HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Thomson, C. W. Articles by Zhang, L. Search for Related Content PubMed PubMed Citation Articles by Thomson, C. W. Articles by Zhang, L.

FcR Presence in TCR Complex of Double-Negative T Cells Is Critical for Their Regulatory Function¹

Christopher W. Thomson^*, Wendy A. Teft, Wenhao Chen^*, Boris P.-L. Lee^*, Joaquin Madrenas and Li Zhang^2,*,

^* Department of Laboratory Medicine and Pathobiology, Multi Organ Transplantation Program, Toronto General Research Institute, University Health Network, University of Toronto, Toronto, Canada; Federation of Clinical Immunology Societies Centre for Clinical Immunology and Immunotherapeutics, Robarts Research Institute, and Departments of Microbiology and Immunology, and Medicine, University of Western Ontario, London, Canada; and Department of Immunology, University of Toronto, Toronto, Canada

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
TCR⁺CD4^–CD8^– double-negative (DN) T regulatory (Treg) cells have recently been shown to suppress Ag-specific immune responses mediated by CD8⁺ and CD4⁺ T cells in humans and mice. Our previous study using cDNA microarray analysis of global gene expression showed that FcR was the most highly overexpressed gene in functional DN Treg cell clones compared with nonfunctional mutant clones. In this study, we demonstrate that FcR-deficient DN T cells display markedly reduced suppressive activity in vitro. In addition, unlike FcR-sufficient DN T cells, FcR-deficient DN T cells were unable to prolong donor-specific allograft survival when adoptively transferred to recipient mice. Protein analyses indicate that in addition to FcR, DN Treg cell clones also express higher levels of TCR, while mutant clones expressed higher levels of Zap70 and Lck. Within DN Treg cells, we found that FcR associates with the TCR complex and that both FcR and Syk are phosphorylated in response to TCR cross-linking. Inhibition of Syk signaling and FcR expression were both found to reduce the suppressive function of DN Treg cells in vitro. These results indicate that FcR deficiency significantly impairs the ability of DN Treg cells to down-regulate allogeneic immune responses both in vitro and in vivo, and that FcR plays a role in mediating TCR signaling in DN Treg cells.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The T regulatory (Treg)³ cells have been shown to have a significant role in a wide range of immune processes, including autoimmune disease (1, 2), cancer (3, 4), and transplantation tolerance (5, 6, 7). Numerous experimental models have been reported in which transplantation tolerance is mediated by Tregs. One of the approaches for inducing transplantation tolerance by Tregs is pretransplant donor lymphocyte infusion (DLI), either alone (8, 9) or in combination with CD4/CD154 treatment (10, 11, 12). A number of different subsets of Tregs have been associated with DLI-induced tolerance, including CD4⁺CD25⁺ Treg cells (10, 11) and the recently described TCR⁺CD4^–CD8^– double-negative (DN) Treg cells (8, 9, 12).

We have demonstrated previously that DN Treg cells play an important role in DLI-induced allograft tolerance. Initially, we found that pretransplant infusion of donor-derived lymphocytes with a single MHC class I locus mismatch led to permanent or significantly prolonged survival of donor-specific, but not third-party, skin allografts in both transgenic and normal mice (13, 14). An additional study found that DLI promotes the activation and function of recipient peripheral DN Treg cells (9). Activated DN Treg cells preferentially infiltrated donor-specific skin allografts and were cytotoxic to antidonor CD8⁺ T cells. We also found that adoptive transfer of DLI-activated DN Treg cells can significantly prolong skin-graft survival in both single class I and class II mismatch models (15). These studies indicate the importance of DN Treg cells in preventing allograft rejection. However, the molecular mechanism by which DLI-activated DN Treg cells induce donor-specific transplantation tolerance is still unclear.

We have generated a panel of DN Treg cell clones from DLI-treated mice that permanently accepted donor-specific skin allografts (8). Long-term cultivation of the DN Treg cell clones resulted in the generation of stable phenotypic variants that significantly down-regulated the expression of their TCR and simultaneously acquired CD8 expression, designated as mutant clones. The mutant clones lost the in vitro and in vivo regulatory function of the parental DN Treg cell clones (8, 16, 17). To understand the molecular mechanisms involved in DN Treg cell function, we recently evaluated the global gene expression differences between Treg DN clone cells and nonregulatory mutants using cDNA microarray analysis (16). Of all 1099 genes differentially expressed between 6 pairs of regulatory and nonregulatory clones, the largest difference was seen in the expression of the FcR subunit, which had an average of 96-fold increase in regulatory DN T clone cells.

FcR was originally identified as a subunit of the high-affinity IgE receptor (FcRI), but has also been demonstrated to be a common component of the majority of FcRs (FcRI, FcRIII, FcRIV, FcR) (18, 19). Several other activating receptors, including the paired Ig-like receptor A (20), Ig-like transcript/leukocyte Ig-like receptor (CD85) (21), platelet glycoprotein VI (22), as well as the primary activating receptor on T cells, the TCR complex (23), also may contain FcR. Although relatively rare, FcR-containing TCR complexes have been found to be expressed in NK-like T cells (NKT) (24), activated TCR⁺ T cells (25), human systemic lupus erythematosus (SLE) T cells (26), and some human effector CD4⁺ T cells (27). Within the subset of T cells expressing FcR, it has been shown to take the place of the conventional CD3 by regulating the expression of TCR complexes at the cell surface and mediating signal transduction through ITAMs upon receptor engagement (28). Whether FcR is expressed by DN Treg cells and is involved in their regulatory function has not been studied previously.

The goal of this study was to determine the role of the FcR subunit in DN T cell-mediated suppression of antidonor CD8⁺ T cells and to elucidate the molecular mechanism of FcR function in DN Treg cells. The results shown in this study demonstrate that compared with FcR^+/+ DN T cells, FcR^–/– DN T cells have a reduced ability to down-regulate allogeneic immune responses mediated by syngeneic CD8⁺ T cells both in vitro and in vivo when adoptively transferred into syngeneic recipient mice. Molecular analysis showed that the FcR subunit is present in the TCR complex of DN Treg cells and that FcR and Syk are phosphorylated upon TCR cross-linking. Inhibition of the function of Syk or expression of FcR in DN T cells resulted in a marked reduction in DN T cell-mediated suppression. Based on these data, expression of the FcR subunit in DN T cells and TCR signaling through FcR and Syk appears to be critical in maintaining DN T cell-mediated suppression of allogeneically activated CD8⁺ T cells both in vitro and in vivo.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Mice

C57BL/6 (B6), BALB/c, B6 x BALB/c (CB6)F₁, B6.C-H2^bm1/By (bm1), and BALB/c H-2-dm2 (dm2, a BALB/c L^d-loss mutant, H-2 D^d+, K^d+, L^d–) mice were purchased from Jackson ImmunoResearch Laboratories, and BALB/c;129P2-Fcr1^tm1Rav/J N12 (BALB/c.FcR^–/–) and B6.129P2-Fcr1^tm1Rav/J N12 (B6.FcR^–/–) (29) were purchased from Taconic Farms. A breeding stock of 2C transgenic mice (on B6 background) was provided by D. Loh (St. Louis, MO) (30). The 2C (H-2^b/b) transgenic mice carry functionally rearranged TCR -chain (1 copy) and -chain (8 copies) transgenes from a cytotoxic T cell clone (2C) that is specific for L^d MHC class I Ag (30). The 2C clonotypic TCR is recognized by the mAb 1B2 (hybridoma provided by H. Eisen, Massachusetts Institute of Technology, Cambridge, MA). The 2CF₁.FcR^–/– mice were created by screening mice from (2C x (B6.FcR^–/–)F₁) and F₂ generations via flow cytometry for 1B2 and FcR expression. The dm2.FcR^–/– mice were created by screening mice from (dm2 x (BALB/c.FcR^–/–)F₁) and F₂ generations via flow cytometry for L^d (American Type Culture Collection) and FcR (Upstate Biotechnology) expression. After identification of 2C.FcR^–/– and dm2.FcR^–/– breeders, their identity was checked twice by the above described screening process before establishing a breeding colony. The 2C.FcR^–/– mice were bred with dm2.FcR^–/– mice to obtain 2CF₁ FcR^–/– (H-2^b/d, L^d–, 1B2⁺, FcR^–/–) mice. All mice were maintained in the University Health Network (University of Toronto) animal colonies and conducted in accordance with guidelines set by the University Health Network Animal Care Committee.

Cell lines

Two DN Treg clone cell lines, DN1 (CN4) and DN2 (TN12), and their associated mutant clone cell lines, MU1 (CN4.8) and MU2 (TN12.8), were used in this study. Generation of DN Treg clones was performed using previously described methods (8). To maintain the T cell clones, 5 x 10⁴ cells were cultured in a 24-well plate containing 5 x 10⁵ irradiated L^d+ (CB6)F₁ splenocytes as stimulators in -MEM supplemented with 10% FBS, 0.1% 2-ME, 30 U/ml human rIL-2, and 30 U/ml rIL-4. The cells were incubated at 37°C with 5% CO₂. Cells were restimulated in the same way every 3–4 days.

Flow cytometry

CD4 (PE-CY5), CD8 (PE-CY5), TCR (PETR), NK1.1 (PETR) (eBioscience), and 1B2 TCR (FITC) were used to stain DN T cells. To detect FcR, lymphocytes were permeabilized (BD Cytofix/Cytoperm; BD Biosciences) and stained using a rabbit anti-FcR or rabbit IgG control primary Ab (Upstate Biotechnology), followed by a PE-conjugated anti-rabbit secondary Ab (Cedarlane Laboratories). Data were acquired and analyzed using an EPICS XL-MCL flow cytometer (Corixa).

Quantitative RT-PCR (QRT-PCR)

QRT-PCR analysis was performed with the ABI Prizm 7900HT thermocycler (Applied Biosystems) using SYBR green detection. RNA from independent cultures of DN1, DN2, MU1, and MU2 clone cells was isolated using the standard TRIzol reagent protocol (Invitrogen Life Technologies) 3–4 days poststimulation, and reverse transcribed using random hexamers. Each reaction was performed in a 10 µl reaction containing 3 mM MgCl₂, 50 nM dNTP, 20 nM primers, 40 ng of cDNA, 1x Rox reference dye (Invitrogen Life Technologies), 1x SYBR green reagent, and 0.125 U/µl Jumpstart Taq polymerase (Sigma-Aldrich). The expression of -actin was used to normalize starting cDNA concentrations. The 5'-3' primer sequence of sense and antisense primers used for QRT-PCR were GGCTGCATTCTTTTCCCACTT and TTCAAAGCACAGAGGTGACCAA. A standard curve consisting of five 3-fold dilutions of cDNA from a pool of all four samples (1:3:9:27:81) was used for linear regression analysis of all samples.

Isolation of DN T cells

For DLI, 2CF₁.FcR^+/+ or 2CF₁.FcR^–/– mice were injected with 4.0 x 10⁷ spleen cells from (CB6)F₁ mice. Spleen and lymph node cells were harvested 7 days after DLI, depleted of RBC, and then passed through a nylon wool column to enrich the T cell population. To deplete CD4⁺ and CD8⁺ T cells, the cells were then incubated with murine CD4 (RL172, rat IgM) (31) and CD8 (3.168.8, rat IgM) (31) depleting mAbs, followed by incubation with rabbit complement (Cedarlane Laboratories). The suspension contained <1% CD4⁺ and CD8⁺ T cells after depletion, according to flow cytometry, and was used in suppression or cytotoxicity assays. To further purify DN T cells, cell suspensions were stained with biotin-labeled anti-1B2 TCR mAb (32) and isolated by using microbeads (Miltenyi Biotec). The viability and purity of DN T cells were monitored by flow cytometry and were >95%.

Suppression assays

Naive 2CF₁.FcR^+/+ splenocytes were depleted of CD4⁺ T cells, used as responder cells (1000 CD8⁺ T cells/well), and cocultured in 96-well plates with irradiated (20 Gy) sex-matched splenocytes (1 x 10⁴ cells/well) from (CB6)F₁ mice in -MEM supplemented with 10% FCS, 50 U/ml rIL-2, and 30 U/ml rIL-4. Splenic DN T cells isolated as described above were used as putative suppressors in standard suppression assays. Serial dilutions of suppressor cells were added to the MLR. After a 4-day incubation, 1 µCi of [³H]TdR was added to each well. Eighteen hours later, cells were harvested and counted in a beta scintillation counter (TOPCOUNT; Packard Instrument). Suppression was calculated using the equation: percentage of suppression = 1 – (E/R), in which E is the cpm of each well and R is the cpm of responder alone.

Inhibitors

The inhibitors of Syk family kinases, piceatannol (33) and sulfonamide-31 (3-(1-methyl-1H-indol-3-yl-methylene)-2-oxo-2,3-dihydro-1H-indole-5-sulfonamide) (34), as well as cell-permeable irreversible inhibitors of caspase-3 (DEVD-FMK) and caspase-8 (IETD-CHO) were purchased from Calbiochem. Syk inhibitors were dissolved in DMSO (Sigma-Aldrich), and equal volumes (2 µl/well) were added to suppression assays, as described above. For caspase-3 and caspase-8 studies, 5 x 10⁶ DN Treg cells (DN1 and DN2) were cultured in -MEM medium supplemented with 10% FBS in the presence of equal volumes of 50 µM caspase-3 inhibitor, 50 µM caspase-8 inhibitor, or DMSO vehicle for 4 h at 37°C, as described previously (35, 36). DN Treg cells were then washed three times with medium, and FcR expression was analyzed by flow cytometry. These treated DN T cells were also used as putative suppressors in modified suppression assays in which DN T cells pretreated with inhibitor were then added to 2CF₁ CD8⁺ T cells that were activated for 4 days, and cell proliferation was then assessed.

Skin grafting

The (B6 x dm2)F₁ mice (L^d–) were used as recipients and were either left untreated or given 5 x 10⁶ DLI-activated DN T cells isolated from syngeneic 2CF₁.FcR^+/+ or 2CF₁.FcR^–/– mice, which express anti-L^d transgenic TCR. One day later, recipient mice received two sex-matched skin grafts from (CB6)F₁ (L^d+; donor-specific) and bm1 (K^bm1+; third-party control) mice. Grafts were monitored by visual inspection daily for the first 2 wk and twice per week thereafter. A graft was considered rejected when >90% was necrotic. To confirm rejection, skin allografts from recipient mice were harvested, fixed in 10% buffered Formalin, embedded in paraffin, and sectioned. Sections were stained with H&E and examined under light microscopy. The accepted syngeneic skin grafts were treated in the same way and used as controls.

Killing assays

DN Treg clone and mutant cells were used as effector cells and plated in serial dilutions in a round-bottom 96-well plate. The 2CF₁.FcR^+/+ CD8⁺ T cell targets were activated for 4 days with irradiated (20 Gy) (CB6)F₁ splenocytes, labeled with 5 µCi/ml ⁵¹Cr at 37°C for 1.5 h, and washed, and 10⁴ cells were added to each well. Each cell culture was also given 50 U of rIL-2, 30 U of rIL-4, and irradiated (20 Gy) (CB6)F₁ splenocytes. After coculture with effector cells at 37°C for 18 h, the cells were harvested and counted using a TOPCOUNT cell harvester and plate reader (Packard Instrument). Specific cell killing was calculated using this equation: percentage of specific killing = (SE)/S x 100, in which E (experimental) is cpm in the presence of effector cells and S (spontaneous) is cpm in the absence of effector cells.

Western blotting

DN Treg (DN1 and DN2) and mutant (MU1 and MU2) clone cells were collected, and stimulator and necrotic cells were removed using Lympholyte M (Cedarlane Laboratories). The cells were confirmed to be >95% viable and then lysed using radioimmunoprecipitation assay buffer containing 0.1% aprotinin, 0.1% leupeptin, and 1 mM PMSF as protease inhibitors. Proteins were analyzed in whole cell lysates by previously described methods (37). A rabbit antiserum against -associated protein of 70 kDa (Zap70) was provided by J. Rojo (Centro de Investigaciones Biologicas, Madrid, Spain). The following commercially available Abs were used in these studies: rabbit anti-FcR, rabbit anti-Lck, and mouse anti-phosphotyrosine (4G10) (Upstate Biotechnology); rabbit anti-CD3 and anti-TCR (Santa Cruz Biotechnology); anti-Syk (Cell Signaling Technology); mouse anti--actin (Sigma-Aldrich); goat anti-rabbit HRP-conjugated secondary Abs (Bio-Rad); and goat anti-mouse HRP-conjugated secondary Abs (Amersham Biosciences). Signal detection was performed by chemiluminescence (Boehringer Mannheim), and image acquisition and analysis were done with the Fluorchem 8000 Advanced Imaging System (Alpha Innotech) and Phoretix 1D software (NonLinear Dynamics).

Immunoprecipitation

TCR cross-linking of DN Treg (DN1 and DN2) and mutant cells (MU1 and MU2) was performed, as previously described (38). Briefly, DN Treg and mutant cells were plated in 24-well culture plates (1.25 x 10⁵ cells/well), which were precoated with 1B2 mAb (10 µg/ml). All cells were supplemented with rIL-2 (50 U/ml) and rIL-4 (25 U/ml) during TCR cross-linking. Membrane protein was isolated using ProteoPrep Universal Extraction Kit (Sigma-Aldrich), and 100 µl of protein was incubated with the desired mAbs (anti-TCR, anti-FcR, or anti-Syk) in the presence of 100 µl of protein G-Sepharose 4 Fast Flow agarose beads (Amersham Biosciences) overnight at 4°C. Immunoprecipitates were then washed four times with lysis buffer before activity analysis. Proteins were analyzed in the immunoprecipitates by previously described methods (38). Hybridization signals were visualized using the Western Lightning Chemiluminescence Reagent Plus kit (PerkinElmer) after exposure to Kodak X-OMAT Blue x-ray film.

Statistics

Survival data were analyzed using the log rank test, and other data were analyzed using Student’s t test.

	Results

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
FcR-deficient primary 2CF₁ DN T cells have reduced ability to suppress allogeneically activated CD8⁺ T cells

Previously, we found that infusion of class I locus L^d+ splenocytes from (CB6)F₁ mice (H-2^b/d, L^d+) into 2CF₁ anti-L^d TCR transgenic (H-2^b/d, L^d–) mice before transplantation activates recipient DN Treg cells, resulting in permanent acceptance of donor-specific allografts, but does not affect the normal rejection of third-party skin allografts (9, 13). To determine the importance of FcR expression in DN Treg cell function in vivo, FcR-deficient 2CF₁ mice were generated, as described in Materials and Methods. First, we addressed whether primary DN T cells preferentially express FcR, and whether DLI can increase FcR expression. Naive FcR-deficient 2CF₁ mice were either given an L^d+ DLI from (CB6)F₁ mice or left untreated. The percentages of FcR⁺ cells in CD4⁺, CD8⁺, and DN T cell subsets in the spleen were determined by flow cytometry. As shown in Fig. 1A, 26% of naive DN T cells in 2CF₁ mice express FcR protein, which was significantly increased after DLI treatment (Fig. 1A). Unlike DN T cells, neither naive nor DLI-treated CD4⁺ and CD8⁺ T cells expressed significant levels of FcR protein.

View larger version (19K): [in this window] [in a new window]   FIGURE 1. FcR in primary 2CF1 DN T cells is up-regulated after DLI treatment and is important to maintain DN T cell-mediated suppression of syngeneic CD8+ T cells. A, Spleen cells were obtained from 2CF1.FcR–/– or 2CF1.FcR+/+ mice that were untreated or given a DLI of MHC class I Ld+ splenocytes and stained for 1B2 TCR (FITC), CD4 and CD8 (PE-CY5), and NK1.1 and TCR (PETR), followed by intracellular staining for FcR (PE). Cells were gated on either 1B2+CD4–CD8–NK1.1–TCR– (DN T cells; ) or 1B2+CD4+/CD8+ (). Percentage of FcR-positive cells is shown. B, Varying numbers of DN T cells isolated from spleens of DLI-treated 2CF1.FcR+/+ or 2CF1.FcR–/– mice were added to the MLR cultures as putative suppressor cells, as described in Materials and Methods. The data are expressed as percentage of inhibition of proliferation as compared with the controls to which no putative suppressor cells were added. This experiment was repeated at least three times to ensure reproducibility of the trend, and each data point was taken as the average of triplicate samples (*, p < 0.002; **, p < 0.01; and ***, p = 0.02).

FcR is important for primary 2CF₁ DN T cell-induced donor-specific skin allograft survival

We have reported previously that the adoptive transfer of DLI-activated primary DN T cells can significantly prolong donor-specific skin graft survival (15). To determine the in vivo effect of FcR deficiency on DN Treg cell function, L^d– (B6 x dm2)F₁ mice were infused with syngeneic 2CF₁.FcR^+/+ or 2CF₁.FcR^–/– DN T cells that had been preactivated by DLI treatment, as described above. One day after DN T cell infusion, each mouse was given a donor-specific L^d+ (CB6)F₁ and a third-party K^bm1+ (bm1) skin allograft, and graft survival was monitored (Fig. 2). L^d+ allograft survival was significantly prolonged (p < 0.0001) after treatment with 2CF₁.FcR^+/+ DN Treg cells (mean survival time (MST) = 24.7) compared with no treatment (MST = 12.6). However, 2CF₁.FcR^–/– DN T cell infusion did not significantly improve L^d+ skin allograft survival (MST = 14.3) when compared with untreated animals. All third-party bm1 skin grafts were rejected in a similar rate in all treatment groups, indicating that the enhancement of skin graft survival was donor specific. Therefore, FcR expression in DN T cells is important for maintenance of their ability to prolong donor-specific skin allograft survival.

View larger version (78K): [in this window] [in a new window]   FIGURE 2. Adoptively transferred DN T cells from FcR-sufficient, but not FcR-deficient, mice are able to prolong allograft survival. (B6 x dm2)F1 recipients were either left untreated or infused with 5 x 106 DLI-activated DN T cells from syngeneic 2CF1.FcR+/+ or 2CF1.FcR–/– mice. On the next day, all recipient mice were given a (CB6)F1 (donor-specific, open symbols) and a bm1 (third-party, closed symbols) skin allograft. A, Survival rates were compared among 2CF1.FcR+/+ DN T cell-treated (circles), 2CF1.FcR–/– DN T cell-treated (squares), and untreated (triangles) animals (n = 10). Ld+ (CB6)F1 grafts on 2CF1.FcR+/+-treated mice survive significantly longer than allografts on untreated recipients (p < 0.0001), but 2CF1.FcR–/–-treated allograft survival was not significantly enhanced. Third-party grafts did not show any significant increase in survival after DN T cell treatment. B, Representative photographs (above) and histological sections (below) of skin grafts taken at 21 days from 2CF1.FcR–/– (left), 2CF1.FcR+/+ (middle), and untreated mice (right). All groups except 2CF1.FcR+/+-treated Ld+ grafts show >90% necrosis and growth of nascent skin are visible underneath the darkly staining necrotic skin graft. Filled arrows on histology indicate hair follicles in the accepted skin graft, while few hair follicles were observed on rejected grafts.

FcR expression correlates with regulatory function of DN Treg cell clones

After confirming the importance of FcR for DN T cell-mediated regulatory function, we sought to elucidate the molecular basis of its function. Due to the fact FcR is only detectable intracellularly in DN T cells, it is not possible to sort out viable DN T cells from 2CF₁.FcR^+/+ mice based on their FcR expression. We thus analyzed two DN Treg and two mutant cell clones that were derived from 2CF₁.FcR^+/+ mice whose function has been described previously in vitro and in vivo (8, 16, 17). First, we confirmed that DN Treg cell clones express high levels of FcR mRNA and protein compared with mutant cell lines (Fig. 3, A and B). We then assessed the regulatory function of FcR^high DN Treg clone cells and FcR^low mutant clone cells (Fig. 3C) to confirm our previously reported function of these cell lines (8). Regulatory function was assessed using the killing assay instead of the suppression assay to allow for functional testing on the day of protein isolation. These data indicate a strong correlation of FcR expression with regulatory function of DN Treg clones.

View larger version (24K): [in this window] [in a new window]   FIGURE 3. FcR is up-regulated in DN Treg clone cells compared with nonfunctional mutants. DN Treg (DN1 and DN2) and mutant (MU1 and MU2) clone cells were analyzed for their FcR expression. A, Quantitative real-time PCR analysis of FcR mRNA expression in DN1 vs MU1 and DN2 vs MU2 cells. B, DN1 DN Treg cells and MU1 mutant cells are stained with rabbit anti-FcR or rabbit IgG control primary Ab (Upstate Biotechnology) and a PE-conjugated secondary Ab (Cedarlane Laboratories). FcR log fluorescence is shown. C, On the day of protein extraction, regulatory function was assessed. DN Treg clone and mutant cells were used as effector cells, and activated 2CF1.FcR+/+ CD8+ T cells were used as targets in a killing assay, as described in Materials and Methods. Percentage of specific cell killing is shown. This experiment was repeated at least three times to ensure reproducibility of the trend, and each data point was taken as the average of triplicate samples.

DN Treg cell clones contain FcR, but lack Lck and Zap70

Our microarray study of DN Treg clone cells found that in addition to FcR, several other TCR-related genes, including Lck and Zap70, were differentially expressed at the mRNA level (16). To further understand the molecular role of FcR in the TCR complex, we sought to determine the protein expression level of TCR-related molecules. Western blotting analysis indicated that DN Treg clone cells express high levels of TCR and FcR, but lack Zap70 and Lck expression. In contrast, mutant clone cells express very high levels of Zap70 and Lck, a low level of TCR, and an absence of FcR (Fig. 4A). Several other TCR-related proteins were also assessed, including linker for activation of T cells, AKT-1, and Csk, but no significant differences were observed (data not shown). Furthermore, we demonstrate that DN Treg TCR coprecipitates with FcR subunits instead of CD3 (Fig. 4B). In addition, we found that both FcR and Syk were phosphorylated after TCR cross-linking of DN Treg cells, suggesting that FcR and Syk are functional components of the TCR complex (Fig. 4C). This molecular analysis of TCR components of DN Treg cells suggests that FcR and Syk are part of the DN Treg TCR complex in place of the conventional CD3 and Zap70 subunits.

View larger version (19K): [in this window] [in a new window]   FIGURE 4. DN Treg clone cells contain FcR and lack Lck and Zap70. DN Treg (DN1 and DN2) and mutant (MU1 and MU2) cells were collected and protein was isolated, as described in Materials and Methods. A, Western blot analysis was used to detect protein expression of TCR, FcR, Zap70, and Lck in cell lysates. B, TCR complexes were immunoprecipitated from membrane fractions with TCR and probed with FcR and CD3. Membrane protein (without immunoprecipitation) from B6.FcR+/+ and B6.FcR–/– splenocytes was also run as Ab controls. C, TCR complexes were cross-linked by 10 µg/ml plate-bound anti-2C TCR Ab (1B2), and phosphorylation status of FcR and Syk was observed. Membrane protein was isolated before and 15 min after TCR cross-linking. FcR and Syk were immunoprecipitated and probed with antiphosphotyrosine (4G10).

Reduction of FcR expression via caspase-3 inhibition reduces suppression mediated by DN Treg clone cells

Recent studies have found that increased caspase-3 expression in T cells from SLE patients causes reduced CD3 expression and a reciprocal increase in FcR expression (36). Furthermore, we previously showed increased caspase-3 mRNA in DN Treg cells vs nonfunctional mutants in a cDNA microarray study (16). Because no known inhibitors of FcR are currently available, we used commercially available inhibitors of caspase-3 to further confirm the requirement of FcR expression for robust DN Treg cell function. DN Treg cells were incubated with a caspase-3 inhibitor (DEVD-FMK), caspase-8 inhibitor (IETD-CHO), or DMSO control. Only caspase-3 inhibitor treatment caused a significant reduction in FcR expression, while caspase-8 and DMSO had little effect (Fig. 5A). In addition, caspase-3 inhibitor-treated DN T cells that express low levels of FcR were tested for their ability to suppress activated CD8⁺ T cells. The suppression assay was modified to allow for testing of suppression function within 24 h of inhibitor incubation, and allow the inhibitors to only act on the DN T cells. We found that the caspase-3-treated DN T cells had significantly reduced suppressive function vs caspase-8 inhibitor-treated or DMSO-treated DN Treg cells (5:1 DNT:CD8; p = 0.02) (Fig. 5B). Therefore, these data further suggest that FcR expression is required to maintain the suppressive capacity of DN Treg cells.

View larger version (24K): [in this window] [in a new window]   FIGURE 5. Reduction of FcR expression via caspase-3 inhibition reduces DN Treg clone cell-mediated suppression. A, DN T clone cells (DN1) were cultured for 4 h at 37°C in the presence of equal volumes of either: 50 µM caspase-3 inhibitor, 50 µM caspase-8 inhibitor, or DMSO vehicle. After incubation, cells were washed three times with medium and the cells were analyzed for FcR expression by flow cytometry. B, The ability of DN T cells treated with caspase inhibitors to maintain their regulatory function was analyzed in a modified suppression assay in which only DN T cells are exposed to caspase inhibitors. DN T cells treated as above were added as putative suppressor cells to 2CF1 CD8+ T cells activated for 4 days with irradiated (CB6)F1 splenocytes. Cell proliferation was measured, as described in Materials and Methods. This experiment was repeated at least three times to ensure reproducibility of the trend, and each data point was taken as the average of triplicate samples (*, p = 0.01, and **, p = 0.02).

After establishing that the presence of FcR in DN Treg cells strongly correlated with suppressive function, we wanted to determine whether signaling through the FcR pathway was also required for suppression mediated by primary DN T cells. Syk is a kinase that has been established to bind to phosphorylated FcR molecules and mediate downstream signal transduction (39). We used the Syk family kinase inhibitor piceatannol, which has been described to preferentially inhibit the tyrosine kinase activity of Syk in a dose-dependent manner (33), and a newly described Syk inhibitor sulfonamide-31 (34) that functions at much lower concentrations than piceatannol. When increasing concentrations of Syk inhibitors were added to suppression assays with primary 2CF₁ DN T cell effectors, the suppression was reduced as inhibitor concentration was increased (Fig. 6). This evidence suggests that signaling through Syk and the associated FcR pathway may be important to maintain the suppressive function of primary DN Treg cells.

View larger version (18K): [in this window] [in a new window]   FIGURE 6. Inhibition of Syk significantly reduces primary 2CF1 DN T cell-mediated suppression in vitro. DLI-activated 2CF1.FcR+/+ DN T cells (5000 cells/well) were added as putative suppressors in standard suppression assays, as described in Fig. 1. Naive 2CF1.FcR+/+ splenocytes were depleted of CD4+ T cells and used as responder cells (1000 CD8+ T cells/well). Serial dilutions of Syk inhibitors piceatannol (A) or sulfonamide-31 (B), or equal volume of DMSO vehicle were added to the MLR. Data show percentage of inhibition of proliferation as compared with the controls to which no putative suppressor cells were added. This experiment was repeated at least three times to ensure reproducibility of the trend, and each data point was taken as the average of triplicate samples.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

Despite the importance of DLI treatment to activate DN Treg cells, we found that naive animals do have a quantity of FcR⁺ DN T cells (Fig. 1A), suggesting that DLI may not necessarily be required to induce all functional DN Treg cells, but some may be naturally induced. This is also supported by the fact that DN Treg clone cells generated from both DLI-treated and naive mice are FcR⁺ and function in a similar fashion (8) (Figs. 3 and 4). The increase in FcR⁺ DN T cells after DLI might be due to an expansion of the naturally present subset of FcR⁺-suppressive cells or, alternatively, may be due to a transition of a subset of naive/nonsuppressive FcR^– DN T cells to a suppressive FcR⁺ phenotype, similar to what has been suggested for CD4⁺ and CD8⁺ Ag-induced Treg cells (40). This concept of transition of signaling machinery is supported by finding that FcR is up-regulated in human effector CD4⁺ T cells, but not detected in naive or memory CD4⁺ T cells (27, 41). Further studies will be required to determine at which developmental stage DN Treg cells begin to express FcR.

We observed a high amount of FcR and no detectable amounts of CD3 protein expression in DN Treg clones (Fig. 4). Reduced levels of CD3 and increased FcR have been observed in human T cells from a wide array of chronic diseases such as chronic infections, autoimmune diseases (including SLE), and cancer (41). Despite the fact that this alteration may occur in pathogenic T cells, it is possible that DN Treg cells may also be serving to suppress these pathogenic cells. A large expansion of DN T cells has been observed in Fas mutant autoimmune lymphoproliferative syndrome patients as well as the Fas mutant lymphoproliferative (lpr) mouse model. We previously found that the DN T cells isolated from lpr mice still maintain regulatory capacity, but are less effective due to the Fas mutation on autoimmune effector T cells (15). Our recent data suggest that FcR may also play a role in mediating the suppressive function of lpr DN T cells and their ability to control lymphoproliferative disease (C. W. Thomson, W. Chen, J. R. Torrealba, and L. Zhang, submitted for publication).

Recent studies reported that treatment of T cells derived from SLE patients with caspase-3 inhibitors reduces the expression of FcR (36). Interestingly, we found that DN Treg cells express higher levels of both FcR and caspase-3 mRNA compared with nonfunctional mutants (16), suggesting that these proteins may be similarly regulated in murine DN Treg cells. As no FcR inhibitor was available, we used a caspase-3 inhibitor reagent (DEVD-FMK) that effectively reduces both FcR expression and suppressive function of DN Treg cells (Fig. 5). This study further confirmed the need for FcR expression to achieve robust DN T cell-mediated suppression. Reports have suggested that caspase-3 does not directly act on FcR molecules, but rather functions by cleaving CD3 molecules, and the reduced levels of CD3 protein lead to increased FcR expression (36, 42). In other T cells, such as human effector CD4⁺ T cells and tumor-infiltrating lymphocytes, up-regulation of FcR is associated with down-regulation of CD3 expression (27, 43). Based on this model, we would expect that the FcR-low mutant cells would have increased levels of CD3 protein. However, we observed that both suppressive and mutant clones had undetectable levels of CD3 protein in the TCR complex (Fig. 4B). This suggests that the regulation of FcR and CD3 expression may be more complex than originally thought or perhaps the changes that resulted in the mutant clone phenotype may have disrupted the normal processes that regulate FcR and CD3 proteins. In addition, the low TCR levels observed in mutant cells (Fig. 4A) may also be related to the absence of either FcR or CD3, because they are required to form stable TCR complexes (23).

In addition to lacking CD3 and Zap70, we also found that DN Treg cells do not express the Src family kinase Lck (Fig. 4), which is an important part of the conventional TCR complex. During standard TCR signaling, Lck has been shown to phosphorylate the ITAMs of CD3 leading to binding of Zap70, and subsequently Lck also phosphorylates Zap70 to aid in its activation (44). This function of Lck has been found to be important for both T cell development and mature function. However, our results suggest that functional DN Treg cells do not require Lck. The absence of Lck in DN Treg cells is not surprising, first because we suggest that DN Tregs signal in a CD3/Zap70-independent manner, and second because Lck is known to form noncovalent interactions with CD4 and CD8 coreceptors that DN Treg cells also lack (45). Further studies will determine whether other kinases such as the classical FcR-associated kinase Lyn (46) or Fyn are responsible for mediating DN Treg TCR signal transduction in lieu of Lck. Fyn is a likely candidate as studies from other groups have previously suggested that functionally anergized DN T cells derived from 2C mice expressing L^d have higher levels of Fyn than DN T cells derived from L^d– 2C mice (47).

Previous studies have shown that T cell FcR expression and signal transduction through Syk are associated with a higher magnitude signaling process, evidenced by increased free intracytoplasmic calcium (Ca²⁺) response and protein tyrosine phosphorylation responses (26, 48). We found that phosphorylation of Syk is increased in DN Treg cell clones after CD3 cross-linking (Fig. 4C), and blocking of Syk in primary DN T cells reduced their suppressive function (Fig. 6). There are several possibilities how FcR and Syk signaling may affect DN Treg function. FcR and Syk kinase may act to promote survival and increase activation and/or other functions that affect the regulatory ability of DN Treg cells. FcR-associated signaling in monocytes has been shown to increase levels of the survival proteins Bcl-2 and Bcl-x_L (49), suggesting that FcR may promote the survival of DN T cells that are otherwise prone to apoptosis. Consistent with this possibility, DN Treg cells have been found to express Bcl-x_L constitutively and up-regulate Bcl-2 expression after TCR cross-linking, leading to a significant resistance to TCR cross-linking-induced apoptosis (50). Aside from increasing survival, FcR-associated signaling may serve to promote the activation state of naive DN T cells, allowing them to make the transition into functional regulatory cells.

Our findings suggest that FcR is required for efficient regulatory function of DN T cells. Others have reported recently that human DN Treg cells function very similarly to murine DN T cells in their ability to suppress CD8⁺ T cells in an Ag-specific manner (51). If it is confirmed that human DN Treg cells also use FcR in their TCR complex, we can potentially exploit this biomarker in therapeutic regimens. We propose that DN T cell-associated FcR expression could serve to assess the presence of functional DN Treg cells for predicting therapeutic responses. Considering their function in suppressing immune responses, FcR-expressing DN T cells could be considered as potential targets of various pharmaceutical agents such as antirejection or chemotherapeutic drugs.

	Acknowledgments

 
We thank Mariana Vidric for critically reviewing this manuscript.

	Disclosures

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The authors have no financial conflict of interest.

	Footnotes

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ This work was supported by Canadian Institutes of Health Research Grant and the Canadian Cancer Society (to L.Z.). C.W.T. is partially supported by Canadian Institute of Health Research Training Program in Regenerative Medicine. Further funding was provided by Wyeth-Ayerst Canada (to L.Z.).

² Address correspondence and reprint requests to Dr. Li Zhang, 101 College Street, Room 2-807, Toronto Medical Discovery Tower, MaRS Centre, University Health Network, University of Toronto, Toronto, Ontario, M5G 1L7, Canada. E-mail address: lzhang{at}transplantunit.org

³ Abbreviations used in this paper: Treg, T regulatory; DLI, donor lymphocyte infusion; DN, double negative; lpr, lymphoproliferative; MST, median survival time; QRT-PCR, quantitative RT-PCR; SLE, systemic lupus erythematosus.

Received for publication March 23, 2006. Accepted for publication May 16, 2006.

	References

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 

1. Shevach, E. M.. 2000. Regulatory T cells in autoimmunity. Annu. Rev. Immunol. 18: 423-449. [Medline]
2. Von Herrath, M. G., L. C. Harrison. 2003. Antigen-induced regulatory T cells in autoimmunity. Nat. Rev. Immunol. 3: 223-232. [Medline]
3. Sakaguchi, S.. 2005. Naturally arising Foxp3-expressing CD25⁺CD4⁺ regulatory T cells in immunological tolerance to self and non-self. Nat. Immunol. 6: 345-352. [Medline]
4. Young, K. J., L. S. Kay, M. J. Phillips, L. Zhang. 2003. Antitumor activity mediated by double-negative T cells. Cancer Res. 63: 8014-8021. [Abstract/Free Full Text]
5. Waldmann, H., L. Graca, S. Cobbold, E. Adams, M. Tone, Y. Tone. 2004. Regulatory T cells and organ transplantation. Semin. Immunol. 16: 119-126. [Medline]
6. Walsh, P. T., D. K. Taylor, L. A. Turka. 2004. Tregs and transplantation tolerance. J. Clin. Invest. 114: 1398-1403. [Medline]
7. Wood, K. J., S. Sakaguchi. 2003. Regulatory T cells in transplantation tolerance. Nat. Rev. Immunol. 3: 199-210. [Medline]
8. Zhang, Z. X., L. Yang, K. J. Young, B. DuTemple, L. Zhang. 2000. Identification of a previously unknown antigen-specific regulatory T cell and its mechanism of suppression. Nat. Med. 6: 782-789. [Medline]
9. Young, K. J., L. Yang, M. J. Phillips, L. Zhang. 2002. Donor-lymphocyte infusion induces transplantation tolerance by activating systemic and graft-infiltrating double-negative regulatory T cells. Blood 100: 3408-3414. [Abstract/Free Full Text]
10. Karim, M., G. Feng, K. J. Wood, A. R. Bushell. 2005. CD25⁺CD4⁺ regulatory T cells generated by exposure to a model protein antigen prevent allograft rejection: antigen-specific reactivation in vivo is critical for bystander regulation. Blood 105: 4871-4877. [Abstract/Free Full Text]
11. Cavinato, R. A., F. Casiraghi, N. Azzollini, P. Cassis, D. Cugini, M. Mister, A. Pezzotta, S. Aiello, G. Remuzzi, M. Noris. 2005. Pretransplant donor peripheral blood mononuclear cells infusion induces transplantation tolerance by generating regulatory T cells. Transplantation 79: 1034-1039. [Medline]
12. Chen, W., D. Zhou, J. R. Torrealba, T. K. Waddell, D. Grant, L. Zhang. 2005. Donor lymphocyte infusion induces long-term donor-specific cardiac xenograft survival through activation of recipient double-negative regulatory T cells. J. Immunol. 175: 3409-3416. [Abstract/Free Full Text]
13. Yang, L., T. B. Du, Q. Khan, L. Zhang. 1998. Mechanisms of long-term donor-specific allograft survival induced by pretransplant infusion of lymphocytes. Blood 91: 324-330. [Abstract/Free Full Text]
14. Yang, L., B. DuTemple, R. M. Gorczynski, G. Levy, L. Zhang. 1999. Evidence for epitope spreading and active suppression in skin graft tolerance after donor-specific transfusion. Transplantation 67: 1404-1410. [Medline]
15. Ford, M. S., K. J. Young, Z. Zhang, P. S. Ohashi, L. Zhang. 2002. The immune regulatory function of lymphoproliferative double negative T cells in vitro and in vivo. J. Exp. Med. 196: 261-267. [Abstract/Free Full Text]
16. Lee, B. P., E. Mansfield, S. C. Hsieh, T. Hernandez-Boussard, W. Chen, C. W. Thomson, M. S. Ford, S. E. Bosinger, S. Der, Z. X. Zhang, et al 2005. Expression profiling of murine double-negative regulatory T cells suggests mechanisms for prolonged cardiac allograft survival. J. Immunol. 174: 4535-4544. [Abstract/Free Full Text]
17. Chen, W., M. S. Ford, K. J. Young, L. Zhang. 2003. Infusion of in vitro-generated DN T regulatory cells induces permanent cardiac allograft survival in mice. Transplant. Proc. 35: 2479-2480. [Medline]
18. Takai, T.. 2005. Fc receptors and their role in immune regulation and autoimmunity. J. Clin. Immunol. 25: 1-18. [Medline]
19. Nimmerjahn, F., P. Bruhns, K. Horiuchi, J. V. Ravetch. 2005. FcRIV: a novel FcR with distinct IgG subclass specificity. Immunity 23: 41-51. [Medline]
20. Ono, M., T. Yuasa, C. Ra, T. Takai. 1999. Stimulatory function of paired immunoglobulin-like receptor-A in mast cell line by associating with subunits common to Fc receptors. J. Biol. Chem. 274: 30288-30296. [Abstract/Free Full Text]
21. Nakajima, H., J. Samaridis, L. Angman, M. Colonna. 1999. Human myeloid cells express an activating ILT receptor (ILT1) that associates with Fc receptor -chain. J. Immunol. 162: 5-8. [Abstract/Free Full Text]
22. Tsuji, M., Y. Ezumi, M. Arai, H. Takayama. 1997. A novel association of Fc receptor -chain with glycoprotein VI and their co-expression as a collagen receptor in human platelets. J. Biol. Chem. 272: 23528-23531. [Abstract/Free Full Text]
23. Koyasu, S., L. D’Adamio, A. R. Arulanandam, S. Abraham, L. K. Clayton, E. L. Reinherz. 1992. T cell receptor complexes containing FcRI homodimers in lieu of CD3 and CD3 components: a novel isoform expressed on large granular lymphocytes. J. Exp. Med. 175: 203-209. [Abstract/Free Full Text]
24. Arase, H., S. Ono, N. Arase, S. Y. Park, K. Wakizaka, H. Watanabe, H. Ohno, T. Saito. 1995. Developmental arrest of NK1.1⁺ T cell antigen receptor (TCR)-⁺ T cells and expansion of NK1.1⁺ TCR-⁺ T cell development in CD3-deficient mice. J. Exp. Med. 182: 891-895. [Abstract/Free Full Text]
25. Hayes, S. M., P. E. Love. 2002. Distinct structure and signaling potential of the TCR complex. Immunity 16: 827-838. [Medline]
26. Enyedy, E. J., M. P. Nambiar, S. N. Liossis, G. Dennis, G. M. Kammer, G. C. Tsokos. 2001. Fc receptor type I chain replaces the deficient T cell receptor chain in T cells of patients with systemic lupus erythematosus. Arthritis Rheum. 44: 1114-1121. [Medline]
27. Krishnan, S., V. G. Warke, M. P. Nambiar, G. C. Tsokos, D. L. Farber. 2003. The FcR subunit and Syk kinase replace the CD3 -chain and ZAP-70 kinase in the TCR signaling complex of human effector CD4 T cells. J. Immunol. 170: 4189-4195. [Abstract/Free Full Text]
28. Rodewald, H. R., A. R. Arulanandam, S. Koyasu, E. L. Reinherz. 1991. The high affinity Fc receptor subunit (FcRI) facilitates T cell receptor expression and antigen/major histocompatibility complex-driven signaling in the absence of CD3 and CD3. J. Biol. Chem. 266: 15974-15978. [Abstract/Free Full Text]
29. Takai, T., M. Li, D. Sylvestre, R. Clynes, J. V. Ravetch. 1994. FcR chain deletion results in pleiotrophic effector cell defects. Cell 76: 519-529. [Medline]
30. Sha, W. C., C. A. Nelson, R. D. Newberry, D. M. Kranz, J. H. Russell, D. Y. Loh. 1988. Selective expression of an antigen receptor on CD8-bearing T lymphocytes in transgenic mice. Nature 335: 271-274. [Medline]
31. Kishimoto, H., J. Sprent. 1999. Several different cell surface molecules control negative selection of medullary thymocytes. J. Exp. Med. 190: 65-73. [Abstract/Free Full Text]
32. Sha, W. C., C. A. Nelson, R. D. Newberry, D. M. Kranz, J. H. Russell, D. Y. Loh. 1988. Positive and negative selection of an antigen receptor on T cells in transgenic mice. Nature 336: 73-76. [Medline]
33. Oliver, J. M., D. L. Burg, B. S. Wilson, J. L. McLaughlin, R. L. Geahlen. 1994. Inhibition of mast cell FcR1-mediated signaling and effector function by the Syk-selective inhibitor, piceatannol. J. Biol. Chem. 269: 29697-29703. [Abstract/Free Full Text]
34. Lai, J. Y., P. J. Cox, R. Patel, S. Sadiq, D. J. Aldous, S. Thurairatnam, K. Smith, D. Wheeler, S. Jagpal, S. Parveen, et al 2003. Potent small molecule inhibitors of spleen tyrosine kinase (Syk). Bioorg. Med. Chem. Lett. 13: 3111-3114. [Medline]
35. Gastman, B. R., D. E. Johnson, T. L. Whiteside, H. Rabinowich. 1999. Caspase-mediated degradation of T-cell receptor -chain. Cancer Res. 59: 1422-1427. [Abstract/Free Full Text]
36. Krishnan, S., J. G. Kiang, C. U. Fisher, M. P. Nambiar, H. T. Nguyen, V. C. Kyttaris, B. Chowdhury, V. Rus, G. C. Tsokos. 2005. Increased caspase-3 expression and activity contribute to reduced CD3 expression in systemic lupus erythematosus T cells. J. Immunol. 175: 3417-3423. [Abstract/Free Full Text]
37. Chau, L. A., J. A. Bluestone, J. Madrenas. 1998. Dissociation of intracellular signaling pathways in response to partial agonist ligands of the T cell receptor. J. Exp. Med. 187: 1699-1709. [Abstract/Free Full Text]
38. Marra, L. E., Z. X. Zhang, B. Joe, J. Campbell, G. A. Levy, J. Penninger, L. Zhang. 2004. IL-10 induces regulatory T cell apoptosis by up-regulation of the membrane form of TNF-. J. Immunol. 172: 1028-1035. [Abstract/Free Full Text]
39. Berton, G., A. Mocsai, C. A. Lowell. 2005. Src and Syk kinases: key regulators of phagocytic cell activation. Trends Immunol. 26: 208-214. [Medline]
40. Vigouroux, S., E. Yvon, E. Biagi, M. K. Brenner. 2004. Antigen-induced regulatory T cells. Blood 104: 26-33. [Abstract/Free Full Text]
41. Krishnan, S., D. L. Farber, G. C. Tsokos. 2003. T cell rewiring in differentiation and disease. J. Immunol. 171: 3325-3331. [Free Full Text]
42. Nambiar, M. P., C. U. Fisher, V. G. Warke, S. Krishnan, J. P. Mitchell, N. Delaney, G. C. Tsokos. 2003. Reconstitution of deficient T cell receptor chain restores T cell signaling and augments T cell receptor/CD3-induced interleukin-2 production in patients with systemic lupus erythematosus. Arthritis Rheum. 48: 1948-1955. [Medline]
43. Mizoguchi, H., J. J. O’Shea, D. L. Longo, C. M. Loeffler, D. W. McVicar, A. C. Ochoa. 1992. Alterations in signal transduction molecules in T lymphocytes from tumor-bearing mice. Science 258: 1795-1798. [Abstract/Free Full Text]
44. Palacios, E. H., A. Weiss. 2004. Function of the Src-family kinases, Lck and Fyn, in T-cell development and activation. Oncogene 23: 7990-8000. [Medline]
45. Veillette, A., M. A. Bookman, E. M. Horak, J. B. Bolen. 1988. The CD4 and CD8 T cell surface antigens are associated with the internal membrane tyrosine-protein kinase p56^lck. Cell 55: 301-308. [Medline]
46. Xu, Y., K. W. Harder, N. D. Huntington, M. L. Hibbs, D. M. Tarlinton. 2005. Lyn tyrosine kinase: accentuating the positive and the negative. Immunity 22: 9-18. [Medline]
47. Utting, O., S. J. Teh, H. S. Teh. 2000. A population of in vivo anergized T cells with a lower activation threshold for the induction of CD25 exhibit differential requirements in mobilization of intracellular calcium and mitogen-activated protein kinase activation. J. Immunol. 164: 2881-2889. [Abstract/Free Full Text]
48. Nambiar, M. P., C. U. Fisher, A. Kumar, C. G. Tsokos, V. G. Warke, G. C. Tsokos. 2003. Forced expression of the Fc receptor -chain renders human T cells hyperresponsive to TCR/CD3 stimulation. J. Immunol. 170: 2871-2876. [Abstract/Free Full Text]
49. Katoh, N., S. Kraft, J. H. Wessendorf, T. Bieber. 2000. The high-affinity IgE receptor (FcRI) blocks apoptosis in normal human monocytes. J. Clin. Invest. 105: 183-190. [Medline]
50. Khan, Q., J. M. Penninger, L. Yang, L. E. Marra, I. Kozieradzki, L. Zhang. 1999. Regulation of apoptosis in mature ⁺CD4^–CD8^– antigen-specific suppressor T cell clones. J. Immunol. 162: 5860-5867. [Abstract/Free Full Text]
51. Fischer, K., S. Voelkl, J. Heymann, G. K. Przybylski, K. Mondal, M. Laumer, L. Kunz-Schughart, C. A. Schmidt, R. Andreesen, A. Mackensen. 2005. Isolation and characterization of human antigen-specific TCR⁺ CD4^–CD8^– double-negative regulatory T cells. Blood 105: 2828-2835. [Abstract/Free Full Text]

This article has been cited by other articles:

C. L. Abram and C. A. Lowell The Expanding Role for ITAM-Based Signaling Pathways in Immune Cells Sci. Signal.,