The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wakabayashi, Y.
Right arrow Articles by Miyake, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wakabayashi, Y.
Right arrow Articles by Miyake, K.
The Journal of Immunology, 2006, 177: 1772-1779.
Copyright © 2006 by The American Association of Immunologists

A Protein Associated with Toll-Like Receptor 4 (PRAT4A) Regulates Cell Surface Expression of TLR41

Yasutaka Wakabayashi*,2, Makiko Kobayashi*,2, Sachiko Akashi-Takamura*, Natsuko Tanimura*, Kazunori Konno*, Koichiro Takahashi*, Takashi Ishii*, Taketoshi Mizutani{dagger}, Hideo Iba{dagger}, Taku Kouro{ddagger}, Satoshi Takaki{ddagger}, Kiyoshi Takatsu{ddagger}, Yoshiya Oda§, Yasushi Ishihama§, Shin-ichiroh Saitoh* and Kensuke Miyake*,3

* Division of Infectious Genetics, {dagger} Division of Host-Parasite Interaction, and {ddagger} Division of Immunology, Institute of Medical Science, University of Tokyo, Tokyo, Japan; § Laboratory of Seeds Finding Technology, Eisai Co. Ltd., Tsukuba, Japan; and Core Research for Engineering, Science, and Technology, Japan Science and Technology Corporation, Tokyo, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
TLRs recognize microbial products. Their subcellular distribution is optimized for microbial recognition. Little is known, however, about mechanisms regulating the subcellular distribution of TLRs. LPS is recognized by the receptor complex consisting of TLR4 and MD-2. Although MD-2, a coreceptor for TLR4, enhances cell surface expression of TLR4, an additional mechanism regulating TLR4 distribution has been suggested. We show here that PRAT4A, a novel protein associated with TLR4, regulates cell surface expression of TLR4. PRAT4A is associated with the immature form of TLR4 but not with MD-2 or TLR2. PRAT4A knockdown abolished LPS responsiveness in a cell line expressing TLR4/MD-2, probably due to the lack of cell surface TLR4. PRAT4A knockdown down-regulated cell surface TLR4/MD-2 on dendritic cells. These results demonstrate a novel mechanism regulating TLR4/MD-2 expression on the cell surface.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Innate immunity is the first line of defense against microbial infection (1). The Toll family of receptors plays an essential role in innate recognition of microbial products (2). TLRs are type I transmembrane proteins that contain a large, leucine-rich repeat in an extracellular region and a Toll/IL-1 receptor homology domain in a cytoplasmic region (3). Cell surface TLRs, including TLR1, TLR2, TLR4, TLR5, and TLR6, recognize bacterial products, whereas TLR3, TLR7, TLR8, and TLR9 reside in intracellular organella and recognize microbial nucleic acids. These subcellular distributions of TLRs are optimized for microbial recognition. TLR5, e.g., is expressed exclusively on the basolateral surface of intestinal epithelia where pathogenic Salmonella, but not commensal Escherichia coli, translocate TLR5 ligand flagellin across epithelia (4). The subcellular distribution of TLR9 is important for sensing viral infection and differential recognition of two distinct types of TLR9 ligands (5, 6, 7, 8). A/D-type CpG is retained for long periods in the endosomal vesicles of plasmacytoid dendritic cells (DCs),4 together with the complex consisting of downstream signaling molecules (8), whereas the B/K-type CpG is recognized by TLR9 in the lysosome (9, 10).

LPS, one of the most immunostimulatory glycolipids constituting the outer membrane of the Gram-negative bacteria, is recognized by the receptor complex consisting of TLR4 and MD-2 (3, 11, 12, 13, 14). MD-2 is an extracellular molecule that is associated with the extracellular domain of TLR4 and is indispensable for LPS recognition by TLR4 (15, 16, 17, 18). TLR4/MD-2 is similar to TLR9 in that LPS can be recognized at the two distinct sites. TLR4/MD-2 is expressed on the cell surface, and LPS recognition occurs on the cell surface in macrophage cells (19, 20, 21). In intestinal epithelial cells, TLR4/MD-2 resides in the Golgi apparatus and recognizes internalized LPS (20). Little is known about differences between LPS recognition/signaling on the cell surface and that in the Golgi apparatus. Considering roles for TLR9 subcellular distribution in CpG recognition, it is possible that these LPS responses are distinct from each other with regard to specificity or cytokine production.

The subcellular distribution of TLR4 is reported to be regulated by two molecules, the endoplasmic reticulum (ER) chaperon gp96 and MD-2. Randow and Seed (22) described a pre-B cell line deficient in the gp96 in which TLR4 failed to associate with MD-2, get to the cell surface, and respond to LPS (22). We previously demonstrated that TLR4 alone is little expressed on the cell surface in MD-2–/– embryonic fibroblasts and that most TLR4s reside in ER or the Golgi apparatus without mature glycosylation, revealing an important role for MD-2 in cell surface expression of TLR4 (16). MD-2 association permits TLR4 glycosylation at Asn526 or Asn575, which facilitates cell surface expression of TLR4 (23). Despite an important role for MD-2 in cell surface expression of TLR4, several studies claimed that TLR4 alone may be expressed on the cell surface without MD-2 in a human kidney cell line (10, 24, 25), suggesting that another MD-2-like molecule regulates TLR4 trafficking to the cell surface. In this study we addressed this issue and described a novel molecule that is associated with TLR4 and regulates its expression on the cell surface.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Reagents, cells, and mice

Anti-Flag Ab and anti-Flag-agarose were purchased from Sigma-Aldrich. Rat anti-mouse TLR4 mAb (MTS510 and Sa15-21) and rat anti-mouse CD14 (Sa2-8) were established in our laboratory and described previously (19). Pre-made Northern blot for mouse normal tissues was purchased from Seegene. HEK293 cells were maintained in DMEM supplemented with 10% FCS and antibiotics. IL-3-dependent Ba/F3 cells were cultured in 10% FCS-RPMI 1640 supplemented with antibiotics, 100 µM 2-ME, and recombinant murine IL-3 (~70 U/ml) at 37°C in a humidified atmosphere of 5% CO2. A rat was immunized with the GST-PRAT4A (protein associated with TLR4A) fusion protein and used for hybridoma production. The anti PRAT4A mAb (542; rat IgG) can be used for immunoprobing.

C57BL/6 mice were purchased from Japan SLC. TLR4–/– mice were kindly provided by Dr. S. Akira (Osaka University, Osaka, Japan), and MD-2–/– mice were established in our own laboratory (16). These mice were maintained in the animal facility at the Institute of Medical Science, the University of Tokyo, Tokyo, Japan. Bone marrow-derived DCs and macrophages were prepared as described previously (16). Briefly, bone marrow cells were plated at 1 x 106 cells/ml in 24-well plates with 10% FCS-RPMI 1640 supplemented with 10 ng/ml recombinant murine GM-CSF (Genzyme/Techne) or 100 ng/ml recombinant murine macrophage CSF (M-CSF) (Genzyme/Techne). On day 7, cells were harvested and used for flow cytometry. For retroviral transduction, bone marrow cells during DC induction were transduced on days 1, 3, and 5 with retroviruses and 25 µl of N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate (DOTAP) transfection reagent (Roche) and centrifuged at 2000 rpm for 1 h at room temperature. After centrifugation, cells were cultured in 10% FCS-RPMI1640 supplemented with GM-CSF and cultured at 37°C in a humidified atmosphere of 5% CO2. On day 7, cells were harvested and used for flow cytometry. To detect DCs expressing short hairpin RNA (shRNA), we used a retroviral vector encoding GFP. In flow cytometry, the gate was set so that only DCs with GFP expression were analyzed (Fig. 7, A and B). To enrich DCs expressing shRNA, we used a retroviral vector with the puromycin resistance gene. Bone marrow was isolated from C57BL/B6 mice that had been injected i.p. 4 days earlier with 5 mg of 5-fluorouracil. After 48 h of culture, cells were transduced with retroviral supernatant on two successive days. After the second transduction, cells were washed and cultured in the presence of GM-CSF. During DC induction, puromycin (2µg/ml) was included to enrich DCs expressing shRNA (Fig. 7C).


Figure 7
View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 7. Cell surface TLR4/MD-2 is down-regulated by the knockdown of murine PRAT4A DCs from MD-2–/– (A) or wild-type mice (B) were transduced with a retroviral vector encoding the PRAT4A shRNA (bottom) or with an empty control vector (middle). Because a retroviral vector encodes GFP, transduced cells can be detected as GFP-positive cells. Cell surface expression of TLR4/MD-2 (left column), TLR4 (center column), or TLR2 (right column) on GFP-positive, transduced DCs was shown by staining with biotinylated MTS510, Sa15-21, or anti-TLR2 mAb, respectively, followed by streptavidin-PE. DCs without transduction (no treat; top row) were also stained as a control. KO, knockout. C, DCs were subjected to immunoprecipitation with the anti-TLR4 mAb Sa15-21 and immunoprobed with the anti-TLR4 Ab (top panel). A part of cell lysate was used for immunoprobing with an anti-actin Ab to show that the approximately equal amount of cell lysate was used (bottom panel). The cells used were DCs without any treatment (no treat; lane 1), DCs expressing an empty vector (lane 2), or DCs expressing the PRAT4A shRNA (lane 3).

 
Microsequencing of N-terminal amino acids

HEK293/mTLR4-GFP cells were collected up to ~5 x 109 cells. Cell lysate extraction and purification with the anti-GFP Abs were conducted as described in the paragraph title Immunoprecipitation and immunoprobing below in this section. Bound proteins were eluted and fractionated with the elution buffer containing 30 mM glycine/HCl (pH 2.5), 30 mM NaCl, and 0.1% Triton X-100. Each fraction was neutralized immediately with 1 M Tris-HCl (pH 8.0), and peak fractions were subjected to freeze drying, SDS-PAGE, electroblotting, and staining with Coomassie brilliant blue R-250 (Bio-Rad). The coprecipitated protein was excised, and its N-terminal amino acid sequence was determined by APRO Science.

Expression constructs and transfectants

Mouse PRAT4A cDNA was cloned into a retroviral vector, pMX-IRES-GFP. PRAT4A was tagged with the Flag epitope followed by the His6 epitope (collectively designated hereafter as the FH epitope) at the C terminus (PRAT4A-FH). PRAT4A-FH was expressed in Ba/F3 cells stably expressing TLR4/MD-2 and CD14. Retroviral vectors were transfected into the Plat-E cells using the FuGENE 6 transfection reagent (Roche). Retroviruses were transduced into Ba/F3 cells, and stable cells expressing mouse PRAT4A were established by enriching GFP-positive cells with a cell sorter. Human and mouse PRAT4A cDNAs were also cloned into the expression vector pEFBOS. We also established retroviral expression vector (pMX-puromycin) encoding TLR4, MD-2, and TLR2, all of which were either tagged with the FH epitope (TLR4FH, MD-2FH, and TLR4FH) or without epitope tags (see Fig. 3C).


Figure 3
View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 3. PRAT4A is associated with the immature form of TLR4. A, HEK293 cells (lanes 1 and 2), those expressing murine TLR4-GFP (mTLR4-GFP; lane 3 and 4), or those expressing murine TLR4-GFP/MD-2 (mTLR4-GFP mMD2; lanes 5 and 6) were transfected with an expression vector encoding human PRAT4A (hPRAT4A) with the FH epitope tag (hPRAT4A-FH) (lanes 2, 4, and 6). PRAT4A-FH (top two panels) and TLR4-GFP (bottom two panels) were precipitated and immunoprobed (IP) with an anti-Flag (for PRAT4A-FH) or anti-GFP (for TLR4-GFP) Ab as indicated. B, TLR4-FH/MD-2, TLR4FH, MD-2FH, or TLR2F were precipitated with anti-Flag mAb-coupled beads and probed with anti-His6 Abs followed by goat-anti-rat alkaline phosphatase (top panel). Coprecipitated endogenous PRAT4A was probed with a mAb to PRAT4A, followed by goat anti-rat alkaline phosphatase (bottom panel). C, TLR4/MD-2 (lane 1) and PRAT4A-FH (lane 3) were precipitated from Ba/F3 cells expressing TLR4, MD-2, CD14, and PRAT4A-FH. As a control, Ba/F3 cells expressing TLR4, MD-2, and CD14, but not PRAT4A-FH, were used in lane 2 as a control for precipitation with anti-Flag Abs. Precipitates were probed with the anti-TLR4 Ab (top panel), the anti-Flag mAb for PRAT4A-FH (middle panel), or anti-MD-2 Ab (bottom panel). WB, Western blotting.

 
Immunoprecipitation and immunoprobing

Cells were lysed on ice for 30 min with a lysis buffer containing 150 mM NaCl, 50 mM Tris-HCl (pH 7.6), 2 mM EDTA, 10 µg/ml aprotinin, 10 µg/ml leupeptin, 1 mM PMSF, and 1% Triton X-100. Lysates were separated from debris by centrifuging at 13,000 rpm at 4°C for 10 min and then incubated with Ab-conjugated beads at 4°C for 2 h. Beads were washed three times, and bound proteins were boiled at 99°C for 5 min in the sample buffer. Samples were subjected to SDS-PAGE and Western blotting. Reagents used for immunoprobing were anti-Flag (M2), anti-mouse PRAT4A mAb, anti-mouse TLR4 mAb, anti-His6 mAb, and anti-mouse MD-2 polyclonal Abs. The second Abs were goat anti-mouse IgG-alkaline phosphatase conjugate (American Qualex) and goat anti-rat IgG-alkaline phosphatase conjugate (American Qualex).

Small interfering RNA

To investigate the biological function of PRAT4A, we purchased an RNA interference duplex (Invitrogen Life Technologies). The oligonucleotide sequences of target sequences for human and mouse PRAT4A were ggaggaagaccugacugaauuccuc (sense strand sequence for human PRAT4A, no.9) and accugacugaauuccucugcgccaa (sense strand sequence for mouse PRAT4A, no.11). Sequence-scrambled negative controls for no.9 and no.11 were ggaagaaguccgucauuaacggcuc and accgucauuaacuccgcgucgucaa, respectively. HEK293 transfectants were seeded onto 24- or 6-well plates in antibiotic-free medium on the day before RNA interference transfection. LipofectAMINE 2000 (Invitrogen Life Technologies) was used as a transfection reagent. Cells were collected 3–4 days after transfection and used for further analyses.

To inhibit mouse PRAT4A expression, we produced a retroviral vector expressing shRNA (26). The target sequences was 5'-gag ttt gaa gag gtg att gag-3'.

RNA extract and Northern hybridization

Premade Northern blot for mouse normal tissues was purchased from Seegene. The RNA blot was hybridized with a 32P-labeled cDNA probe encoding mouse PRAT4A (from aa 1 to aa 166). The probe was labeled using a random primed labeling system (Rediprime II; Amersham Biosciences). Hybridization was conducted at 65°C for 17 h in a buffer containing 10% dextran sulfate, 1% SDS, 50 mM Tris-HCl (pH7.5), 1 M NaCl, and denatured salmon sperm DNA (100 µg/ml). Blots were washed three times in 2 x SSC/0.1% SDS at 65°C and three times in 0.2 x SSC/0.1% SDS for 10 min at 65°C before exposure to imaging plate (Fuji Film).

RT-PCR and semiquantitative PCR

Total pure RNA (1 µg) from Ba/F3 or HEK293 cells was reverse transcribed into cDNA using ReverTra Ace-{alpha} (Toyobo) according to the manufacturer’s instruction. cDNA was diluted at 1/1, 1/4, and 1/16, and each diluted cDNA was used as PCR template. RT-PCR was conducted with initial denaturation at 94°C for 3 min followed by 25 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 1 min. The primer pairs used were as follows: 5'-ggctcgagatggattcaatgcctgagcc-3' and 5'-ggggatcctcagagctcatcagggg-3' for human PRAT4A; 5'-tctactcaagccaggatgag-3' and 5'-ttcctgccaattgcatcctg-3' for human TLR4; and 5'-tatggacaggactgaacgtc-3' and 5'-cctacaacaaacttgtctgg-3' for human hypoxanthine phosphoribosyltrans-ferase (HPRT).

To determine the efficiency of gene silencing, semiquantitative PCR analyses were conducted using a 7300 fast real-time PCR System (Applied Biosystems) with TaqMan gene expression assays (Applied Biosystems) for mouse PRAT4A (Mm00511161). To normalize the amount of cDNAs, each sample was standardized by using internal TaqMan gene expression assays for mouse beta-actin (Mm00607939).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
HEK293 cells expressing mouse TLR4 alone

Because HEK293 cells do not express endogenous MD-2, HEK293 cells expressing TLR4 responded to LPS/MD-2 but not to LPS alone (25), suggesting that TLR4 was expressed on the cell surface and bound to the LPS/MD-2 complex. We established HEK293 cells stably expressing mouse TLR4 fused with GFP. Established HEK293 cells, in which TLR4 expression was confirmed by GFP expression, were stained with two distinct mAbs to TLR4, Sa15-21 and MTS510. Cell surface TLR4 was detected by Sa15-21, but very weakly with MTS510 (Fig. 1A, middle). When these cells were transiently transfected with an expression vector encoding mouse MD-2, cell surface TLR4 was apparently up-regulated, confirming a role for MD-2 in optimal expression of TLR4 on the cell surface (Fig. 1A, bottom). MTS510 was able to detect cell surface TLR4 only when MD-2 was coexpressed (Fig. 1A, bottom row).


Figure 1
View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 1. TLR4 alone is expressed on the cell surface. A, HEK293 cells were stained with two biotinylated mAbs to TLR4, MTS510, or Sa15-21, followed by streptavidin-PE. The stained cells were HEK293 cells (top row), HEK293 cells stably expressing mouse TLR4 (middle row), and HEK293 cells stably expressing mouse TLR4 and transiently expressing mouse MD-2 (bottom row). Open histograms depict staining with the second reagent alone. B and C, Bone marrow-derived DCs (B) and macrophages (C) were prepared from wild-type, TLR4–/–, and MD-2–/– mice as indicated. Cells were stained with biotinylated mAbs to CD14 or TLR4 (MTS510 and Sa15-21), followed by streptavidin-PE. Open histograms depict staining with the second reagent alone.

 
To study a role for MD-2 in cell surface expression of TLR4 on normal immune cells, we examined bone marrow-derived macrophages and DCs prepared from wild-type, TLR4–/–, and MD-2–/– mice. As published previously (16), MTS510 only bound to wild-type cells but not to TLR4–/– or MD-2–/– cells. In contrast, Sa15-21 was able to detect TLR4 on DCs or macrophages from MD-2–/– mice (Fig. 1, B and C). Although a role for MD-2 in augmenting cell surface expression of TLR4 was confirmed, MD-2 was found to be dispensable for cell surface expression of TLR4 at least in certain types of cells such as HEK293 cells, bone marrow-derived DC, or macrophages.

We have previously demonstrated with Ba/F3 cells that the above two mAbs to TLR4, MTS510 and Sa15-21, reacted with TLR4/MD-2 but poorly with TLR4 alone as judged by immunoprecipitation (19, 27). Sa15-21 was not able to detect cell surface TLR4 alone on Ba/F3 cells by flow cytometry. Because Sa15-21 was found to react with TLR4 on HEK293 cells, MD-2-deficient macrophages, or DCs, Sa15-21 but not MTX510 was able to bind to TLR4 without MD-2. TLR4 without MD-2 expressed in Ba/F3 cells might be distinct in conformation from TLR4 on HEK293 cells, macrophages, or DCs.

Molecular cloning of a molecule interacting with TLR4

We hypothesized that cell surface expression of TLR4 is regulated not only by MD-2 but also by another unknown molecule. With an aim to identifying such a molecule, we sought for a molecule coprecipitated with TLR4-GFP in HEK293 cells. An ~40 kDa signal was consistently coprecipitated with TLR4/MD-2, and we therefore determined its N-terminal amino acid sequence. The determined amino acid sequence (EENDWVRLPS) was completely matched with aa 38–47 of a gene containing CAG trinucleotide repeats (28). A similar 40-kDa molecule was also found to be coprecipitated with TLR4 in Ba/F3 cells, and its N-terminal amino acid sequence was determined. The N-terminal amino acid sequence was precisely the same portion of the mouse homologue (Fig. 2A) that was previously described as a retinoic acid-induced gene (29). We hereafter describe this molecule as PRAT4A, a protein associated with TLR4A. Data base analyses identified a molecule similar to PRAT4A. We named it PRAT4B, which was described elsewhere (30). The experimentally determined N-terminal amino acid sequence of PRAT4A clearly identified the first 37 amino acids as a signal sequence (Fig. 2A, boxed area). The mature peptide has a canonical N-glycosylation site and six cysteine residues. PRAT4A is highly conserved among a variety of species, including cow, chick, pig, catfish, sea squirt, nematode, zebra fish, and fruit fly (29). We examined tissue distribution of mRNA for mouse PRAT4A. Abundant expression of PRAT4A mRNA was detected in all of the organs tested, including lymphoid organs such as spleen and thymus (Fig. 2B).


Figure 2
View larger version (62K):
[in this window]
[in a new window]
 
FIGURE 2. The amino acid sequences of PRAT4A and its tissue distribution. A, The amino acid sequences of mouse and human PRAT4A were aligned. The signal sequence and the experimentally determined N-terminal sequence were boxed and underlined by a dashed line, respectively. Cysteine residues and an N-glycosylation site were marked by closed circles and an asterisk, respectively. B, Northern hybridization was conducted with a cDNA probe encoding mouse PRAT4A.

 
PRAT4A is associated with the hypoglycosylated form of TLR4

We first confirmed the physical association between TLR4 and PRAT4A. HEK293 cells expressing mouse TLR4-GFP or TLR4-GFP/MD-2 were transiently transfected with human PRAT4A tagged with the Flag epitope followed by the His6 epitope (PRAT4A-FH). TLR4-GFP and PRAT4A-FH were precipitated, and coprecipitated RPAT4-FH or TLR4-GFP was immunoprobed by the anti-Flag mAb or anti-GFP Ab, respectively (Fig. 3A). Mouse TLR4-GFP was coprecipitated with PRAT4A-FH (Fig. 3A, upper panel, lanes 4 and 6), and human PRAT4A-FH was coprecipitated with mouse TLR4-GFP (lower panel, lanes 4 and 6). The amount of PRAT4A coprecipitated with TLR4-GFP appeared to decrease when MD-2 was coexpressed (Fig. 3A, upper, lanes 4 and 6).

To confirm the physical association between TLR4 and PRAT4A with another cell line and to study the interaction between PRAT4A and other TLRs, Ba/F3 transfectants expressing TLR4-FH, TLR4-FH/MD-2, MD-2-FH, or TLR2-FH were used for immunoprecipitation studies. Coprecipitation of endogenously expressed PRAT4A was detected by a mAb to PRAT4A. PRAT4A was coprecipitated with TLR4-FH and TLR4-FH/MD-2, but not with MD-2-FH, TLR2-FH, or RP105/MD-1 (Fig. 3B, and data not shown), demonstrating specific association between TLR4 and PRAT4A. In contrast to the results with HEK293 cells, PRAT4A coprecipitated with TLR4 increased with MD-2 coexpression (Fig. 3B, lanes 2 and 3). The association of human PRAT4A with mouse TLR4 might be weaker than that of mouse PRAT4A and may be affected by MD-2 association. Next, epitope-tagged PRAT4A (PRAT4A-FH) was expressed in Ba/F3 cells expressing TLR4, MD-2, and CD14. PRAT4A-FH was precipitated by the anti-Flag mAb, and coprecipitated TLR4 and MD-2 were immunoprobed (Fig. 3C). Interestingly, the smaller species of TLR4 and MD-2 were coprecipitated with PRAT4A-FH (Fig. 3C, lane 3). Considering that PRAT4A-FH was not associated with MD-2 alone (Fig. 3B), PRAT4A-FH was likely to be associated with the hypoglycosylated form of TLR4 that was expressed either alone or as a complex with the hypoglycosylated form of MD-2. As published previously (19), coexpressed MD-2 facilitated TLR4 glycosylation as revealed by the larger form in SDS-PAGE (Fig. 3B, lane 2 compared with lane 3). The glycosylated mature form was preferentially precipitated by the MTS510 mAb (compare Fig. 3B, lane 2 with C, lane 1). Coprecipitation of PRAT4A-FH was hardly detected when the MTS510 mAb was used for immunoprecipitation of TLR4/MD-2 (Fig. 3C, middle, lane 1). The MTS510 mAb would bind to the mature TLR4/MD-2 complex from which PRAT4A has been already dissociated, or the mAb might disrupt the association between PRAT4A and TLR4/MD-2.

PRAT4A knockdown negatively regulates cell surface expression of TLR4

To address a role for PRAT4A in cell surface expression of TLR4, we used siRNA for inhibiting the expression of endogenous PRAT4A. The effect of siRNA was validated by detecting the transiently expressed human PRAT4A protein (Fig. 4A) or mRNA encoding endogenously expressed PRAT4A by RT-PCR (Fig. 4B), both of which were apparently down-regulated by two distinct siRNA, siRNA1 and siRNA2, but not by sequence-scrambled control RNA, ctrl1 and ctrl2 (Fig. 4, A and B). The PRAT4A siRNA did not down-regulate mRNA expression encoding human TLR4-FH, indicating specific silencing by the siRNA (Fig. 4B). HEK293 cells stably expressing human TLR4 were transiently transfected with the human PRAT4A siRNA. Cell surface TLR4 was detected by flow cytometry with an anti-human TLR4 mAb, HTA125 (Fig. 4C). The PRAT4A siRNA down-regulated cell surface human TLR4 without influencing the expression of mRNA encoding hTLR4-FH (Fig. 4B). Cell surface CD44 was not influenced by the siRNA, and the sequence-scrambled control siRNA had no effect on cell surface hTLR4-FH.


Figure 4
View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 4. Cell surface murine TLR4 is down-regulated by the knockdown of human PRAT4A (hPRAT4A). A, HEK293 cells were transiently transfected with the expression vector encoding human PRAT4A-FH (hPRAT4A-FH; lanes 2–6) and 2 nM siRNA (PRAT4A siRNA1 and siRNA2 are in lanes 4 and 6, respectively, and control siRNAs for siRNA1 and siRNA2 are in lanes 3 and 5, respectively) 3 days before analyses. HEK293 cells were subjected to SDS-PAGE, Western blotting, and immunoprobing with the anti-Flag mAb for PRAT4A-FH (top panel) or with an anti-actin mAb as loading controls (bottom panel). B, HEK293 cells stably expressing human TLR4-FH were transfected with the 20 nM PRAT4A siRNA (siRNA1 and siRNA2) or 20 nM sequence-scrambled control RNA (control 1 and control 2) as indicated. RT-PCR was conducted with template cDNAs without dilution or with 4-fold or 16-fold dilution. cDNAs encoding human PRAT4A (top panel), human TLR4 (middle panel), or human HPRT (hHPRT; bottom panel) were amplified, electrophoresed on an agarose gel, and visualized. C, HEK293 cells stably expressing human TLR4 were transfected with the PRAT4A siRNA or control siRNA at the indicated concentration (2 or 10 nM). HEK293 cells were stained 4 days later with an anti-human TLR4 mAb HTA125 or anti-human CD44 as indicated.

 
PRAT4A knockdown negatively regulates cell surface expression of TLR4/MD-2 and LPS responsiveness

We next asked whether PRAT4A regulates cell surface expression of TLR4/MD-2. We established two Ba/F3 cell lines, PRAT4A8 and PRAT4A11, stably expressing TLR4/MD-2 and the mouse PRAT4A shRNA. The effect of the PRAT4A shRNA was confirmed by semiquantitative PCR (Fig. 5A). The PRAT4A mRNA was reduced to 15% (PRAT4A8) or 13% (PRAT4A11) by the shRNA when compared with the Ba/F3 transfectant without transduction or with the Ba/F3 transfectant expressing an empty vector (Fig. 5A). PRAT4A mRNA reduction by ~85% appeared to be sufficient for down-regulating cell surface TLR4/MD-2 on Ba/F3 cells to the undetectable level by flow cytometry (Fig. 5B). Such a drastic down-regulation was not observed in cell surface TLR2 or CD43 (Fig. 5B, and data not shown). We asked whether the lack of cell surface TLR4/MD-2 influenced LPS responses. Because the Ba/F3 transfectants had been transfected with a luciferase reporter construct driven by NF-{kappa}B activity, transfectants were stimulated with lipid A, LPS, another TLR4/MD-2 ligand (Taxol), or TNF-{alpha}. Luciferase activity in the cell lysate was determined (Fig. 5C). Whereas Ba/F3 transfectants without any treatment or with an empty control vector both responded to the TLR4 ligands, those with the PRAT4A shRNA did not respond to lipid A or LPS from E. coli even at a concentration as high as 10 µg/ml (Fig. 5C). Similar results were obtained with another TLR4/MD-2 ligand (Taxol) (data not shown). PRAT4A knockdown had no effect on NF-{kappa}B activation induced by TNF-{alpha} (data not shown).


Figure 5
View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 5. Down-regulation of cell surface TLR4/MD-2 by the PRAT4A knockdown. A, Expression of PRAT4A mRNA was determined by semiquantitative PCR in TLR4/MD-2-expressing Ba/F3 transfectants without any treatment (no treat), with transduction with an empty vector (control), or with the PRAT4A shRNA (PRAT4A8 and PRAT4A11). The amount of PRAT4A mRNA was normalized by the amount of beta-actin mRNA and is represented as the mean average from triplicate samples. B, Cell surface TLR4/MD-2 and TLR2 on Ba/F3 transfectants were stained with biotinylated mAbs to TLR4 (MTS510) or TLR2, followed by streptavidin-PE. Open histograms depict staining with the second reagent alone. The cell lines studied are indicated in the figure. C, Ba/F3 cells expressing TLR4/MD-2 and the NF-{kappa}B luciferase reporter construct were stimulated with lipid A or LPS from E. coli as indicated. Luciferase activity was determined and represented as fold increase from the activity without stimulation. The results were shown as the mean from triplicates.

 
PRAT4A knockdown led to the lack of mature TLR4/MD-2 on the cell surface

To ask how the PRAT4A shRNA led to the lack of cell surface TLR4/MD-2 and hyporesponsiveness to LPS, the expression of TLR4 and MD-2 was studied. RT-PCR revealed that the amount of mRNA encoding TLR4 or MD-2 was not down-regulated by the PRAT4A shRNA (Fig. 6A). Because TLR4 and MD-2 had been tagged with the FH epitope, these molecules were precipitated with the anti-Flag mAb and immunoprobed with the anti-His6 mAb, respectively. The amount of TLR4 protein was decreased in one of the transfectants, PRAT4A11, but not in the other transfectant, PRAT4A8, when compared with Ba/F3 cells without transduction or with a control vector (Fig. 6B, lanes 4 and 5). The MD-2 protein was comparably expressed in all the lines. Despite the expression of TLR4, PRAT4A was not coprecipitated with TLR4 in the transfectants expressing PRAT4A shRNA, demonstrating its silencing effect (Fig. 6B, middle). The MTS510 mAb was specific for the TLR4/MD-2 complex and the preferentially precipitated mature form of TLR4 (compare TLR4 in Fig. 6B, lane 2, between the upper and lower panels). Despite the expression of TLR4 and MD-2, TLR4 was much less precipitated by the MTS510 mAb in the transfectants with RPAT4A shRNA (Fig. 6B, lower panel), indicating the lack of mature TLR4. These results demonstrate an important role for PRAT4A in TLR4 maturation.


Figure 6
View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 6. PRAT4A knockdown leads to the lack of mature TLR4/MD-2. A, Expression of mRNAs encoding TLR4, MD-2, and HPRT was determined by RT-PCR in TLR4/MD-2-expressing Ba/F3 transfectants without any treatment (no treat), with transduction with an empty vector (control), or with the PRAT4A shRNA (PRAT4A no.8 and PRAT4A no.11). RTPCR was conducted with template cDNAs without dilution or with 4-fold or 16-fold dilution for each sample. cDNAs encoding murine TLR4 (mTLR4; top panel), murine MD-2 (mMD-2; middle panel), or murine HPRT (mHPRT; bottom panel) were amplified, electrophoresed on an agarose gel, and visualized. B, TLR4 and MD-2 with the FH epitope (TLR4-FH and MD-2-FH) were precipitated (IP) with anti-Flag mAb (top and middle panels) or the anti-TLR4 mAb MTS510 (bottom panel) from TLR4/MD-2-expressing Ba/F3 transfectants as indicated. Precipitated TLR4-FH and MD-2-FH were probed with the anti-His mAb (top panel). Coprecipitated endogenous PRAT4A was probed with the anti-PRAT4A mAb (middle panel). TLR4-FH precipitated with MTS510 was probed with the anti-His mAb (bottom panel). WB, Western blotting.

 
PRAT4A knockdown negatively regulates cell surface TLR4 and TLR4/MD-2 on DCs

To confirm that the role for PRAT4A on TLR4 was not restricted to in vitro cell lines such as Ba/F3 or HEK293 cells, bone marrow-derived DCs were transduced with retrovirus encoding the PRAT4A shRNA or an empty control vector. Cell surface expression of TLR4 alone, TLR4/MD-2, or TLR2 was determined by flow cytometry analyses. TLR4 alone was detected on MD-2-deficient DCs without any treatment or with an empty control vector but not on those with the PRAT4A shRNA (Fig. 7A). Similarly, cell surface TLR4/MD-2 on wild-type DCs was drastically down-regulated with the PRAT4A shRNA (Fig. 7B). The control vector had no effect on cell surface expression of TLR4/MD-2. To make sure that the TLR4 protein is expressed in PRAT4A-silenced DCs, DCs expressing the PRAST4A shRNA were enriched and subject to immunoprecipitation with the anti-TLR4 mAb Sa15-21 and to immunoprobing with anti-TLR4 Ab (Fig. 7C). We were able to detect the TLR4 protein in DCs expressing the RPAT4A shRNA, but the amount of TLR4 protein in PRAT4A-silenced DCs was much less than the amount in control cells, DCs without any treatment, or DCs expressing an empty vector. When compared with TLR4/MD-2, cell surface TLR2 was much less influenced by the PRAT4A shRNA (Fig. 7B). However, we cannot exclude a possibility that PRAT4A knockdown had a small but significant effect on cell surface expression of TLR2. This issue is currently being studied further.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The present study identified RPAT4A as a novel molecule that is associated with TLR4 and regulates its cell surface expression. This conclusion was based on the following results. First, physical association between TLR4 and PRAT4A was shown in human and mouse cell lines, HEK293 cells, and Ba/F3 cells (Fig. 3). Second, gene silencing of the PRAT4A mRNA down-regulated cell surface TLR4 alone on human HEK293 cells and mouse MD-2-deficient DCs (Figs. 4 and 7). Third, PRAT4A knockdown decreased cell surface TLR4/MD-2 on Ba/F3 transfectants and wild-type DCs. Fourth, mature TLR4/MD-2 precipitated by the MTS510 mAb was reduced by the PRAT4A knockdown (Fig. 6).

PRAT4A binds hypoglycosylated TLR4 with or without MD-2 (Fig. 3C), but not with mature TLR4/MD-2. PRAT4A knockdown decreased the amount of mature TLR4 precipitated with the MTS510 mAb, but not that of immature TLR4 (Fig. 6B). These results suggest a role for PRAT4A in TLR4 maturation/glycosylation. Although the MTS510 mAb was unable to precipitate TLR4/MD-2 in Ba/F3 transfectants with RPAT4A shRNA (Fig. 6B), it is possible that hypoglycosylated TLR4 is still associated with hypoglycosylated MD-2 even in the lack of PRAT4A. A role for PRAT4A in the assembly of the TLR4/MD-2 complex remains to be clarified.

An ER chaperon, gp96, was shown to have a similar role. Randow and Seed (22) described a pre-B cell line, deficient in gp96, in which TLR4 failed to associate with MD-2, get to the cell surface, and respond to LPS. Altered localization of gp96 from ER to the membrane led to the redistribution of TLR4 (20). gp96 regulates the subcellular distribution of not only TLR4 but also TLR2, TLR1, and some integrins (22). Although PRAT4A is not associated with TLR2, it remains to be determined whether PRAT4A is associated with other TLRs, including TLR1 or TLR6.

A majority of TLR4 was detected inside the cells in the Golgi apparatus (16) as a hypoglycosylated immature form as judged by SDS-PAGE analyses (Fig. 3B, lane 3). Overexpression of MD-2 increased the mature form of TLR4 on the cell surface, but most TLR4 still remained immature in the Golgi apparatus (Fig. 3B, lane 2) (16). There must be machinery regulating the subcellular distribution of TLR4 between Golgi/ER and the cell surface. The Golgi apparatus is reported to be another site allowing TLR4/MD-2 to recognize LPS. TLR4 in intestinal epithelial cells resides in the Golgi apparatus, and internalized LPS is recognized in the Golgi apparatus (20). The molecular mechanisms by which TLR4/MD-2 stays in Golgi/ER or traffics back from the cell surface are currently unknown. PRAT4A is likely to be a component of the machinery facilitating TLR4/MD-2 trafficking to the cell surface. Further study might reveal a difference in cytokine production between TLR4/MD-2 on the cell surface and in the Golgi apparatus.

PRAT4A knockdown led to the profound defect in LPS responsiveness that is probably due to the impaired maturation of TLR4, leading to the lack of mature TLR4/MD-2 on the cell surface (Fig. 5). PRAT4A was required for cell surface expression of TLR4/MD-2, not only in Ba/F3 cells but also in normal DCs (Fig. 7), suggesting a role for PRAT4A in DC response to LPS. We are currently studying a role for PRAT4A in LPS responses by DCs or macrophages by using shRNA. Up-regulation or down-regulation of PRAT4A may influence LPS responses. PRAT4A was previously shown to be induced by all-trans retinoic acid (29). It is important to study induction and reduction of PRAT4A mRNA upon a variety of stimulations.

In conclusion, the present study identified a novel molecule that is associated with TLR4 and regulates cell surface expression of TLR4. This molecule might reveal a novel mechanism regulating the subcellular distribution of TLR4.


    Acknowledgments
 
We thank Dr. Shizuo Akira (Osaka University, Osaka, Japan) for providing us with TLR4-deficient mice.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This study was supported by Special Coordination Funds of the Ministry of Education, Culture, Sports, Science and Technology of the Japanese Government, Uehara Memorial Foundation, the Takeda Foundation, and the Naito Foundation. Back

2 Y.W. and M.K. contributed equally to this study. Back

3 Address correspondence and reprint requests to Dr. Kensuke Miyake, Division of Infectious Genetics, Institute of Medical Science, University of Tokyo, 4-6-1 Shirokanedai, Minatoku, Tokyo 108-8639, Japan. E-mail address: kmiyake{at}ims.u-tokyo.ac.jp Back

4 Abbreviations used in this paper: DC, dendritic cell; ER, endoplasmic reticulum; FH, Flag/His6 epitope; HPRT, hypoxanthine phosphoribosyltransferase; siRNA, small interfering RNA; shRNA, short hairpin RNA. Back

Received for publication February 15, 2006. Accepted for publication May 5, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Janeway, C. A., Jr, R. Medzhitov. 2002. Innate immune recognition. Annu. Rev. Immunol. 20: 197-216. [Medline]
  2. Takeda, K., T. Kaisho, S. Akira. 2003. Toll-like receptors. Annu. Rev. Immunol. 21: 335-376. [Medline]
  3. Medzhitov, R., P. Preston-Hurlburt, C. A. Janeway, Jr. 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388: 394-397. [Medline]
  4. Gewirtz, A. T., T. A. Navas, S. Lyons, P. J. Godowski, J. L. Madara. 2001. Cutting edge: bacterial flagellin activates basolaterally expressed TLR5 to induce epithelial proinflammatory gene expression. J. Immunol. 167: 1882-1885. [Abstract/Free Full Text]
  5. Barton, G. M., J. C. Kagan, R. Medzhitov. 2006. Intracellular localization of Toll-like receptor 9 prevents recognition of self DNA but facilitates access to viral DNA. Nat. Immunol. 7: 49-56. [Medline]
  6. Krug, A., S. Rothenfusser, V. Hornung, B. Jahrsdorfer, S. Blackwell, Z. K. Ballas, S. Endres, A. M. Krieg, G. Hartmann. 2001. Identification of CpG oligonucleotide sequences with high induction of IFN-{alpha}/beta in plasmacytoid dendritic cells. Eur. J. Immunol. 31: 2154-2163. [Medline]
  7. Verthelyi, D., K. J. Ishii, M. Gursel, F. Takeshita, D. M. Klinman. 2001. Human peripheral blood cells differentially recognize and respond to two distinct CPG motifs. J. Immunol. 166: 2372-2377. [Abstract/Free Full Text]
  8. Honda, K., Y. Ohba, H. Yanai, H. Negishi, T. Mizutani, A. Takaoka, C. Taya, T. Taniguchi. 2005. Spatiotemporal regulation of MyD88-IRF-7 signalling for robust type-I interferon induction. Nature 434: 1035-1040. [Medline]
  9. Latz, E., A. Schoenemeyer, A. Visintin, K. A. Fitzgerald, B. G. Monks, C. F. Knetter, E. Lien, N. J. Nilsen, T. Espevik, D. T. Golenbock. 2004. TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nat. Immunol. 5: 190-198. [Medline]
  10. Kennedy, M. N., G. E. Mullen, C. A. Leifer, C. Lee, A. Mazzoni, K. N. Dileepan, D. M. Segal. 2004. A complex of soluble MD-2 and lipopolysaccharide serves as an activating ligand for Toll-like receptor 4. J. Biol. Chem. 279: 34698-34704. [Abstract/Free Full Text]
  11. Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. V. Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, et al 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282: 2085-2088. [Abstract/Free Full Text]
  12. Qureshi, S. T., L. Lariviere, G. Leveque, S. Clermont, K. J. Moore, P. Gros, D. Malo. 1999. Endotoxin-tolerant mice have mutations in Toll-like receptor 4 (Tlr4). J. Exp. Med. 189: 615-625. [Abstract/Free Full Text]
  13. Hoshino, K., O. Takeuchi, T. Kawai, H. Sanjo, T. Ogawa, Y. Takeda, K. Takeda, S. Akira. 1999. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J. Immunol. 162: 3749-3752. [Abstract/Free Full Text]
  14. Chow, J. C., D. W. Young, D. T. Golenbock, W. J. Christ, F. Gusovsky. 1999. Toll-like receptor-4 mediates lipopolysaccharide-induced signal transduction. J. Biol. Chem. 274: 10689-10692. [Abstract/Free Full Text]
  15. Shimazu, R., S. Akashi, H. Ogata, Y. Nagai, K. Fukudome, K. Miyake, M. Kimoto. 1999. MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like receptor 4. J. Exp. Med. 189: 1777-1782. [Abstract/Free Full Text]
  16. Nagai, Y., R. Shimazu, H. Ogata, S. Akashi, K. Sudo, H. Yamasaki, S. Hayashi, Y. Iwakura, M. Kimoto, K. Miyake. 2002. Requirement for MD-1 in cell surface expression of RP105/CD180 and B-cell responsiveness to lipopolysaccharide. Blood 99: 1699-1705. [Abstract/Free Full Text]
  17. Schromm, A. B., E. Lien, P. Henneke, J. C. Chow, A. Yoshimura, H. Heine, E. Latz, B. G. Monks, D. A. Schwartz, K. Miyake, D. T. Golenbock. 2001. Molecular genetic analysis of an endotoxin nonresponder mutant cell line: a point mutation in a conserved region of MD-2 abolishes endotoxin-induced signaling. J. Exp. Med. 194: 79-88. [Abstract/Free Full Text]
  18. Miyake, K., H. Ogata, Y. Nagai, S. Akashi, M. Kimoto. 2000. Innate recognition of lipopolysaccharide by Toll-like receptor 4/MD-2 and RP105/MD-1. J. Endotoxin Res. 6: 389-391. [Medline]
  19. Akashi, S., S.-i. Saitoh, Y. Wakabayashi, T. Kikuchi, N. Takamura, Y. Nagai, Y. Kusumoto, K. Fukase, S. Kusumoto, Y. Adachi, et al 2003. Lipopolysaccharide interaction with cell surface Toll-like receptor 4-MD-2: higher affinity than that with MD-2 or CD14. J. Exp. Med. 198: 1035-1042. [Abstract/Free Full Text]
  20. Hornef, M. W., B. H. Normark, A. Vandewalle, S. Normark. 2003. Intracellular recognition of lipopolysaccharide by toll-like receptor 4 in intestinal epithelial cells. J. Exp. Med. 198: 1225-1235. [Abstract/Free Full Text]
  21. Latz, E., A. Visintin, E. Lien, K. A. Fitzgerald, B. G. Monks, E. A. Kurt-Jones, D. T. Golenbock, T. Espevik. 2002. Lipopolysaccharide rapidly traffics to and from the Golgi apparatus with the Toll-like receptor 4-MD-2-CD14 complex in a process that is distinct from the initiation of signal transduction. J. Biol. Chem. 277: 47834-47843. [Abstract/Free Full Text]
  22. Randow, F., B. Seed. 2001. Endoplasmic reticulum chaperone gp96 is required for innate immunity but not cell viability. Nat. Cell Biol. 3: 891-896. [Medline]
  23. Ohnishi, T., M. Muroi, K. Tanamoto. 2003. MD-2 is necessary for the Toll-like receptor 4 protein to undergo glycosylation essential for its translocation to the cell surface. Clin. Diagn. Lab. Immunol. 10: 405-410.
  24. Jia, H. P., J. N. Kline, A. Penisten, M. A. Apicella, T. L. Gioannini, J. Weiss, P. B. McCray, Jr. 2004. Endotoxin responsiveness of human airway epithelia is limited by low expression of MD-2. Am. J. Physiol. 287: L428-L437.
  25. Gioannini, T. L., A. Teghanemt, D. Zhang, N. P. Coussens, W. Dockstader, S. Ramaswamy, J. P. Weiss. 2004. Isolation of an endotoxin-MD-2 complex that produces Toll-like receptor 4-dependent cell activation at picomolar concentrations. Proc. Natl. Acad. Sci. USA 101: 4186-4191. [Abstract/Free Full Text]
  26. Yamamichi, N., M. Yamamichi-Nishina, T. Mizutani, H. Watanabe, S. Minoguchi, N. Kobayashi, S. Kimura, T. Ito, N. Yahagi, M. Ichinose, et al 2005. The Brm gene suppressed at the post-transcriptional level in various human cell lines is inducible by transient HDAC inhibitor treatment, which exhibits antioncogenic potential. Oncogene 24: 5471-5481. [Medline]
  27. Akashi, S., R. Shimazu, H. Ogata, Y. Nagai, K. Takeda, M. Kimoto, K. Miyake. 2000. Cutting edge: cell surface expression and lipopolysaccharide signaling via the Toll-like receptor 4-MD-2 complex on mouse peritoneal macrophages. J. Immunol. 164: 3471-3475. [Abstract/Free Full Text]
  28. Margolis, R. L., M. R. Abraham, S. B. Gatchell, S. H. Li, A. S. Kidwai, T. S. Breschel, O. C. Stine, C. Callahan, M. G. McInnis, C. A. Ross. 1997. cDNAs with long CAG trinucleotide repeats from human brain. Hum. Genet. 100: 114-122. [Medline]
  29. Glozak, M. A., Y. Li, R. Reuille, K. H. Kim, M. N. Vo, M. B. Rogers. 2003. Trapping and characterization of novel retinoid response elements. Mol. Endocrinol. 17: 27-41. [Abstract/Free Full Text]
  30. Konno, K., Y. Wakabayashi, S. Akashi-Takamura, T. Ishii, M. Kobayashi, K. Takahashi, Y. Kusumoto, S. Saitoh, Y. Yoshizawa, K. Miyake. 2006. A molecule that is associated with Toll-like receptor 4 and regulates its cell surface expression. Biochem. Biophys. Res. Commun. 339: 1076-1082. [Medline]



This article has been cited by other articles:


Home page
Int ImmunolHome page
T. Kiyokawa, S. Akashi-Takamura, T. Shibata, F. Matsumoto, C. Nishitani, Y. Kuroki, Y. Seto, and K. Miyake
A single base mutation in the PRAT4A gene reveals differential interaction of PRAT4A with Toll-like receptors
Int. Immunol., September 9, 2008; (2008) dxn098v1.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Tissieres, I. Dunn-Siegrist, M. Schappi, G. Elson, R. Comte, V. Nobre, and J. Pugin
Soluble MD-2 is an acute-phase protein and an opsonin for Gram-negative bacteria
Blood, February 15, 2008; 111(4): 2122 - 2131.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
K. Takahashi, T. Shibata, S. Akashi-Takamura, T. Kiyokawa, Y. Wakabayashi, N. Tanimura, T. Kobayashi, F. Matsumoto, R. Fukui, T. Kouro, et al.
A protein associated with Toll-like receptor (TLR) 4 (PRAT4A) is required for TLR-dependent immune responses
J. Exp. Med., November 26, 2007; 204(12): 2963 - 2976.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Wang, T. Chen, C. Han, D. He, H. Liu, H. An, Z. Cai, and X. Cao
Lysosome-associated small Rab GTPase Rab7b negatively regulates TLR4 signaling in macrophages by promoting lysosomal degradation of TLR4
Blood, August 1, 2007; 110(3): 962 - 971.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wakabayashi, Y.
Right arrow Articles by Miyake, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wakabayashi, Y.
Right arrow Articles by Miyake, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS