The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brown, H. J.
Right arrow Articles by Robson, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brown, H. J.
Right arrow Articles by Robson, M. G.
The Journal of Immunology, 2006, 177: 1925-1931.
Copyright © 2006 by The American Association of Immunologists

TLR2 Stimulation of Intrinsic Renal Cells in the Induction of Immune-Mediated Glomerulonephritis1

Heather J. Brown2, Helen R. Lock, Steven H. Sacks and Michael G. Robson

Department of Nephrology and Transplantation, King’s College London School of Medicine, Guy’s Hospital, London, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Infection may exacerbate organ-specific autoimmune disease such as glomerulonephritis. This may occur in the absence of a measurable effect on the adaptive immune response, and the mechanisms responsible are not fully understood. To investigate this, we have studied the effect of TLR2 ligation by the synthetic ligand Pam3CysSK4 on the development of glomerulonephritis in mice. We demonstrated that glomerular inflammation induced by passive administration of nephrotoxic Ab does not occur in the absence of TLR2 stimulation, with a strong synergy when Ab deposition and TLR2 stimulation occur together. Parameters of glomerular inflammation were neutrophil influx, thrombosis, and albuminuria. To investigate the relative contribution of TLR2 on bone marrow-derived cells and intrinsic renal cells, we constructed bone marrow chimeras. Nephrotoxic Ab and TLR2 ligation caused a neutrophil influx in both types of chimera at a similar level to that seen in sham chimeras totally TLR2 sufficient. Albuminuria was seen in both types of chimera above that seen in sham chimeras that were totally TLR2 deficient. This was greater in chimeras with TLR2 present on bone marrow-derived cells. To find a potential mechanism by which intrinsic renal cells may contribute toward disease exacerbation, mesangial cells were studied and shown to express TLR2 and MyD88. Wild-type but not TLR2-deficient mesangial cells produced CXC chemokines in response to stimulation with Pam3CysSK4. These results demonstrate that TLR2 stimulation on both bone marrow-derived and resident tissue cells plays a role in amplifying the inflammatory effects of Ab deposition in the glomerulus.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Autoimmune disease in man can be exacerbated by systemic infection. This is seen in multiple sclerosis and in several types of glomerulonephritis. Examples of the latter are IgA nephropathy, where an upper respiratory tract infection commonly precedes disease presentation (1), and antiglomerular basement membrane disease, where exacerbations during treatment are often related to infection (2). Relapses of anti-neutrophil cytoplasmic Ab-associated vasculitis are also associated with nasal carriage of Staphylococcus aureus (3) and prevented by antimicrobial therapy (4).

TLRs are a family of receptors that recognize endotoxin and other ligands derived from pathogens. They are likely to play a major role in the exacerbation of autoimmune disease by infection.

So far, 11 mammalian TLRs have been described (5). It was discovered that TLR4 is the specific receptor for endotoxin, when two endotoxin-tolerant mouse strains were found to have mutations in TLR4 (6). TLR2 was subsequently found to be the receptor for various Gram-positive and -negative ligands including lipopeptide and peptidoglycan, as demonstrated by studies in gene-targeted mice (5). As well as leukocytes, TLRs are also widely distributed on non-bone marrow-derived cells (7). There are at least three mechanisms by which infection could potentially exacerbate glomerulonephritis. First, TLR agonists could act on cells of the innate immune system such as neutrophils and macrophages to increase glomerular inflammation. Second, inflammation could be potentiated by TLRs present on intrinsic renal cells. Third, the nephritogenic adaptive immune response could be augmented or modulated by TLR agonists. In this study, we use heterologous nephrotoxic nephritis, a passive model of Ab-mediated glomerular inflammation, to study the first two of these three mechanisms.

Heterologous nephrotoxic nephritis is an animal model of Ab-mediated glomerular inflammation, in which a foreign Ab binds to the glomerular basement membrane, and passively produces disease (8, 9). A glomerular neutrophil influx peaks at around 2 h and is largely resolved by 24 h with accompanying proteinuria. It has been shown that endotoxin (LPS) can exacerbate disease in this model in both the rat and mouse (10, 11), although the mechanisms have not been explored in detail. We are not aware of any studies in which disease has been induced in the heterologous model with serum alone, with the documented absence of any endotoxin contamination. Previous studies used crude preparations of endotoxin, now known to contain agonists for both TLR2 and TLR4 (12). Therefore, the precise role of each receptor is difficult to deduce from these experiments. Because disease is caused by injected exogenous Ab, this model is ideally suited to address mechanisms independently of any potential effects of TLR stimulation on the adaptive immune response. Because upper respiratory tract infections have been particularly implicated in the exacerbation of glomerulonephritis, we have chosen to study the role of TLR2, the main receptor for ligands derived from Gram-positive bacteria. We show that, for inflammation and tissue damage to occur in response to Ab deposition, there is a requirement for TLR2 ligation. TLR2 on both leukocytes and intrinsic renal cells is able to mediate this amplification of neutrophil influx. However, TLR2 ligation on neutrophils is required for maximal tissue injury as shown by albuminuria.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Preparation of nephrotoxic serum (NTS)3

A mouse glomerular extract was made as previously described (13) and serum was prepared in sheep by Micropharm. The NTS was heat-inactivated at 56°C for 30 min and frozen in aliquots at –20°C until use. The endotoxin content of the serum was measured using a chromogenic kinetic Limulus amebocyte lysate assay by Cambrex Bioscience. The amount of endotoxin received by each mouse was <0.1 endotoxin units.

Preparation of TLR agonists

Pam3CysSK4 (EMC Microcollections) was dissolved in DMSO and stored in aliquots at –20°C until use. The final concentration of DMSO in injected serum was 0.1%, and control animals received an equivalent amount of DMSO. Synthetic lipid A ONO-4007 (Ono Pharmaceutical) was dissolved in 50% ethanol and stored in aliquots at –20°C until use. The final concentration of ethanol in injected serum was 0.5%. For mesangial cell stimulation experiments, Pam3CysSK4 was reconstituted and stored as described above. All cultures in each mesangial cell experiment contained the equivalent amount of DMSO, which was 10–4%. The TLR4 agonist used for mesangial cell stimulation experiments was highly purified LPS from Escherichia coli R515 (581-007-L002; Alexis). This was in an aqueous solution, and frozen in aliquots until use.

Induction of glomerulonephritis

TLR2-deficient mice (backcrossed six generations to C57BL/6) were obtained from S. Akira (Osaka University, Osaka, Japan) (14), and wild-type C57BL/6 mice were from B&K Universal Limited. Animal experiments were performed according to Home Office regulations. Pam3CysSK4 (EMC Microcollections) and synthetic lipid A ONO-4007 (Ono Pharmaceutical) were used as TLR2 and TLR4 agonists. Glomerulonephritis was induced by 200 µl of NTS given with TLR agonist (10 µg/mouse) or vehicle, or the TLR agonist was given alone. All components were given together as a single tail-vein injection.

Histological assessment of glomerular inflammation

The glomerular histology was assessed at 2 and 24 h following disease induction with NTS. Kidneys were fixed in Bouin’s solution and stained with periodic acid-Schiff reagent. At 2 h, the number of neutrophils (identified by their characteristic nuclear morphology) per 50 glomerular cross sections was counted. At 24 h, the amount of glomerular thrombosis was assessed by identification of the amount of periodic acid-Schiff-positive material. In total, 50 glomeruli were assessed for each animal for signs of glomerular thrombosis, and a score was assigned as follows: grade 0, no periodic acid-Schiff-positive material; grade 1, <25%; grade 2, 25–50%; grade 3, 50–75%; grade 4, 75–100%. All sections scored for neutrophils and glomerular thrombosis were done so blindly.

Urinary albumin measurement

Mice were housed singly in glass metabolic cages for 24 h immediately following disease induction with NTS to measure the 24-h albuminuria. The urinary albumin concentration was measured by radial immunodiffusion as previously described (13). The sensitivity of the radial immunodiffusion assay for albumin was 0.05 mg/ml.

Peripheral neutrophil counts and measurement of glomerular sheep IgG deposition

The total white cell number was counted, on tail-vein blood, after lysing red cells in 2% acetic acid, and a blood film was made to assess the percentage neutrophils. Frozen sections were stained with FITC-conjugated donkey anti-sheep IgG (Jackson ImmunoResearch Laboratories), and images were saved of 20 glomeruli for each sample. The mean fluorescence intensity was then measured using Adobe Photoshop software version 8.0 (Adobe Systems).

Bone marrow transplantation

Chimeric mice were made by irradiation with a dose of 9 Gy and reconstitution with 5 x 106 donor bone marrow cells, using 6- to 10-wk-old animals. After 8 wk, genomic DNA was extracted from peripheral blood and real-time PCR was performed using DyNAmo Hot Start SYBR Green qPCR kit (Braintree). GAPDH was used as a gene present in both wild-type and TLR2-deficient mouse DNA, and the neomycin resistance gene used as one present only in TLR2-deficient DNA. A previously published mathematical model was used for relative quantification (15). DNA from a TLR2-deficient mouse was used as a standard, and results expressed as a percentage of this value.

Mesangial cell culture

Renal cortex was taken from wild-type and TLR2-deficient mice into RPMI 1640 medium (Invitrogen Life Technologies), minced with a scalpel, and passed twice through a 100-µm cell strainer. It was then put onto a 40-µm cell strainer, and the material that would not pass through the strainer was collected. After centrifugation, the pellet was digested with type IV collagenase (Sigma-Aldrich) at 37°C for 10 min before culture. Glomeruli were cultured in medium consisting of RPMI 1640, supplemented with 10% FCS, 1% insulin, transferrin, selenium, and 1% penicillin/streptomycin. These cell culture reagents were all from Invitrogen Life Technologies. After four passages, a pure population of mesangial cells was seen. These were characterized by positive immunocytochemistry for desmin, vimentin, and smooth muscle actin. Macrophages were excluded by negative staining for CD68, endothelial cells by negative staining for factor VIII, and epithelial cells by negative staining for cytokeratin. The primary Abs used for this characterization included Abs to CD68 (monoclonal FA11; Serotec) and factor VIII (rabbit polyclonal from DakoCytomation). Other primary Abs were all from Sigma-Aldrich. These were Abs to desmin (monoclonal DE-U-10), vimentin (monoclonal VIM 13-2), smooth muscle actin (monoclonal I-A4), and cytokeratin (monoclonal PCK-26). Smooth muscle actin staining was done by direct immunofluorescence with a FITC-conjugated primary Ab. Other staining was performed by indirect immunofluorescence using FITC-conjugated secondary Abs from Jackson ImmunoResearch Laboratories. Following cell characterization, the cell purity was found to be >98%. Mesangial cells were cultured in medium consisting of RPMI 1640, supplemented with 10% FCS, 1% insulin, transferrin, selenium, and 1% penicillin/streptomycin (Invitrogen Life Technologies).

For TLR agonist stimulation experiments, cells were grown in 24-well plates to generate supernatants for ELISAs, and in 75-cm2 flasks before mRNA extraction. All cultures were performed in triplicate. To show the presence of TLR2 and MyD88 mRNA in primary cultures of wild-type mesangial cells, endpoint RT-PCR was used. Cells were stimulated with TLR agonists (prepared as above) for 24 h, after which supernatants were taken for ELISAs for CXCL1 and CXCL2 (from R&D Systems). The sensitivity of the assays were 156 and 31 pg/ml for CXCL1 and for CXCL2, respectively. Mesangial cells were stimulated for 6 h before mRNA extraction and cDNA synthesis for real-time PCR with DyNAmo Hot Start SYBR Green qPCR kit (Braintree).

Primers

Primers for PCRs were as follows (sense, antisense, annealing temperature in °C): GAPDH: ACCACAGTCCATGCCATCAC, TCCACCACCCTGTTGCTGTA, 56; Neomycin: AAGGGACTGGCTGCTATTGG, TATGTCCTGATAGCGGTCCG, 60; TLR2: TCTGGGCAGTCTTGAACATTT, AGAGTCAGGTGATGGATGTCG, 61; Myd88: ATCCGAGAGCTGGAAACG, GCAAGGGTTGGTTAATC, 51; beta-actin: GAGCAAGAGAGGTATCCTGACC, GGATGCCACAGGATTCCATACC, 51; CXCL1: CTTGAAGGTGTTGCCCTCAG, TGGGGACACCTTTTAGCATC, 60; CXCL2: CCAAGGGTTGACTTCAAGAAC, CCCTTGAGAGTGGCTATGACT, 60.

Statistics

The groups of data were compared using the unpaired t test and GraphPad Prism software (GraphPad). Where the F test suggested that variances were significantly different, data were analyzed after a logarithmic transformation.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Lipopeptide exacerbates disease in wild-type but not TLR2-deficient animals

To assess the role of lipopeptide in exacerbating glomerulonephritis, we gave NTS with or without 10 µg of the lipopeptide Pam3CysSK4, or Pam3CysSK4 alone, to wild-type and TLR2-deficient mice. In each case, the component(s) were given together as a single i.v. injection. At 2 h, a significant glomerular neutrophil infiltrate was seen only in wild-type, but not TLR2-deficient animals given Pam3CysSK4 and NTS together. A neutrophil influx was not seen in either wild-type or TLR2-deficient animals given NTS or Pam3CysSK4 alone. Data are shown graphically in Fig. 1A, with representative histology in D. To establish that the TLR2-deficient animals were able to mount a neutrophil influx, their response to a TLR4 agonist when given with NTS was assessed. Nephritis was induced simultaneously in TLR2-deficient animals and wild types by giving the TLR4 agonist lipid A (10 µg per mouse) and NTS together. In both wild-type and TLR2-deficient animals, equivalent disease was produced using this method, as quantified by glomerular neutrophil influx at 2 h (Fig. 1B). At 24 h after injection of Pam3CysSK4 and NTS, the renal neutrophil influx had virtually completely resolved, and there was no significant difference between TLR2-deficient and wild-type groups at this point (Fig. 1C). Segmental glomerular thrombosis was seen at 24 h only in wild-type mice (Fig. 1E, with representative histology in D). The 24-h albuminuria was measured after disease induction in wild-type and TLR2-deficient animals. Only wild-type animals produced significant albuminuria, with TLR2-deficient animals being protected against disease (Fig. 1F). These data show that both Ab deposition and Pam3CysSK4 are essential for the neutrophil influx in this model, with a strong synergistic effect through a mechanism that is entirely dependent on TLR2. Tissue damage, indicated by albuminuria following administration of NTS and Pam3CysSK4, also requires TLR2 stimulation in addition to Ab deposition.


Figure 1
View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 1. A, Glomerular neutrophil influx in wild-type and TLR2-deficient mice at 2 h following i.v. Pam3CysSK4 (10 µg) and NTS given alone or together. p < 0.0001 for wild-type mice given Pam3CysSK4 and NTS, vs any other group shown. B, Glomerular neutrophil influx at 2 h in wild-type and TLR2-deficient animals following i.v. lipid A (10 µg/mouse) and NTS. There was no statistically significant difference between these two groups. C, Glomerular neutrophil influx at 24 h in wild-type and TLR2-deficient mice following NTS and Pam3CysSK4. D, Representative glomerular histology at 2 and 24 h following the i.v. injection of NTS and Pam3CysSK4 in a wild-type (lower panels) and TLR2-deficient mice (upper panels). At 2 h, there is a significant glomerular neutrophil influx in the wild-type group (neutrophils indicated by arrows), which is not seen in the TLR2-deficient group. At 24 h, there is segmental thrombosis in the wild-type group but very little glomerular thrombosis in the TLR2-deficient group. E, Glomerular thrombosis scores in wild-type and TLR2-deficient mice at 24 h following the i.v. injection of Pam3CysSK4 and NTS. There is a significantly greater glomerular thrombosis in the wild-type group (p < 0.0001). F, Twenty-four-hour albuminuria in wild-type and TLR2-deficient animals following Pam3CysSK4 and NTS given together. There was a significant difference between the two groups (p = 0.0005).

 
Differences in disease severity between wild-type and TLR2-deficient animals cannot be explained by differences in circulating numbers of neutrophils or glomerular IgG

To investigate whether the observed differences in glomerular neutrophil influx were related to changes in circulating numbers, peripheral blood neutrophil counts were taken at both baseline and 2 h after disease induction when the mice were killed. There was no significant difference in neutrophil numbers at baseline between wild-type and TLR2-deficient animals. The TLR2-deficient group had more circulating neutrophils than wild-type mice at 2 h after disease induction. In addition, there was a reduction in the circulating numbers of neutrophils in the wild-type group at 2 h compared with baseline. These data are shown in Fig. 2A. To explore whether the decreased neutrophil influx in TLR2-deficient mice was related to a decrease in glomerular Ab binding, the amount of sheep IgG deposited within the glomerulus was quantified. This was performed on kidney sections taken at 2 h following disease induction with NTS and Pam3CysSK4 in wild-type and TLR2-deficient animals. There was no difference between the two groups, as shown in Fig. 2B. These data established that TLR2-deficient mice had a diminished glomerular neutrophil influx, despite having a larger number of circulating peripheral blood neutrophils and a similar amount of IgG in their glomeruli at 2 h.


Figure 2
View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 2. A, Peripheral neutrophil counts at baseline and 2 h following i.v. Pam3CysSK4 and NTS in wild-type and TLR2-deficient animals. p = 0.0286 for the TLR2-deficient animals compared with the wild-type animals at 2 h. p = 0.0003 for the wild-type at 2 h compared with the wild-type animals at baseline. B, Immunofluoresence for glomerular deposition of sheep IgG at 2 h following NTS and Pam3CysSK4 in a wild-type animal (left), and a TLR2-deficient animal (right). The number given is the mean fluorescence ± SEM for each group of four animals.

 
TLR2 on both bone marrow-derived and non-bone marrow-derived cells contribute to glomerular neutrophil influx

To investigate the relative contribution of TLR2 on leukocytes and non-bone marrow-derived cells to the neutrophil influx, bone marrow chimeras were constructed. We made mice with TLR2 present on leukocytes but absent on non-bone marrow-derived cells, and mice with TLR2 present on non-bone marrow cells, but absent on leukocytes (wild-type bone marrow into TLR2-deficient host, WT/TLR2–/–; and TLR2-deficient marrow into wild-type host, TLR2–/–/WT). Additionally, two sham chimeric groups were produced with TLR2 present on all cells (WT/WT) or with a complete absence of TLR2 (TLR2–/–/TLR2–/–). These sham chimeras were made using identical methods to those used for the chimeric mice. Real-time PCR analysis of genomic DNA extracted from whole blood of WT/TLR2–/– mice showed that 4.6 ± 0.01% was derived from the TLR2-deficient strain (n = 7, mean ± SEM). At 8 wk following reconstitution, the chimeric and sham chimeric groups were given NTS and Pam3CysSK4 (10 µg per mouse). A significant glomerular neutrophil influx at 2 h was seen in the WT/WT group compared with the TLR2–/–/TLR2–/– group, consistent with the results we had previously seen in nonchimeric mice as shown in Fig. 1. Additionally, animals from both chimeric groups (WT/TLR2–/– and TLR2–/–/WT) developed significant glomerular neutrophil influx when compared with the sham chimeric TLR2–/–/TLR2–/– group. Data are shown in Fig. 3A.


Figure 3
View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 3. A, Glomerular neutrophil influx at 2 h following i.v. Pam3CysSK4 and NTS in chimeric animals. Both groups of chimeras had a significantly greater neutrophil influx to the glomerulus when compared with the sham chimeras totally deficient in TLR2. For those that are bone marrow-derived cell positive and non-bone marrow-derived cell negative (WT/TLR2–/–), p = 0.0017, and for those bone marrow-derived cell negative and non-bone marrow-derived cell positive (TLR2–/–/WT), p = 0.0012, vs those totally deficient for TLR2. B, Albuminuria in 24 h following i.v. Pam3CysSK4 and NTS in chimeric animals. Both groups of chimeras had a significantly greater albuminuria when compared with the sham-negative chimeras. For the WT/TLR2–/– chimeras, p = 0.0002, and for the TLR2–/–/WT, p = 0.0093, vs those totally deficient for TLR2. There is significantly greater albuminuria in the WT/TLR2–/– group when compared with the TLR2–/–/WT group (p = 0.0003).

 
TLR2 on both bone marrow-derived and non-bone marrow-derived cells contribute toward albuminuria

Similarly to the experiments outlined above, chimeric and sham chimeric mice were constructed to assess the relative importance of TLR2 on bone marrow-derived and non-bone marrow-derived cells toward the production of albuminuria. At 10 wk following reconstitution, the chimeric and sham chimeric animals were given NTS and Pam3CysSK4 (10 µg per mouse). Significant albuminuria developed in the WT/WT group compared with the TLR2–/–/TLR2–/– group. Animals from both chimeric groups (WT/TLR2–/– and TLR2–/–/WT) developed significant albuminuria when compared with the sham TLR2–/–/TLR2–/–group. When the two chimeric groups were compared, the WT/TLR2–/– chimeras developed significantly more albuminuria than the TLR2–/–/WT group. This suggests that both non-bone marrow- and bone marrow-derived cell TLR2 contribute toward albuminuria, although TLR2 on bone marrow-derived cells make the more significant contribution. Data are shown in Fig. 3B.

Mesangial cells express TLR2 and MyD88 and produce CXC chemokines in response to Pam3CysSK4

It was possible that the mesangial cell response to TLR2 agonists could explain the role of TLR2 on intrinsic renal cells in mediating a glomerular neutrophil influx. Therefore, we studied primary cultures of mouse mesangial cells to assess their expression of TLR2 and their response to stimulation with Pam3CysSK4. First, we examined the expression of TLR2 and MyD88 on mesangial cells by RT-PCR. Fig. 4, A and B, shows that mRNA for both of these molecules was expressed by mesangial cells. We stimulated mesangial cells with Pam3CysSK4 or vehicle, and measured chemokines important for neutrophil chemotaxis. These were CXCL1 and CXCL2. We established a dose response for CXCL1 as shown in Fig. 4C. This clearly showed that mesangial cells were able to respond to Pam3CysSK4 to produce CXCL1. Based on this experiment, a dose of Pam3CysSK4 of 10 ng/ml was used in subsequent studies. We measured protein for both CXCL1 and CXCL2 by ELISA and mRNA by real-time PCR. To show that the response was mediated by TLR2, the response of wild-type and TLR2-deficient mesangial cells was compared. Fig. 5A shows that wild-type, but not TLR2-deficient mesangial cells, produced CXCL1 mRNA and protein in response to Pam3CysSK4. Fig. 5B shows that wild-type, but not TLR2-deficient mesangial, cells, produced CXCL2 mRNA and protein in response to Pam3CysSK4. To establish that there was no intrinsic inability of TLR2-deficient mesangial cells to produce CXCL1 and CXCL2, these cells were also stimulated with endotoxin (1 µg/ml) and mounted a good response. These data showed that mesangial cells produced CXCL1 and CXCL2 mRNA and protein in response to Pam3CysSK4, and that this effect was entirely mediated by TLR2.


Figure 4
View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 4. A, RT-PCR for TLR2 on mRNA extracted from mesangial cells using actin as a reference gene. Mesangial cell RNA and macrophage cDNA are included as negative and positive controls. B, RT-PCR for MyD88 on mRNA extracted from mesangial cells using GAPDH as a reference gene. C, Dose-response curve showing the concentration of CXCL1 in supernatant taken from mesangial cells stimulated with increasing concentrations of Pam3CysSK4.

 

Figure 5
View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 5. A, CXCL1 concentration measured by ELISA in supernatant of wild-type and TLR2-deficient mesangial cells stimulated with Pam3CysSK4 or LPS (left). Relative amount of mRNA for CXCL1 measured by real-time PCR on wild-type and TLR2-deficient mesangial cells, following stimulation with lipopeptide or LPS (right). B, CXCL2 concentration measured by ELISA in supernatant of wild-type and TLR2-deficient mesangial cells stimulated with Pam3CysSK4 or LPS (left). Relative amount of mRNA for CXCL2 measured by real-time PCR on wild-type and TLR2-deficient mesangial cells following stimulation with lipopeptide or LPS (right).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
We have shown that lipopeptide can exacerbate glomerulonephritis through a mechanism that depends on TLR2. Previous studies using this model of glomerulonephritis have focused on the role of endotoxin, containing predominantly TLR4 agonistic activity (10, 11). It is probably more relevant to explore the role of TLR2 agonists, because the strongest evidence for glomerulonephritis being exacerbated by infection comes from the observation that nasal S. aureus carriage is a risk factor for exacerbations of renal vasculitis (3). In addition, bacterial pathogens from the respiratory tract that may play a role in the exacerbation of IgA nephropathy are likely to act on TLR2. Our data are the first demonstration that both glomerular inflammation and proteinuria can be exacerbated through ligands for TLR2. We have shown that disease does not occur unless TLR2 is stimulated in addition to Ab deposition.

We have excluded two possible explanations for this finding. It was possible that the decreased inflammation in TLR2-deficient mice was the result of their binding less sheep IgG in their glomeruli. However, quantitative immunofluorescence demonstrated that this was not the case. Another possible explanation was that the decreased numbers of neutrophils in their glomeruli, compared with wild types, was a reflection of lower circulating neutrophil numbers. However, 2 h after disease induction, TLR-deficient mice had higher circulating neutrophils numbers than wild types. The observed rise in circulating neutrophils in response to Pam3CysSK4 and NTS in TLR2-deficient mice is probably due to a factor in the serum, because it was not seen with Pam3CysSK4 alone (data not shown). The observed fall in circulating neutrophils in response to Pam3CysSK4 and NTS in wild-type mice was likely to be a result of neutrophil sequestration in the kidney and other organs. Therefore, despite having more circulating neutrophils than wild types at 2 h, and the same amount of nephrotoxic Ab in their glomeruli, TLR2-deficient mice had less disease. This means that there was a defect in recruitment of circulating neutrophils to the glomerulus.

We then demonstrated, using bone marrow chimeras, that disease can be exacerbated with lipopeptide, if TLR2 is present on bone marrow-derived cells or on non-bone marrow-derived cells. Neutrophil influx was more variable in the chimeras, when compared with the previous experiments shown in Fig. 1. This may have been due to an effect of the irradiation or other factors in the generation of chimeric mice. Nonetheless, these experiments clearly established that TLR2 present on both leukocytes and non-bone marrow-derived cells, was capable of contributing to the glomerular neutrophil influx. Resident tissue macrophages are resistant to radiation, and therefore it may be suggested that TLR2 stimulation on theses cells may contribute toward the neutrophil influx and albuminuria seen in the TLR2–/–/WT chimeric group. However, the number of resident renal macrophages in mice is small, and they are largely confined to the interstitial compartment and are therefore unlikely to contribute significantly toward disease. Although there was no significant difference in neutrophil influx between the two chimeric groups, there was a difference in albuminuria. Mice with TLR present only on intrinsic renal cells had less albuminuria than those with TLR2 present only on neutrophils. This demonstrated that ligation of neutrophil TLR2 was required for the full expression of disease and tissue damage. The differences in albuminuria between these two chimeric groups occurred despite similar numbers of glomerular neutrophils. This could be related to greater activation of the recruited neutrophils expressing TLR2 and therefore an increase in their ability to promote tissue damage. Nonetheless, mice with TLR2 on intrinsic renal cells did develop significant albuminuria when compared with the totally TLR2-deficient sham chimeric group, showing that renal cell TLR2 does play a role in the development of albuminuria.

The effects of TLR agonists on neutrophils are well described. Human neutrophils express all TLRs except TLR3 (16). Described effects of activation by TLR agonists include L selectin shedding, CD11b up-regulation, chemokine and cytokine release, superoxide generation, and modulation of chemokine receptor expression (16, 17, 18). These observations in human neutrophils have been mirrored to some extent in the mouse. For example, endotoxin causes L selectin shedding and CD11b up-regulation (19). Because this previous work has offered many possible mechanisms by which TLR2 on neutrophils could augment disease, we have not explored these aspects further in this study. Instead, we have focused on the potential role of TLR2 on nonleukocytes in causing disease exacerbation.

We found that stimulation of TLR2 on nonleukocytes is sufficient for lipopeptide to initiate disease when Ab deposition has occurred. A previous study has shown TLR2 and TLR4 expression in mouse kidney, but this was predominantly in the tubules with sparse glomerular expression (20). Despite this low level of glomerular expression, we have demonstrated an important inflammatory function of TLR2 expressed on glomerular cells. We confirmed that primary cultures of mesangial cells also express TLR2, with the signaling adaptor MyD88. There are no previous data on TLR2 expression in primary cultures of mesangial cells, but a study in a mesangial cell line also showed expression of TLR2 and TLR4 (21). The mesangial cell is an immunologically active cell, known to produce a number of chemokines and cytokines (22, 23, 24, 25, 26, 27, 28). In some of these studies, primary cultures of mesangial cells were stimulated by cytokines. However, in others, a role for TLRs was shown (albeit before the discovery of TLRs) by stimulating with endotoxin. For example, endotoxin was shown to cause RANTES release (28), MCP-1 release (27), and IL-10 release (25). It is probable that these earlier studies used crude endotoxin that is now known to contain ligands for other TLRs such as TLR2 (12). More recently, TLR3 was shown to be present on mesangial cells, and a TLR3 ligand caused secretion of proinflammatory CCL2 and IL-6 (29). In mice, the major chemokines responsible for neutrophil infiltration are CXCL1 (30) and CXCL2 (31). We have found that mesangial cells produce both of these chemokines in response to lipopeptide acting through TLR2. This therefore provides a biologically plausible mechanism whereby TLR2 agonists, acting on mesangial cells, could exacerbate disease. We are not suggesting that these are the only factors produced by mesangial cells via stimulation of TLR2 that may be important. Other factors secreted by mesangial cells may activate neutrophils or endothelium. Further work using gene-targeted mice, or blocking studies, will be needed to establish which aspects of the mesangial cell response to lipopeptide are the most important in exacerbating disease. In addition to TLR2 expression on mesangial cells, TLR2 on glomerular epithelial or endothelial cells could potentially contribute to disease. Although we chose to examine the mesangial cell response to TLR2 in detail, it remains possible that TLR2 on endothelium or epithelium could play an additional role.

Previous studies in lung and bladder have shown a role for nonleukocyte TLR4 in inflammation mediated solely by microbial products (19, 32). Our study differs from these because we show a role for TLR2 stimulation of resident renal cells in the expression of Ab-mediated inflammation and tissue damage. This provides a novel insight into the convergence of infection and immunity. Renal autoimmune disease is frequently worsened by respiratory infection, in the absence of any measurable effect on the serum levels of pathogenic autoantibodies, such as anti-GBM or ANCA (2), and we provide a molecular explanation for this clinical observation. Our data do not suggest that specific targeting of mesangial cell TLR2 would be a useful therapeutic strategy for preventing exacerbations of glomerulonephritis. Neutrophil TLR2 alone is sufficient for disease exacerbation, and systemic TLR2 blockade would be necessary to prevent this.


    Acknowledgments
 
We are grateful to S. Akira for supplying TLR2-deficient mice and to J. Mitchell who helped us to obtain them, to Ono Pharmaceutical for supplying ONO-4007, and to A. Hayday for critical review of the manuscript.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by a Wellcome Trust clinical training fellowship (to H.J.B.) and a Wellcome Trust advanced fellowship (to M.G.R.). Back

2 Address correspondence and reprint requests to Heather J. Brown, Department of Nephrology and Transplantation, 5th Floor Thomas Guy House, Guy’s Hospital, St. Thomas Street, London SE1 9RT, U.K. E-mail address: heather.brown{at}kcl.ac.uk Back

3 Abbreviation used in this paper: NTS, nephrotoxic serum. Back

Received for publication October 11, 2005. Accepted for publication May 16, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Frimat, L., S. Briançon, D. Hestin, B. Aymard, E. Renoult, T. C. Huu, M. Kessler. 1997. IgA nephropathy: prognostic classification of end-stage renal failure. Nephrol. Dial. Transplant. 12: 2569-2575. [Abstract/Free Full Text]
  2. Rees, A. J., C. M. Lockwood, D. K. Peters. 1977. Enhanced allergic tissue injury in Goodpasture’s syndrome by intercurrent bacterial infection. Br. Med. J. 2: 723-726. [Abstract/Free Full Text]
  3. Stegeman, C. A., J. W. Tervaert, W. J. Sluiter, W. L. Manson, P. E. de Jong, C. G. Kallenberg. 1994. Association of chronic nasal carriage of Staphylococcus aureus and higher relapse rates in Wegener granulomatosis. Ann. Intern. Med. 120: 12-17. [Abstract/Free Full Text]
  4. Stegeman, C. A., J. W. Tervaert, P. E. de Jong, C. G. Kallenberg. 1996. Trimethoprim-sulfamethoxazole (co-trimoxazole) for the prevention of relapses of Wegener’s granulomatosis: Dutch Co-Trimoxazole Wegener Study Group. N. Engl. J. Med. 335: 16-20. [Abstract/Free Full Text]
  5. Takeda, K., T. Kaisho, S. Akira. 2003. Toll-like receptors. Annu. Rev. Immunol. 9: 9[Medline]
  6. Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. Van Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, et al 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282: 2085-2088. [Abstract/Free Full Text]
  7. Zarember, K. A., P. J. Godowski. 2002. Tissue expression of human Toll-like receptors and differential regulation of Toll-like receptor mRNAs in leukocytes in response to microbes, their products, and cytokines. J. Immunol. 168: 554-561. [Abstract/Free Full Text]
  8. Cochrane, C. G., E. R. Unanue, F. J. Dixon. 1965. A role of polymorphonuclear leukocytes and complement in nephrotoxic nephritis. J. Exp. Med. 122: 99-119. [Abstract]
  9. Hammer, D. K., F. J. Dixon. 1963. Experimental glomerulonephritis. III. Immunologic events in the pathogenesis of nephrotoxic seum nephritis in the rat. J. Exp. Med. 117: 1019-1034. [Abstract]
  10. Robson, M. G., H. T. Cook, C. D. Pusey, M. J. Walport, K. A. Davies. 2003. Antibody-mediated glomerulonephritis in mice: the role of endotoxin, complement and genetic background. Clin. Exp. Immunol. 133: 326-333. [Medline]
  11. Karkar, A. M., A. J. Rees. 1997. Influence of endotoxin contamination on anti-GBM antibody induced glomerular injury in rats. Kidney Int. 52: 1579-1583. [Medline]
  12. Hirschfeld, M., Y. Ma, J. H. Weis, S. N. Vogel, J. J. Weis. 2000. Cutting edge: repurification of lipopolysaccharide eliminates signaling through both human and murine Toll-like receptor 2. J. Immunol. 165: 618-622. [Abstract/Free Full Text]
  13. Robson, M. G., H. T. Cook, M. Botto, P. R. Taylor, N. Busso, R. Salvi, M. J. Walport, K. A. Davies. 2001. Accelerated nephrotoxic nephritis is exacerbated in C1q-deficient mice. J. Immunol. 166: 620-628.
  14. Takeuchi, O., K. Hoshino, T. Kawai, H. Sanjo, H. Takada, T. Ogawa, K. Takeda, S. Akira. 1999. Differential roles of TLR2 and TLR4 in recognition of gram-negative and gram-positive bacterial cell wall components. Immunity 11: 443-451. [Medline]
  15. Pfaffl, M. W.. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29: e45[Abstract/Free Full Text]
  16. Hayashi, F., T. K. Means, A. D. Luster. 2003. Toll-like receptors stimulate human neutrophil function. Blood 102: 2660-264. [Abstract/Free Full Text]
  17. Fan, J., A. B. Malik. 2003. Toll-like receptor-4 (TLR4) signaling augments chemokine-induced neutrophil migration by modulating cell surface expression of chemokine receptors. Nat. Med. 9: 315-321. [Medline]
  18. Sabroe, I., L. R. Prince, E. C. Jones, M. J. Horsburgh, S. J. Foster, S. N. Vogel, S. K. Dower, M. K. Whyte. 2003. Selective roles for Toll-like receptor (TLR)2 and TLR4 in the regulation of neutrophil activation and life span. J. Immunol. 170: 5268-5275. [Abstract/Free Full Text]
  19. Andonegui, G., C. S. Bonder, F. Green, S. C. Mullaly, L. Zbytnuik, E. Raharjo, P. Kubes. 2003. Endothelium-derived Toll-like receptor-4 is the key molecule in LPS-induced neutrophil sequestration into lungs. J. Clin. Invest. 111: 1011-1020. [Medline]
  20. Wolfs, T. G., W. A. Buurman, A. van Schadewijk, B. de Vries, M. A. Daemen, P. S. Hiemstra, C. van ’t Veer. 2002. In vivo expression of Toll-like receptor 2 and 4 by renal epithelial cells: IFN-{gamma} and TNF-{alpha} mediated up-regulation during inflammation. J. Immunol. 168: 1286-1293. [Abstract/Free Full Text]
  21. Tsuboi, N., Y. Yoshikai, S. Matsuo, T. Kikuchi, K. Iwami, Y. Nagai, O. Takeuchi, S. Akira, T. Matsuguchi. 2002. Roles of Toll-like receptors in C-C chemokine production by renal tubular epithelial cells. J. Immunol. 169: 2026-2033. [Abstract/Free Full Text]
  22. Brown, Z., R. M. Strieter, S. W. Chensue, M. Ceska, I. Lindley, G. H. Neild, S. L. Kunkel, J. Westwick. 1991. Cytokine-activated human mesangial cells generate the neutrophil chemoattractant, interleukin 8. Kidney Int. 40: 86-90. [Medline]
  23. Bussolati, B., F. Mariano, L. Biancone, R. Foa, S. David, V. Cambi, G. Camussi. 1999. Interleukin-12 is synthesized by mesangial cells and stimulates platelet-activating factor synthesis, cytoskeletal reorganization, and cell shape change. Am. J. Pathol. 154: 623-632. [Abstract/Free Full Text]
  24. Adler, S., P. J. Baker, R. J. Johnson, R. F. Ochi, P. Pritzl, W. G. Couser. 1986. Complement membrane attack complex stimulates production of reactive oxygen metabolites by cultured rat mesangial cells. J. Clin. Invest. 77: 762-767. [Medline]
  25. Fouqueray, B., V. Boutard, C. Philippe, A. Kornreich, A. Marchant, J. Perez, M. Goldman, L. Baud. 1995. Mesangial cell-derived interleukin-10 modulates mesangial cell response to lipopolysaccharide. Am. J. Pathol. 147: 176-182. [Abstract]
  26. Feng, L., Y. Xia, J. I. Kreisberg, C. B. Wilson. 1994. Interleukin-1{alpha} stimulates KC synthesis in rat mesangial cells: glucocorticoids inhibit KC induction by IL-1. Am. J. Physiol. 266: F713-F722. [Medline]
  27. Grande, J. P., M. L. Jones, C. L. Swenson, P. D. Killen, J. S. Warren. 1994. Lipopolysaccharide induces monocyte chemoattractant protein production by rat mesangial cells. J. Lab. Clin. Med. 124: 112-117. [Medline]
  28. Wolf, G., S. Aberle, F. Thaiss, P. J. Nelson, A. M. Krensky, E. G. Neilson, R. A. Stahl. 1993. TNF{alpha} induces expression of the chemoattractant cytokine RANTES in cultured mouse mesangial cells. Kidney Int. 44: 795-804. [Medline]
  29. Patole, P. S., H. J. Grone, S. Segerer, R. Ciubar, E. Belemezova, A. Henger, M. Kretzler, D. Schlondorff, H. J. Anders. 2005. Viral double-stranded RNA aggravates lupus nephritis through Toll-like receptor 3 on glomerular mesangial cells and antigen-presenting cells. J. Am. Soc. Nephrol. 16: 1326-1338. [Abstract/Free Full Text]
  30. Oquendo, P., J. Alberta, D. Z. Wen, J. L. Graycar, R. Derynck, C. D. Stiles. 1989. The platelet-derived growth factor-inducible KC gene encodes a secretory protein related to platelet {alpha}-granule proteins. J. Biol. Chem. 264: 4133-4137. [Abstract/Free Full Text]
  31. Tekamp-Olson, P., C. Gallegos, D. Bauer, J. McClain, B. Sherry, M. Fabre, S. van Deventer, A. Cerami. 1990. Cloning and characterization of cDNAs for murine macrophage inflammatory protein 2 and its human homologues. J. Exp. Med. 172: 911-919. [Abstract/Free Full Text]
  32. Schilling, J. D., S. M. Martin, C. S. Hung, R. G. Lorenz, S. J. Hultgren. 2003. Toll-like receptor 4 on stromal and hematopoietic cells mediates innate resistance to uropathogenic Escherichia coli. Proc. Natl. Acad. Sci. USA 100: 4203-4208. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Wu, C. Mei, H. Vlassara, G. E. Striker, and F. Zheng
Oxidative stress-induced JNK activation contributes to proinflammatory phenotype of aging diabetic mesangial cells
Am J Physiol Renal Physiol, December 1, 2009; 297(6): F1622 - F1631.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Lichtnekert, V. Vielhauer, D. Zecher, O. P. Kulkarni, S. Clauss, S. Segerer, V. Hornung, T. N. Mayadas, B. Beutler, S. Akira, et al.
Trif is not required for immune complex glomerulonephritis: dying cells activate mesangial cells via Tlr2/Myd88 rather than Tlr3/Trif
Am J Physiol Renal Physiol, April 1, 2009; 296(4): F867 - F874.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Giorgini, H. J. Brown, H. R. Lock, F. Nimmerjahn, J. V. Ravetch, J. S. Verbeek, S. H. Sacks, and M. G. Robson
Fc{gamma}RIII and Fc{gamma}RIV Are Indispensable for Acute Glomerular Inflammation Induced by Switch Variant Monoclonal Antibodies
J. Immunol., December 15, 2008; 181(12): 8745 - 8752.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
A. C. Shirali and D. R. Goldstein
Tracking the Toll of Kidney Disease
J. Am. Soc. Nephrol., August 1, 2008; 19(8): 1444 - 1450.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
H. J. Brown, H. R. Lock, T. G.A.M. Wolfs, W. A. Buurman, S. H. Sacks, and M. G. Robson
Toll-Like Receptor 4 Ligation on Intrinsic Renal Cells Contributes to the Induction of Antibody-Mediated Glomerulonephritis via CXCL1 and CXCL2
J. Am. Soc. Nephrol., June 1, 2007; 18(6): 1732 - 1739.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. A. Shigeoka, T. D. Holscher, A. J. King, F. W. Hall, W. B. Kiosses, P. S. Tobias, N. Mackman, and D. B. McKay
TLR2 Is Constitutively Expressed within the Kidney and Participates in Ischemic Renal Injury through Both MyD88-Dependent and -Independent Pathways
J. Immunol., May 15, 2007; 178(10): 6252 - 6258.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brown, H. J.
Right arrow Articles by Robson, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brown, H. J.
Right arrow Articles by Robson, M. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS