+ T cell response to an epitope linked to the capsid protein. We now demonstrate that capsid protein-primed CD4+ T cells secrete IL-10 in response to capsid protein presented by dendritic cells, and deviate CD8+ T cells responding to a linked MHC class I-restricted epitope to reduce IFN-{gamma} production. Neutralizing IL-10 while delivering further linked epitope, either in vitro or in vivo, restores induction by immunization of an Ag-specific IFN-{gamma} response to the epitope. This finding demonstrates a strategy for overcoming inhibition of MHC class I epitopes upon immunization of a host already primed to Ag, which may facilitate immunotherapy for chronic viral infection or cancer.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Original antigenic sin described failure to mount an immune response to type-specific epitopes of a new influenza virus (flu) in individuals already immune to previously encountered strains (1). Passive transfer of primed thymus-derived lymphocytes showed a role for T cells in regulating the response to new epitopes of flu (2), shortly after the recognition of the importance of thymus-derived lymphocytes in the immune response. However, mechanisms responsible for selection of the B cell repertoire responsive to a particular influenza virus remain uncertain, and hypotheses generally relate to selective activation by further Ag exposure of B cell clones cross-reactive with new epitopes that were primed by the original infection (3). "Original antigenic sin" has more recently described selective activation of CTLs specific for previously encountered epitopes of a virus, following challenge with a heterologous strain presenting mutant variants of those epitopes that would otherwise invoke a different T cell repertoire (4). This T cell variety of original antigenic sin is, like the B cell variety, Ag driven, and is demonstrable for a number of pairs of related viral protein epitopes. It also results in impaired clearance of the second encountered virus. The cellular basis of T cell original antigenic sin, as for the B cell variety, has been attributed to T cells primed by the original epitope and sufficiently cross-reactive with the modified epitope to be expanded (5), although not sufficiently cross-reactive to be effective effector cells, which is an unsatisfactory explanation from a molecular perspective.

MHC class I-restricted peptide epitopes, when delivered linked to a papillomavirus (PV)3 viral capsid as chimeric virus-like particles (cVLPs), engender CD8+ T cell cytotoxic and IFN-{gamma} responses (6, 7, 8). Recently, we and others (9, 10) have demonstrated that the CD8+ T cell response is not induced if the immunized animal has prior immunity to the PV capsid. This observation suggested that failure to develop a CD8-restricted T cell response to a novel viral epitope might have another explanation besides clonal selection, as in our system the novel CTL epitope is not related to any epitope of the original viral capsid immunogen. Inhibition of CD8+ T cell responses was observed in µMT mice lacking B cells, and thus did not require Ab to the virus capsid, or Ag-experienced B cells. Furthermore, IL-10–/– mice develop CD8+ T cells specific for a novel epitope on cVLP despite prior PV capsid-specific immunity, in contrast to IL-10+/+ mice (10). Thus, immunization with VLPs, which matures dendritic cells (DC) (11, 12) and induces VLP-specific Th and CD8+-restricted responses (6, 7, 8), may also promote induction of IL-10-dependent regulatory T cells, which impair CD8+ T cell induction or function. Immunization with cVLPs in consequence provides an opportunity to shed further light on the cellular mechanisms underlying original antigenic sin. In this study, we show that immunization with PV VLPs induces VLP-specific IL-10-secreting CD4+ T cells, which inhibit development of Ag-specific CD8+ T cells in response to a subsequent immunization with PV cVLPs. VLP-specific CD4+ T cells secrete IL-10 upon contact with DCs, and these educated DCs favor induction of CD8+ T cells that reduce the production of IFN-{gamma}. Significantly, delivery of cVLPs in combination with temporary neutralization of IL-10 either in vitro or, more practically for immunotherapy, in vivo allows restoration of the ability to mount a CD8 IFN-{gamma} response following appropriate immunization.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice

Four- to 8-wk-old adult female C57BL/6 (H-2b) mice were purchased specific pathogen free from the Animal Resource Centre, and human PV (HPV) 16 E7 (RAHYNIVTF) MHC class I-restricted TCR beta-chain transgenic mice (E7 TCR transgenic mice) on a C57BL/6 background were produced in the laboratory as described elsewhere (13) and are used as effector cells in all of the in vitro experiments. Mice were kept under specific pathogen-free conditions throughout, and all experiments were approved by and performed in compliance with the guidelines of the University of Queensland Animal Experimentation Ethics Committee.

Cell lines, peptides, and Abs

Spodoptera frugiperda (Sf-9) cells (Life Technique) were maintained in Sf-900 II medium with Sf-9 II Supplement (Life Technique) and 10% FBS (CSL) at 27°C. Anti-IL-10R hybridoma (3B1.3a) was provided by Dr. W. Britton (Centenary Institute, Sydney, Australia) and was maintained in RPMI 1640 (Invitrogen Life Technologies) with 10% FBS.

For production of anti-IL-10 mAb and anti-CD25 mAb (PC61), hybridoma cells were cultured in RPMI 1640 with 1% FBS for 72 h, and supernatants were collected and passed through a protein G column (Sigma-Aldrich) and eluted by running 100 mM glycine (Sigma-Aldrich) through the column. Eluted Abs were dialyzed extensively against PBS (0.15 M NaCl; 0.02 M PO4 (pH 7.4)), and the concentration of Ab was measured as described previously (10).

Anti-CD4 mAb (GK1.5) and anti-CD8 mAb (2.43) were produced from mouse ascites. Anti-CD4-FITC mAb (RM4-4), FITC rat IgG2a (R35-95), anti-IL-10 mAb (JES5-16E3), anti-Gr-1 mAb (RB6-85C), anti-CD45R/B220 mAb (RA3-6B2), and anti-CD16/CD32 mAb Fc{gamma}II/III (2.4G2), and anti-CD25-FITC (7D4) were purchased from BD Pharmingen. Anti-CD4-PE (RM 4-5) was purchased from eBioscience.

The MHC class I (H-2Db)-restricted HPV16 E7 peptide RAHYNIVTF, and OVT (ISQAVHAAHAEINEAGR), a MHC class II (H-2Db)-restricted OVA peptide 323-39, were synthesized and purified by Chiron Mimotopes. CpG (ODN-1826) containing two CpG motifs (TCCATGACGTTCCTGACGTT) was synthesized by GeneWorks. A GST E7 protein was produced as described previously (14). Aluminum hydroxide gel (alum) was purchased from Superfos Biosector, and IFA was obtained from Sigma-Aldrich.

Isolation of mouse mononuclear cells and flow cytometric analysis

Isolation of mouse blood mononuclear cells was performed by density gradient centrifugation. Briefly, 200 µl of venous blood was added to PBS containing 0.2% EDTA Na2 (Sigma-Aldrich) and overlaid to 1 ml of Histopaque (Sigma-Aldrich). After centrifugation at 400 x g for 15 min at 22°C, the interlayer was washed extensively with PBS containing 0.1% BSA and 0.1% NaN3, then exposed to FITC-conjugated mAb at room temperature for 15 min, and analyzed using a BD Biosciences FACSCalibur flow cytometer and CellQuest (BD Biosciences) software.

Production of recombinant VLPs

VLPs of various PVs were produced using recombinant baculoviruses encoding the L1 protein of HPV 6b (HPV6bL1 VLPs), bovine PV (L1VLPs), or a synthetic fusion protein comprising the L1 protein of bovine PV and a cytotoxic T cell epitope of HPV 16 E7 protein (RAHYNIVTF; single letter amino acid code) (L1E7VLPs) as described previously (8). VLPs were purified from the nuclei of SF9 cells infected with recombinant baculovirus by CsCl gradient centrifugation as described previously (7). Samples were subjected to analysis by transmission electron microscope and immunoblotting to confirm the identity and integrity of the VLPs. For immunoblot analysis, protein samples were diluted in SDS-PAGE sample buffer, electrophoresed through a 10% SDS-PAGE gel, and transferred to nitrocellulose membrane. The membrane was probed with the anti-L1 mAb MC15 (15). Bound Ab was detected by incubation of the membrane with HRP-conjugated sheep anti-mouse Ab (Silenus) and visualized using ECL (Amersham Biosciences). For electron microscopy, CsCl gradient-purified and dialyzed VLP samples were mounted onto carbon-coated grids, stained with 2% ammonium molybdate (pH 6.2), and examined with a Hitachi H-800 electron microscope.

Immunization of mice

Groups of three to five mice were immunized as indicated with 30 or 50 µg of VLPs with or without alum. Mice were lightly anesthetized with Isofluorane (Abbott Laboratories) during immunization. VLPs were in 50 µl of PBS or mixed with equal volume of alum. For in vivo-neutralizing experiments, 0.5–1 mg of mAbs or of normal rat serum was administered i.p. Immunization with recombinant GST-E7 protein combined with IFA was performed as described previously (14). For depletion of CD25+ T cells in vivo, 0.5 mg of mAb was administered i.p., and depletion efficacy was monitored by FACS analysis.

ELISA for IL-10, IL-5, and IFN-{gamma} cytokines from culture supernatants

ELISA for IL-5, IL-10, and IFN-{gamma} (R&D Systems) was performed as described previously, according to the manufacturer’s recommended procedures (10).

ELISPOT

ELISPOT was performed as described previously (16). Briefly, single spleen cell or lymph node suspensions were added to membrane-base 96-well plates (Millipore) coated with anti-IFN-{gamma} (BD Pharmingen) with or without added IL-2 (Life Techniques). Peptide was added at various concentrations, and cells were held at 37°C with peptide for 18 h. Ag-specific IFN-{gamma}-secreting cells were detected by sequential exposure of the plate to biotinylated anti-IFN-{gamma} (BD Pharmingen), avidin-HRP (Sigma-Aldrich), and diaminobenzidine (Sigma-Aldrich). The results were measured by ELISPOT reader system ELR02 (AID Autoimmun Diagnostika).

Positive selection of mouse spleen CD11c+ cells

C57 BL/6 mouse spleens were held in 1 mg/ml collagenase D (Roche Diagnostics), and 500 µl of collagenase D was injected into each spleen. The spleens were then cut in smaller pieces, held in 5 ml of collagenase D for 45–60 min at 37°C, and passed through a steel mesh. The cells were counted, washed in RPMI 1640 with 2% FBS, and resuspended in 400 µl of RPMI 1640 with 2% FBS per 108 total cells. A total of 100 µl of MACS CD11c microbeads (Miltenyi Biotec) was added and held for 15 min at 6–12°C. After washing, cells were resuspended in 500 µl/108 cells. CD11c+ cells were positively selected with a LS column (Miltenyi Biotec) according to the manufacturer’s protocols. The purity of CD11c+ cells was ~80% as assessed by flow cytometry.

Selection of CD4+ cells

To generate a lymphocyte population enriched for Ag-primed CD4+ T cells, mice were immunized with L1VLPs twice, and draining inguinal lymph nodes were removed 7 days after the second immunization. Cells were passed through a 70-µm nylon membrane (BD Pharmingen) and resuspended in 1 ml of RPMI 1640 + 2% FBS. For every 108 cells, 8 µl of anti-Gr-1 mAb, 6 µl of anti-B220 mAb, 5 µl of anti-MHC class II (I-Ab) mAb, 4 µl of anti-Fc{gamma}II/III mAb, and 8 µl of anti-CD8 mAb were added. After incubation at room temperature for 15 min, the cells were washed and resuspended in 1 ml of RPMI 1640 with 2% FBS. Anti-rat-MACS beads (Miltenyi Biotec) were added at 100 µl/108 cells for 15 min at 9°C, washed with RPMI 1640, and passed through an LS column following the manufacturer’s protocols. The enriched cell population comprised ~70% CD4+ T cells by flow cytometry.

In vitro activation of E7 TCR transgenic CD8+ T cells by APC exposed to chimeric E7VLP

A total of 105 CD11+ cells was exposed to 40 µg of L1VLPs, L1E7VLPs, or HPV6bL1 VLPs for 18 h at 37°C. After extensive washing, cells were placed in U-shape 96-well tissue culture plates (Trasadingen; TPP), and different numbers of splenocytes, depleted of adherent cells by exposure to plastic at 37°C for 2 h, from C57BL/6 mice, or from C57BL/6 mice with a transgene TCR beta-chain specific for the MHC class I-restricted E7 peptide RAHYNIVTF, designated E7 T cells, were added. Approximately 50% of T cells from the TCR beta-chain transgenic C57BL/6 animals bind E7 peptide tetramers and secrete IFN-{gamma} in response to E7 peptide-pulsed targets (13). Cells were held for 2 days at 37°C, and supernatants were collected for cytokine measurement. [3H]Thymidine was added to the culture plate for another 16 h, and T cell proliferation was assayed as described previously (14). In some experiments, CD4-enriched lymphocytes from mice immunized with L1VLPs or unrelated Ag were added for 18 h to CD11c+ cells exposed to VLPs. E7 TCR transgenic T cells and 15 µg/ml GK1.5-blocking Ab were then added, cells were cultured, and cytokine secretion and proliferation were assessed after 48 h as described above.

Intracellular staining for Foxp3

Intracellular staining for Foxp3 of lymphocytes from spleen and lymph nodes were performed using Foxp3 intracellular staining kit purchased from eBioscience, following the instruction provided.

Statistical analysis

Statistical analysis was performed using the two-tailed Student’s t test and Prism 4.0 (GraphPad).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Carrier-primed CD4+ cells inhibit IFN-{gamma} secretion by CD8+ T cells in vivo

Administration of a MHC class I-restricted epitope coupled to a virus capsid carrier to produce a cVLP induces epitope-specific IFN-{gamma}-secreting CD8+ T cells (8). However, activation of an IFN-{gamma} response to a new epitope associated with a cVLP is inhibited by pre-existing immunity to the VLP, and inhibition requires IL-10 (10). In this study, we define the mechanism of the observed inhibition and a means to overcome it. Although IL-10 can be secreted by different cells, our previous results show that the inhibition is Ag specific and is not related to Ag-experienced B cells. We therefore hypothesized that Ag-experienced T cells may be involved in the inhibition. Because IL-10-secreting T cells with regulatory function are mainly CD4+ (17), we first wished to establish whether immune CD4+ cells were necessary in vivo for the inhibition of IFN-{gamma} responses that we observed. We therefore depleted CD4 cells from L1VLP-primed animals that were unable to mount an IFN-{gamma} response to a new E7 epitope associated with the virus capsid. We then observed recovery of a naive CD4+ population over 3 wk (Fig. 1A) and tested for recovery of the ability to mount an IFN-{gamma} response to the E7 epitope by immunization with L1E7VLPs. As expected, E7 epitope-specific IFN-{gamma} responses were induced by L1E7VLPs in a naive animal and were not induced by L1E7VLPs in L1VLP-primed, nondepleted mice. However, E7-specific IFN-{gamma}-secreting T cells were readily detected in L1VLP-immunized mice that were depleted of Ag-experienced CD4+ cells and allowed to recover a naive CD4+ population before immunization with L1E7VLPs (Fig. 1B). These results confirm our previous findings and demonstrate in vivo that viral capsid-induced CD4+ T cells are required for inhibition of the epitope-specific IFN-{gamma} response.


Figure 1
View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 1. Viral capsid-primed CD4 T cells produce IL-10 and are necessary for E7-specific IFN-{gamma} inhibition. A, Groups of three C57BL/6 mice were immunized twice with L1VLPs on day 0 and 14, and 500 µl of 1 mg/ml anti-CD4 (GK1.5) or normal rat serum (NRS) was given i.p. consecutively for 3 days from day 21. Depletion and recovery of CD4 T cells was monitored by FACS analysis of blood at day 25 and day 43. B, Groups of three mice were immunized with L1VLPs on day 0 and 14 and then depleted (anti-CD4) or mock depleted (NRS) of CD4 cells as in A; these mice were immunized with L1E7VLPs on day 44 and 58 (L1VLPs/L1E7VLPs). Previously untreated animals were similarly immunized with L1E7VLPs. Induction of E7-specific IFN-{gamma}-secreting CD8 T cells in spleen and lymph nodes was assessed by ELISPOT on day 55. The results are representative of two independent experiments. C, Groups of five C57BL/6 mice were immunized with L1VLPs on day 0 and 14 with or without alum, or were left unimmunized. Lymph node lymphocytes were collected on day 21 and exposed to 10 µg/ml L1VLPs for 48 h. Supernatants were assayed by ELISA for IL-10. D, Groups of three mice were immunized twice with L1VLPs with alum, then lymph node and spleen lymphocytes were exposed to VLPs as for A, with or without addition of 15 µg/ml anti-CD4 (GK1.5), anti-CD8 (2.43), or an isotype control Ab. Supernatants were analyzed for IL-10 by ELISA. Results are mean ± SEM of individual mice for splenocytes and of triplicate assays of pooled local lymph node cells.

 
Because inhibition of induction of E7-specific T cell IFN-{gamma} responses by L1E7VLPs in L1VLP-primed mice is dependent on IL-10 and also L1VLP-primed CD4+ T cells, we hypothesized that IL-10 would be produced by primed CD4+ T cells in the lymph nodes draining the L1VLP injection site. To test this hypothesis, mice were immunized twice with L1E7VLPs, and cytokine secretion by cells from the draining lymph node was examined. L1E7VLPs, injected with or without alum adjuvant, enhanced Ag-specific IL-10 production by draining lymph node cells stimulated in vitro with L1E7VLPs (Fig. 1C). IL-10 production was significantly reduced by anti-CD4 treatment of lymph node cells but not by anti-CD8 treatment (Fig. 1D). L1E7VLPs immunization similarly enhanced IL-10 production by splenocytes from immunized animals following in vitro exposure to L1E7VLP Ag. Thus, immunization with VLPs induces IL-10 secretion in draining lymph nodes by VLP-specific CD4+ T cells, suggesting that these VLP-specific CD4+ T cells contribute to the IL-10-dependent suppression of induction, in response to immunization with a new MHC class I-restricted epitope, of IFN-{gamma}-secreting T cells.

Inhibition of E7-specific responses cannot be overcome by immunization with CpG

We next tested methods that might overcome the inhibition of a CD8 response to epitopes linked to a carrier protein that occurred consequent to prior priming of the animal to the carrier protein. Because patients with cancer or chronic viral infection commonly have ineffective immune responses to virus and tumor-specific Ags, characterized by Ab and lack of tumor or virus Ag-specific CTL effectors, overcoming such inhibition may be important for immunotherapy. Administration of VLPs together with CpG DNA as a stimulus to the innate immune system can increase the magnitude of the induced CD8+ T cell response (18), so we immunized viral capsid protein-primed mice with L1E7VLPs and CpG but saw no induction of E7-specific CD8 IFN-{gamma} responses (Fig. 2), although CpG mixed with peptide induce strong cellular immune responses compared with peptide immunization alone (data not shown). Thus, increasing the immunogenicity of Ag by mix with CpG in a primed host through better activation of DC could not overcome the observed inhibition of new CD8-dependent responses by prior priming.


Figure 2
View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 2. CpG stimulation cannot overcome suppression of E7-specific IFN-{gamma} secretion by IL-10-secreting CD4 cells. Groups of three C57BL/6J mice were immunized with L1VLPs on day 0 and 14 or were left unimmunized. On day 21 and 35, all groups were immunized with L1E7VLPs; one group was also given 10 µg/ml CpG as shown. Six days after final immunization, spleen (A) and draining lymph nodes (B) were collected, and E7-specific IFN-{gamma} ELISPOT assays were performed. Results are the mean and 1 SEM from three mice in each group.

 
Neutralizing IL-10 restores E7-specific responses in vivo

Next, we investigated whether neutralizing the effect of IL-10 in vivo could restore the E7-specific IFN-{gamma} response to L1E7VLPs in L1VLP-primed mice. To test whether in vivo-neutralizing IL-10 could restore the E7-specific IFN-{gamma} responses, mice were immunized with L1VLPs to render their CD8+ T cells unable to secrete IFN-{gamma} in response to E7VLPs, and then treated with L1E7VLPs together with a neutralizing Ab to the IL-10R, and E7-specific IFN-{gamma} responses were measured by ELISPOT assay. The responses to E7 are recovered in mice treated with anti-IL-10R Ab but not in mice treated with control serum, as shown by the increased number and overall areas of spots (Fig. 3A). To extend this observation, mice primed with L1VLPs and then immunized with L1E7VLPs and treated with either anti-IL-10R or rat serum were left for 28 days and subsequently immunized with a suboptimal amount of E7 protein. The induced E7-specific immune response was compared with that obtained if the animals were not given Ab to IL-10R or were totally unprimed (Fig. 3B). The spleen CD8-specific IFN-{gamma} response to E7 in animals given L1VLPs, and then L1E7VLPs without Ab to IL-10R, was not significantly different from the E7 response in untreated animals. In contrast, the response in the animals additionally administered Ab to IL-10R was significantly greater than in either control group, confirming that the administration of anti-IL-10R at the time of specific immunization had restored the ability of the animals to be primed in vivo to produce a Tc1 type response to the new Ag.


Figure 3
View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 3. Blocking IL-10R restores E7-specific IFN-{gamma} secretion in vivo. A, Groups of four C57BL/6 mice were immunized with 30 µg of L1VLPs on day 0 and 14. Mice were given either 0.3 mg of anti-IL-10R or normal rat serum i.p. on day 20 and 21, and immunized with 50 µg of L1E7VLPs on day 21. On day 34 and 35, anti-IL-10R Ab or normal rat serum and L1E7VLPs immunization were repeated. One group of four mice were immunized twice with 50 µg of L1E7VLPs as control. After 6 days, spleen cells were harvested, and E7 peptide-specific IFN-{gamma} ELISPOT was performed on all groups. Results were represents of two independent experiments. B, Groups of three C57BL/6J mice were immunized with 30 µg of L1VLPs ({blacktriangleup}{blacktriangledown}) on day 0 and 14 or left unimmunized ({blacksquare}). Immunized mice were given either 0.5 mg of anti-IL-10R ({blacktriangledown}) or normal rat serum ({blacktriangleup}) i.p. on day 20 and 21 and immunized with L1E7VLPs on day 21. On day 34 and 35, IL-10R Ab or control administration and VLP immunization was repeated. Twenty-eight days after final immunization, all animals were immunized with 10 µg of E7GST/IFA, a suboptimal immunization producing no measurable response in naive CD57BL/6 mice. After 6 days, spleen cells were harvested, and E7 peptide-specific IFN-{gamma} ELISPOT was performed on all groups.

 
Viral capsid-primed CD4+ cells inhibit Ag-specific IFN-{gamma} secretion in vitro when DCs talk with L1CD4 but not unrelated Ag-specific CD4+ cells

E7 peptide-specific T cell responses are observed in L1VLP-primed hosts immunized with E7 protein and L1VLPs, if the E7 peptide is not covalently linked to the VLPs (10). From these data we hypothesized that if the same DC presents L1VLP peptide to CD4+ T cells and E7 peptide to CD8+ T cells, the CD4+ cells, by secreting IL-10, locally influence the fate of E7-specific CD8+ T cells. To investigate this hypothesis, we set up an in vitro system in which CD11c+ cells isolated from naive mouse spleen (called DCs hereafter) were exposed to L1VLPs, L1E7VLPs, or unrelated HPV6bL1 VLPs for 18 h. Activation in vitro of naive E7-specific (TCR transgenic) CD8+ T cells by the Ag-pulsed DC was then assessed as IFN-{gamma} secretion and T cell proliferation. Activation in vitro of E7-specific CD8+ T cells was observed for DC exposed to L1E7VLPs but not L1VLP or HPV6bL1 VLP, as expected (Fig. 4A). No significant IFN-{gamma} secretion was observed from CD8+ or CD4+ T cells exposed to unpulsed DC or DC exposed to L1VLPs (Fig. 4B and data not shown), indicating the specificity of the in vitro system.


Figure 4
View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 4. CD4+ T cells from VLP and alum-immunized mice suppress E7-specific IFN-{gamma} secretion in vitro when DCs talk with L1CD4 but not unrelated Ag-specific CD4+ T cells. A, A total of 105 CD11c+ DCs from C57BL/6 mice was exposed to 40 µg/ml BPV1 L1E7VLPs, BPV1 L1VLPs, or HPV6 L1VLPs, respectively, for 18 h: after extensive washing, 5 x 105 E7 TCR transgenic T cells were added and cultured for 48 h. Supernatants were measured for IFN-{gamma} by ELISA. [3H]Thymidine was added, and T cell proliferation was assessed as [3H]thymidine incorporation. Results are representative of three independent results. B, CD11c+ cells (105) were exposed to BPV1 L1E7VLPs or BPV1 L1VLPs for 18 h. After washing, CD4+ T cells (105) from BPV1 L1E7VLP-immunized or from OVA-immunized mice, or from unimmunized mice, were added as shown. A total of 5 x 105 E7 TCR cells was added, and IFN-{gamma} secretions were assayed as described above. Results are mean ± SEM from triplicate samples and represent one of two independent experiments. C, CD11c+ cells (105) were exposed to either BPV1 L1E7VLPs or BPV1 L1VLPs for 18 h. After washing, CD4+ T cells (105) from BPV1 L1E7VLP-immunized mice, or from OVA-immunized mice, were added as shown. Supernatants were collected, and IL-10 secretion was measured by ELISA. Results are means ± SEM from triplicate samples and represent two independent experiments.

 
To examine the effect of CD4+ T cells on E7-specific CD8+ T cell activation in this in vitro system, we added CD4 T cells from draining lymph nodes of L1VLP-immunized mice. Because CD4+ T cells from mice immunized with VLPs secreted more IL-10 if the VLPs were coadministered with alum, we tested whether VLP and alum-primed CD4+ T cells were effective in vitro at inhibiting activation of E7-specific T cells by L1E7VLP-exposed DC. CD4+ cells from animals immunized with VLP and alum, in contrast to CD4+ cells from unrelated Ag with alum, significantly inhibited activation of E7-specific T cell IFN-{gamma} secretion (Fig. 4B). These results were also confirmed by intracellular IFN-{gamma} staining of E7-specific CD8+ T cells (data not shown). To investigate whether this inhibition was mediated by IL-10 as predicted from our in vivo observation, we first assayed supernatants from different CD4+ cell and DC cultures for IL-10. As expected, IL-10 secretion was significantly higher from cultures including CD4+ cells from animals immunized with L1VLP with alum than from cultures with CD4+ cells from control-immunized animals (Fig. 4C). Furthermore, neutralization of IL-10 in vitro restored the activation by L1E7VLP-primed DC of IFN-{gamma} secretion by E7-specific T cells (Fig. 5A), whereas T cell proliferation was similar among different groups (Fig. 5B), showing that DC-mediated Ag presentation was occurring and T cells were able to respond. Thus, viral capsid-primed CD4+ cells secrete IL-10 upon interaction with DCs presenting L1E7VLPs. Interaction between CD4+ cells and Ag-loaded DC prevents the subsequent activation by those DC of IFN-{gamma} secretion from E7-specific CD8-restricted T cells, and inhibition of IFN-{gamma} secretion is dependent on IL-10.


Figure 5
View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 5. Neutralizing IL-10 restores E7-specific IFN-{gamma} secretion in vitro. CD11c+ cells (105) from C57BL/6 mice were exposed to 40 µg/ml L1E7VLPs for 18 h. CD4+ cells (105) from mice immunized with L1VLP and alum, and anti-IL-10 Abs as shown were added and mixed with above pulsed CD11c+ cells for 18 h. E7 TCR transgenic T cells (5 x 105) were then added for 48 h. Supernatants were collected for cytokine ELISA (A) and T cell proliferation (B) was assessed as [3H]thymidine incorporation.

 
Role of naturally occurring CD+CD25+ T cells

Inhibition of CD8 responses is not observed in L1-primed mice immunized with L1E7VLPs if CD4+ cells are depleted after priming with L1VLPs (Fig. 1B). Because CD4+CD25+ T cell numbers were observed to recover following CD4 cell depletion at the same rate as CD4+CD25 T cells (data not shown), naturally occurring CD4+CD25+ T cells are likely not required for the inhibition of CD8 responses. To further investigate the cell population within CD4+ T cells that mediate specific inhibition of CD8 responses, we first examined CD4 cells isolated from draining and nondraining lymph nodes of L1VLP-immunized mice for expression of Foxp3, the master gene of natural-occurring T regulatory cells. Foxp3+CD4+, or Foxp3+CD25+ T cells from draining lymph nodes (Fig 6A), and nondraining lymph nodes (data not shown) were not increased in immunized mice compared with naive mice, consistent with the hypothesis that CD25+ T cells are not responsible for the observed inhibition of CD8 responses. To further investigate the role of CD4+CD25+ regulatory T cells in production of IL-10 after immunization, we examined the effects of depletion of CD25+ T cells before immunization with L1VLPs. At 14 days after depletion, CD4+CD25+ T cells remain low (Fig. 6B). Depleted L1VLP-primed or nondepleted L1VLP-primed mice were immunized with L1E7VLPs. Depletion of CD25+ T cells had no effect on the inhibition of E7-specific CTL responses (Fig 6B), although in parallel experiments naive mice depleted of CD25+ T cells generated larger numbers of E7-specific CD8 T cells secreting IFN-{gamma} (98 vs 18) than untreated mice in response to E7 immunization. Thus, the CD4+ T cells responsible for the inhibition of CD8 responses are unlikely to be CD4+CD25+ natural regulatory T cells.


Figure 6
View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 6. CD4+CD25+ T cells are not required for the E7-specific inhibition. A, Groups of four C57BL/6J mice were immunized with 30 µg of L1VLPs with or without alum on day 0 and 14. Draining and nondraining inguinal lymph nodes of immunized and naive mice were harvested after 7 days, and single-cell suspensions were exposed to conjugated anti-CD4 and anti-CD25 before intracellular staining for Foxp3. B, Groups of four C57BL/6J mice were either depleted of CD25+ T cells by administration of 0.5 mg of PC61 i.p. 1 day before immunization or left undepleted. CD4+CD25+ T cells were measured by staining of CD3+, CD4+, and CD25+ populations of inguinal lymph nodes 14 days after depletion Mice depleted of CD25 cells and nondepleted mice were then immunized twice with L1VLPs on day 0 and day 14. On day 21 and 35, mice either depleted or nondepleted were immunized with L1E7VLPs; 6 days after immunization, E7-specific IFN-{gamma} were measured by ELISPOT assay.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In this study, we describe one mechanism that might explain the observations termed original antigenic sin and a way to overcome the problem original antigenic sin presents for vaccine development. We show here that inhibition of the CD8+ T cell response to a newly presented antigenic epitope to reduce type 1 cytokine production can be mediated by Ag-specific CD4+ T cells that instruct DCs by an IL-10-dependent mechanism. Original antigenic sin is commonly attributed to selection of B and T cells cross-reactive between the priming virus and the subsequent challenge virus (3, 5). It remains unclear, however, why this polarization of the selected repertoire would result in recall of cells cross-reactive enough to be activated but insufficiently cross-reactive to be effective effectors against the variant pathogen. The early observation that polarization of a B cell response to flu could be induced by Thy-positive splenocytes (2) would now be interpreted as evidence that a T cell-mediated regulatory process was important. This hypothesis is strongly supported by our current observation of a role for IL-10 in suppression of generation of CD8 T cells IFN-{gamma} responses. T cells with regulatory function exist within all major subsets, including CD4+, CD8+, and NKT cells. Naturally occurring CD4+CD25+ T cells and T regulatory 1 (Tr1) cells are the two main different cell populations under intensive study (17, 19). Naturally occurring CD4+CD25+ cells, which develop in the thymus and are ~5–10% of the peripheral CD4+ population, appear to work by direct cell contact. In contrast, Tr1 cells develop peripherally in response to Ag and are activated by subsequent Ag exposure to secrete immunoregulatory cytokines including IL-10 or TGF-beta. Our in vivo data suggested that naturally occurring CD4+CD25+ cells are not directly responsible for the observed inhibition; because (1) inhibition required VLP-experienced CD4+ T cells, and (2), after CD4 T cell depletion, the recovery rate of CD4+CD25+ T cell and CD4+CD25 T cells are similar, and inhibition still occurs when CD4+CD25+ T cells are depleted during L1VLP immunization. Our in vitro data show that the regulatory cells involved in suppression of CD8 responses are CD4+ T cells, secreting IL-10 that can instruct DCs to reduce IFN-{gamma} CD8 responses. A direct action of IL-10 on developing CD8 T cells to induce Tc2 cytokine secretion has been proposed (20). Whether the Ag-experienced CD4 T cells with regulatory function require CD4+CD25+ T cells are under investigation. DCs are considered to be a key intermediate target of the suppression of T cell responses by regulatory T cells (21), and they can respond to both TGF-beta (22) and IL-10 (23, 24) to adopt a tolerogenic phenotype. In our model, instructed DCs were able to invoke T cell proliferation (Fig. 3 and data not shown), suggesting that their Ag presentation capacity was not impaired. Whether a secondary signal promoting CD8 T cells to reduce IFN-{gamma} is therefore transmitted directly from the DC, or via DC-secreted IL-10 (25) or a further IL-10-secreting regulatory T cell (26), can be tested with Ag-specific CD8+ T cells lacking functional IL-10R.

CD8+ T cell effector responses have been classified as Tc1 and Tc2 according to the cytokines secreted (27). The Th1/Th2 paradigm has been used to explain differing clinical presentations following infection with Mycobacterium leprae and some parasites (28) and is postulated to explain predisposition to aeroallergen-induced asthma (29). The clinical relevance of the Tc1/Tc2 paradigm is less clear: CD8+ T cell clones isolated from HIV-infected patients are often Tc2 type and secrete IL-5 and IL-4, but not IFN-{gamma}, whereas HIV-negative controls usually generate Tc1 type CD8+ T cells (30), but both Tc1 and Tc2 clones seem able to control HIV-1-infected cells (31). In contrast, EBV-specific CD8+ T cells with Tc2 cytokine secretion patterns are less effective at controlling proliferation of EBV-infected cells (32), and Tc2 cells are ineffective at controlling some but not all tumor growth (33, 34). Given the key role of IFN-{gamma} in many CD8 T cell functions, including control of viral infections and tumors, it would seem likely that induction of Tc2 response to immunization or infection would be undesirable. We checked the IL-5 production by CD8 T cells in our in vitro system by intracellular staining and found some CD8+ T cells are producing IL-5 (data not shown), suggesting that a Tc1/Tc2 shift may be a major mechanism of the observed inhibition; we are currently investigating the function of the CD8+ T cells with reduced IFN-{gamma} secretion in vivo.

Use of CpG to modulate DC function via TLR9 has been proposed as a means to strengthen CD8+ T cell responses to viral Ags (18), but proved ineffective at regenerating the ability to mount a CD8+ T cell response in our current study, although better immune responses might have been generated if VLPs were coupled together with CpG (35). In contrast, inhibition of Il-10 appears to allow recovery of the ability to mount a Tc1 immune response even when IL-10-secreting Th cells had been generated by prior Ag exposure. This novel observation should be of significance for immunotherapy of chronic viral infections and of cancer. The immune system is commonly ineffectively primed to virus or tumor-specific Ags (36, 37), with measurable Ab and Th responses but manifest absence of effective Tc response. Induction of a CD8+ T cell response, which would likely be directed at epitopes of the proteins to which Th immunity already exists, is held critical for immunotherapy (38, 39), and delivery of Ag along with an inhibitor of Il-10 function such as Il-10R Ab, or soluble IL-10R, should therefore achieve restoration of the desired immune function.


    Acknowledgments
 
We thank Dr. Ray Steptoe for help with IL-10R purification from hybridoma cells; Yan Xu for preparation of VLPs; Ross Dixon and Rachel De Kluyver for technical assistance; and Megan Bathurst and Caron Maxim for excellent animal care.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
I. H. Frazer and X. S. Liu, together with the University of Queensland, hold a provisional patent with the title "Immunomodulating Compositions and Uses Therefor.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Health and Medical Research Council Program Grant 351439 and Queensland Cancer Fund Project Grant 2004000983. Back

2 Address correspondence and reprint requests to Dr. Xiao Song Liu, Centre for Immunology and Cancer Research, University of Queensland, Princess Alexandra Hospital, Brisbane, Queensland 4102, Australia. E-mail address: xliu{at}cicr.uq.edu.au Back

3 Abbreviations used in this paper: PV, papillomavirus; VLP, virus-like particle; cVLP, chimeric VLP; DC, dendritic cell; HPV, human PV; alum, aluminum hydroxide gel. Back

Received for publication March 14, 2006. Accepted for publication June 9, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Davenport, F. M., A. V. Hennessy, T. Francis, Jr. 1953. Epidemiologic and immunologic significance of age distribution of antibody to antigenic variants of influenza virus. J. Exp. Med. 98: 641-656. [Abstract]
  2. Virelizier, J. L., R. Postlethwaite, G. C. Schild, A. C. Allison. 1974. Antibody responses to antigenic determinants of influenza virus hemagglutinin. I. Thymus dependence of antibody formation and thymus independence of immunological memory. J. Exp. Med. 140: 1559-1570. [Abstract]
  3. Fish, S., E. Zenowich, M. Fleming, T. Manser. 1989. Molecular analysis of original antigenic sin. I. Clonal selection, somatic mutation, and isotype switching during a memory B cell response. J. Exp. Med. 170: 1191-1209. [Abstract/Free Full Text]
  4. Klenerman, P., R. M. Zinkernagel. 1998. Original antigenic sin impairs cytotoxic T lymphocyte responses to viruses bearing variant epitopes. Nature 394: 482-485. [Medline]
  5. Singh, R. A., J. R. Rodgers, M. A. Barry. 2002. The role of T cell antagonism and original antigenic sin in genetic immunization. J. Immunol. 169: 6779-6786. [Abstract/Free Full Text]
  6. Muller, M., J. Zhou, T. D. Reed, C. Rittmuller, A. Burger, J. Gabelsberger, J. Braspenning, L. Gissmann. 1997. Chimeric papillomavirus-like particles. Virology 234: 93-111. [Medline]
  7. Liu, X. S., I. Abdul-Jabbar, Y. M. Qi, I. H. Frazer, J. Zhou. 1998. Mucosal immunisation with papillomavirus virus-like particles elicits systemic and mucosal immunity in mice. Virology 252: 39-45. [Medline]
  8. Peng, S., I. H. Frazer, G. J. Fernando, J. Zhou. 1998. Papillomavirus virus-like particles can deliver defined CTL epitopes to the MHC class I pathway. Virology 240: 147-157. [Medline]
  9. Da Silva, D. M., D. V. Pastrana, J. T. Schiller, W. M. Kast. 2001. Effect of preexisting neutralizing antibodies on the anti-tumor immune response induced by chimeric human papillomavirus virus-like particle vaccines. Virology 290: 350-360. [Medline]
  10. Liu, X. S., Y. Xu, L. Hardy, V. Khammanivong, W. Zhao, G. J. Fernando, G. R. Leggatt, I. H. Frazer. 2003. IL-10 mediates suppression of the CD8 T cell IFN-{gamma} response to a novel viral epitope in a primed host. J. Immunol. 171: 4765-4772. [Abstract/Free Full Text]
  11. Rudolf, M. P., S. C. Fausch, D. M. Da Silva, W. M. Kast. 2001. Human dendritic cells are activated by chimeric human papillomavirus type-16 virus-like particles and induce epitope-specific human T cell responses in vitro. J. Immunol. 166: 5917-5924. [Abstract/Free Full Text]
  12. Lenz, P., P. M. Day, Y. Y. Pang, S. A. Frye, P. N. Jensen, D. R. Lowy, J. T. Schiller. 2001. Papillomavirus-like particles induce acute activation of dendritic cells. J. Immunol. 166: 5346-5355. [Abstract/Free Full Text]
  13. Matsumoto, K., G. R. Leggatt, J. Zhong, X. Liu, R. L. de Kluyver, T. Peters, G. J. Fernando, A. Liem, P. F. Lambert, I. H. Frazer. 2004. Impaired antigen presentation and effectiveness of combined active/passive immunotherapy for epithelial tumors. J. Natl. Cancer Inst. 96: 1611-1619. [Abstract/Free Full Text]
  14. Fernando, G. J., T. J. Stewart, R. W. Tindle, I. H. Frazer. 1998. Vaccine-induced Th1-type responses are dominant over Th2-type responses in the short term whereas pre-existing Th2 responses are dominant in the longer term. Scand. J. Immunol. 47: 459-465. [Medline]
  15. Kulski, J. K., S. Gaudieri, M. Bellgard, L. Balmer, K. Giles, H. Inoko, R. L. Dawkins. 1998. The evolution of MHC diversity by segmental duplication and transposition of retroelements. J. Mol. Evol. 46: 734
  16. Khammanivong, V., X. S. Liu, W. J. Liu, S. J. Rodda, G. R. Leggatt, R. W. Tindle, I. H. Frazer, G. J. Fernando. 2003. Paucity of functional CTL epitopes in the E7 oncoprotein of cervical cancer associated human papillomavirus type 16. Immunol. Cell Biol. 81: 1-7. [Medline]
  17. Fehervari, Z., S. Sakaguchi. 2004. Development and function of CD25+CD4+ regulatory T cells. Curr. Opin. Immunol. 16: 203-208. [Medline]
  18. Storni, T., F. Lechner, I. Erdmann, T. Bachi, A. Jegerlehner, T. Dumrese, T. M. Kundig, C. Ruedl, M. F. Bachmann. 2002. Critical role for activation of antigen-presenting cells in priming of cytotoxic T cell responses after vaccination with virus-like particles. J. Immunol. 168: 2880-2886. [Abstract/Free Full Text]
  19. Mills, K. H., P. McGuirk. 2004. Antigen-specific regulatory T cells: their induction and role in infection. Semin. Immunol. 16: 107-117. [Medline]
  20. Rowbottom, A. W., M. A. Lepper, R. J. Garland, C. V. Cox, E. G. Corley. 1999. Interleukin-10-induced CD8 cell proliferation. Immunology 98: 80-89. [Medline]
  21. Misra, N., J. Bayry, S. Lacroix-Desmazes, M. D. Kazatchkine, S. V. Kaveri. 2004. Cutting edge: human CD4+CD25+ T cells restrain the maturation and antigen-presenting function of dendritic cells. J. Immunol. 172: 4676-4680. [Abstract/Free Full Text]
  22. Strobl, H., W. Knapp. 1999. TGF-beta1 regulation of dendritic cells. Microbes Infect. 1: 1283-1290. [Medline]
  23. Corinti, S., C. Albanesi, A. la Sala, S. Pastore, G. Girolomoni. 2001. Regulatory activity of autocrine IL-10 on dendritic cell functions. J. Immunol. 166: 4312-4318. [Abstract/Free Full Text]
  24. Brossart, P., A. Zobywalski, F. Grunebach, L. Behnke, G. Stuhler, V. L. Reichardt, L. Kanz, W. Brugger. 2000. Tumor necrosis factor {alpha} and CD40 ligand antagonize the inhibitory effects of interleukin 10 on T-cell stimulatory capacity of dendritic cells. Cancer Res. 60: 4485-4492. [Abstract/Free Full Text]
  25. Yan, M., J. Peng, I. A. Jabbar, X. Liu, L. Filgueira, I. H. Frazer, R. Thomas. 2005. Activation of dendritic cells by human papillomavirus-like particles through TLR4 and NF-{kappa}B-mediated signalling, moderated by TGF-beta. Immunol. Cell Biol. 83: 83-91. [Medline]
  26. MacDonald, K. P., V. Rowe, A. D. Clouston, J. K. Welply, R. D. Kuns, J. L. Ferrara, R. Thomas, G. R. Hill. 2005. Cytokine expanded myeloid precursors function as regulatory antigen-presenting cells and promote tolerance through IL-10-producing regulatory T cells. J. Immunol. 174: 1841-1850. [Abstract/Free Full Text]
  27. Sad, S., R. Marcotte, T. R. Mosmann. 1995. Cytokine-induced differentiation of precursor mouse CD8+ T cells into cytotoxic CD8+ T cells secreting Th1 or Th2 cytokines. Immunity 2: 271-279. [Medline]
  28. Infante-Duarte, C., T. Kamradt. 1999. Th1/Th2 balance in infection. Springer Semin. Immunopathol. 21: 317-338. [Medline]
  29. Ngoc, P. L., D. R. Gold, A. O. Tzianabos, S. T. Weiss, J. C. Celedon. 2005. Cytokines, allergy, and asthma. Curr. Opin. Allergy Clin. Immunol. 5: 161-166. [Medline]
  30. Maggi, E., R. Manetti, F. Annunziato, S. Romagnani. 1995. CD8+ T lymphocytes producing Th2-type cytokines (Tc2) in HIV-infected individuals. J. Biol. Regul. Homeostatic Agents 9: 78-81.
  31. Fevrier, M., S. le Borgne, C. Marty, A. Talarmin, Y. Riviere. 2004. Functional characterization of human Tc0, Tc1 and Tc2 CD8+ T cell clones: control of X4 and R5 HIV strain replication. J. Clin. Immunol. 24: 272-280. [Medline]
  32. Nazaruk, R. A., R. Rochford, M. V. Hobbs, M. J. Cannon. 1998. Functional diversity of the CD8+ T-cell response to Epstein-Barr virus (EBV): implications for the pathogenesis of EBV-associated lymphoproliferative disorders. Blood 91: 3875-3883. [Abstract/Free Full Text]
  33. Do, J. S., Y. H. Choi, S. H. Shin, H. K. Yi, P. H. Hwang, S. Y. Nam. 2004. Committed memory effector type 2 cytotoxic T (Tc2) cells are ineffective in protective anti-tumor immunity. Immunol. Lett. 95: 77-84. [Medline]
  34. Dobrzanski, M. J., J. B. Reome, J. A. Hollenbaugh, R. W. Dutton. 2004. Tc1 and Tc2 effector cell therapy elicit long-term tumor immunity by contrasting mechanisms that result in complementary endogenous type 1 antitumor responses. J. Immunol. 172: 1380-1390. [Abstract/Free Full Text]
  35. Storni, T., C. Ruedl, K. Schwarz, R. A. Schwendener, W. A. Renner, M. F. Bachmann. 2004. Nonmethylated CG motifs packaged into virus-like particles induce protective cytotoxic T cell responses in the absence of systemic side effects. J. Immunol. 172: 1777-1785. [Abstract/Free Full Text]
  36. Houghton, A. N., J. A. Guevara-Patino. 2004. Immune recognition of self in immunity against cancer. J. Clin. Invest. 114: 468-471. [Medline]
  37. Novellino, L., C. Castelli, G. Parmiani. 2005. A listing of human tumor antigens recognized by T cells: March 2004 update. Cancer Immunol. Immunother. 54: 187-207. [Medline]
  38. Ho, W. Y., C. Yee, P. D. Greenberg. 2002. Adoptive therapy with CD8+ T cells: it may get by with a little help from its friends. J. Clin. Invest. 110: 1415-1417. [Medline]
  39. Hussain, S. F., Y. Paterson. 2005. What is needed for effective antitumor immunotherapy: lessons learned using Listeria monocytogenes as a live vector for HPV-associated tumors. Cancer Immunol. Immunother. 54: 577-586. [Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
X. S. Liu, J. Leerberg, K. MacDonald, G. R. Leggatt, and I. H. Frazer
IFN-{gamma} Promotes Generation of IL-10 Secreting CD4+ T Cells that Suppress Generation of CD8 Responses in an Antigen-Experienced Host
J. Immunol., July 1, 2009; 183(1): 51 - 58.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, X. S.
Right arrow Articles by Frazer, I. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, X. S.
Right arrow Articles by Frazer, I. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS