The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reinhardt, R. L.
Right arrow Articles by Locksley, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reinhardt, R. L.
Right arrow Articles by Locksley, R. M.
The Journal of Immunology, 2006, 177: 1618-1627.
Copyright © 2006 by The American Association of Immunologists

Visualization of IL-12/23p40 In Vivo Reveals Immunostimulatory Dendritic Cell Migrants that Promote Th1 Differentiation1

R. Lee Reinhardt2,*, Seokmann Hong2,*,{dagger}, Suk-Jo Kang*, Zhi-en Wang* and Richard M. Locksley*

* Howard Hughes Medical Institute and Departments of Medicine and Microbiology and Immunology, University of California, San Francisco, CA 94143; and {dagger} Bioscience and Biotechnology, Sejong University, Seoul, Korea


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
IL-12p40 is induced in macrophages and dendritic cells (DC) after activation by microbial TLR ligands and cytokines and constitutes a component of IL-12 and IL-23. In an effort to understand the location and kinetics of these cytokines during the course of an immune response, we generated knockin (gene-targeted) mice that express the p40 gene linked via a viral internal ribosome entry site element with fluorescent reporters, eYFP or eGFP. Macrophages and DC from these mice faithfully reported biallelic p40 induction using the fluorescent marker. s.c. inoculation with Listeria monocytogenes or LPS led to a rapid, but transient, accumulation of p40-expressing DC in draining lymph nodes, which could be blocked by the addition of pertussis toxin. In situ analysis also revealed the accumulation of IL-12p40 protein around high endothelial venules located in close proximity to p40-expressing DC. Consistent with the in vivo findings, in vitro-activated DC that expressed p40 migrated to draining lymph nodes and promoted Th1 differentiation more efficiently than DC that did not express p40. Accordingly, these mice provide a valuable tool for tracking critical functions of DC in vivo and should bestow a useful reagent for exploring the effector biology of these cells in models of infectious disease, cancer immunity, and vaccine development.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Interleukin 12 is the founding member of a group of heterodimeric cytokines that critically link innate and adaptive immunity (1). IL-12 is produced after activation of TLRs, primarily on macrophages and dendritic cells (DC),3 by NF-{kappa}B- and IFN-{gamma}-dependent pathways that target the IL-12/IL-23p40 and IL-12p35 genes. After dimerization of p40 and p35, active IL-12 is secreted, whereupon it interacts with its receptors on activated NK and T cells to promote, with IL-2, growth, survival, and importantly, production of IFN-{gamma} (2). In the case of NK and memory/effector T cells, the capacity of IL-12 to induce IFN-{gamma} production by a TCR-independent pathway may be important in early immune responses (3, 4, 5). Following maturation and migration to draining lymph nodes, DC prime naive T cells, during the course of which IL-12 is a key cytokine required for efficient Th1 development as part of the adaptive immune system (6, 7).

In addition to associating with p35 to form IL-12, p40 can dimerize with the p35-like protein, p19, to form IL-23, a heterodimeric cytokine that shares with IL-12 the use of the IL-12Rbeta1 chain and the ability to activate signal transducer and activator of transcription 4 (Stat4) (8). Although Th1 cells and activated macrophages express p19 mRNA, only activated myeloid DC secrete IL-23 (8). Although less potent than IL-12 in promoting IFN-{gamma} secretion from naive T cells following primary activation, IL-23 has been shown to be instrumental in generating an IL-17-producing subset of CD4 T cells (9). Additionally, IL-23 does effectively mediate proliferation and IFN-{gamma} production from activated memory/effector T cells. The finding that mice deficient in p35 or IL-12Rbeta2 were less immunologically impaired than mice deficient in p40 or IL-12Rbeta1 could be explained by previously unappreciated contributions of IL-23 to host immunity (10).

Despite the importance of IL-12- and IL-23-producing cells to multiple areas of immunity, methods to follow the production of these cytokines or the cells that produce them in vivo are limited. DC constitute heterogeneous populations that are few in number and turnover rapidly after activation (11, 12), although this may vary with conditions (13). Macrophages are likely just as diverse, and their residence in tissues makes their recovery difficult. Using a method that we applied previously to track the production of IL-4-expressing cells (14), we generated mice with a knockin p40 allele modified to express bicistronically linked fluorescent reporter proteins, thus efficiently marking p40-expressing cells. As shown in this study, cells from these mice faithfully report p40 expression. This fluorescent reporter was used to recover a functionally discrete population of DC that accumulated in draining lymph nodes subsequent to s.c. inoculation and that were capable of efficiently activating naive CD4 T cells. Only DC that expressed p40 efficiently promoted Th1 differentiation, and this was independent of enhanced IL-12 production by these cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Animals

BALB/c, C57BL/6, C57BL/6.PL, C57BL/6 p40–/–, and C57BL/6 p35–/– mice were obtained from The Jackson Laboratory. OT-II mice expressing an I-Ab-restricted OVA-specific TCR were crossed to C57BL/6 TCR-C{alpha}–/– mice (The Jackson Laboratory) (15). DO11.10 mice expressing I-Ad-restricted OVA-specific TCRs were crossed onto yeti and 4get cytokine reporter mice. Mice were maintained in the University of California, San Francisco, specific pathogen-free animal facility in accordance with institutional guidelines.

Generation of p40 knockin mice

BamHI and XhoI sites were introduced using PCR-mediated mutagenesis 50 base pairs downstream of the TAG stop codon in exon 8 of a murine 129/Sv IL-12p40 genomic bacterial artificial chromosome clone (16). A bicistronic reporter cassette containing an encephalomyocarditis virus internal ribosome entry site (IRES) element was modified as described (14) and was inserted 5' of eYFP followed by a bovine growth hormone polyadenylation signal (Clontech Laboratories). A loxP-flanked neomycin resistance cassette, derived from pL2new2 (17), was placed at the 3' end to generate the final selectable cassette, which was cloned into the BamHI and XhoI sites in the mutated IL-12p40 gene to generate the final targeting construct. A second targeting construct using eGFP was generated after introduction of XbaI and EcoRV sites downstream of the exon 8 stop codon to accept the eGFP cassette. The NotI-linearized constructs were electroporated into PrmCre embryonic stem (ES) cells, which express Cre recombinase under control of the protamine promoter (18), and selection was achieved using G418. Resistant ES clones were screened by Southern blotting and correctly targeted clones were injected into C57BL/6 blastocysts to create chimeric mice. The neomycin resistance cassette was deleted in the male germline by Cre-mediated recombination. Chimeric males were bred to wild-type C57BL/6 mice, and offspring were selected for the mutated IL-12p40 allele and for deletion of the neomycin cassette. Heterozygous mice were backcrossed to C57BL/6 and selected for absence of the Cre transgene. Targeted mice were designated yet40 (yellow-enhanced transcript for p40) or get40 (green-enhanced transcript for p40). Yet40 and get40 mice were backcrossed three to five generations to C57BL/6 or BALB/c and intercrossed to derive homozygous knockin mice or bred to p40–/– or p35–/– mice.

In vitro T cell activation

Activating TLR ligands used in this study included LPS (Escherichia coli 026:B6; Sigma-Aldrich), peptidoglycan (PGN; Fluka), and poly(I:C) (Amersham Biosciences). Unmethylated CpG (1826T; TCCATGACGTTCCTGACGTT) and control GpC DNA (1826TGC; TCCATGAGCTTCCTGAGCTT) were synthesized (Oligos Etc.). Unless specified, activating ligands were used at the following final concentrations: LPS, 1 µg/ml; PGN, 100 µg/ml; CpG/GpC, 5 µg/ml; poly(I:C), 100 µg/ml.

Preparation of macrophage and DC populations

Peritoneal macrophages were harvested in 5% DMEM 3–5 days after i.p. injection of 3% thioglycolate. Recovered cells were distributed to culture dishes, and nonadherent cells were removed after 3 h by washing with warm medium. Designated TLR ligands were added with 100 U/ml recombinant IFN-{gamma}, and cells were detached and analyzed by flow cytometry at the designated time points.

Bone marrow-derived DC (BMDC) and BM-derived plasmacytoid IFN-producing DC (BMpDC) were prepared using conventional methods. Briefly, cells were flushed from the tibias and femurs of designated mice and plated at 37°C for 1 h. The nonadherent cells were collected and incubated at 106 cells/ml in complete RPMI 1640 medium containing 10–20 ng/ml recombinant murine GM-CSF and 10 ng/ml IL-4 for BMDC or 100 ng/ml Flt3L for BMpDC. Medium was replenished two to three times, and cells were harvested on day 5 or 7. BMDC and BMpDC were incubated with the indicated TLR ligands and analyzed at the specified time points.

Spleen DC and lymph node DC were isolated as described (19) and further enriched for CD11c+ cells using CD11c MACS beads (Miltenyi Biotec) or metrizamide gradient. Positively selected cells were analyzed using flow cytometry or sorted after staining with the indicated Abs.

IL-12 cytokine analysis in yet40 mice

Intracellular p40 was analyzed after the addition of 10 µg/ml brefeldin A (Epicentre Technologies) for the final 2 h of culture. Cells were fixed with 4% formaldehyde, permeabilized with 0.5% saponin buffer, and analyzed after incubation with PE-conjugated anti-p40 mAb C15.6 (BD Pharmingen). Secreted IL-12p40/p70 was detected in supernatants by ELISA using mAb C15.6 for capture and biotinylated mAb C17.8 (BD Pharmingen) for detection. Recombinant murine IL-12 was used as a standard.

Tissue immunohistochemistry

Spleens and lymph nodes were isolated at the indicated time points and placed directly into 4% paraformaldehyde for 2 h. Following an overnight wash in PBS, tissues were frozen in OCT embedding compound (Sakura Finetek), and 6- to 8-µm sections were cut using a cryomicrotome (CM 1850; Leica). For detection of eYFP, the signal was amplified using tyramide amplification as described (20). Briefly, after blocking endogenous peroxidase and biotin in the tissue, sections were incubated with rabbit anti-GFP polyclonal Ab (ab 6556; Novus Biologicals), followed by biotinylated goat anti-rabbit F(ab')2 (Jackson ImmunoResearch Laboratories), streptavidin-peroxidase, and FITC-tyramide from the thyamis signal amplification-fluorescein kit (PerkinElmer) according to the manufacturer’s instructions. For detection of CD11c or vascular endothelial growth factor receptor III (VEGFR-III) (R&D Systems) on the same slides, peroxidase and biotin were again blocked, and sections were incubated sequentially with biotinylated anti-CD11c (BD Pharmingen) or biotinylated anti-VEGFR-III, streptavidin-peroxidase, and biotinyl-tyramide. Deposited biotin was detected by streptavidin-Cy3 (Caltag Laboratories).

IL-12 protein was visualized by incubation with a biotinylated mAb specific for p40 homodimers or the functional p70 heterodimer. This signal was amplified using biotinyltyramide and streptavidin-Cy3. B cell follicles were identified using allophycocyanin- or FITC-conjugated anti-B220, and high endothelial venules (HEV) were visualized with MECA-79 followed by Cy5-conjugated goat anti-rat Ab (Jackson ImmunoResearch Laboratories). Nuclei were counterstained with 4',6'-diamidine-2'-phenylindole dihydrochloride (DAPI; Roche) in PBS before mounting the coverslip. Digital images in the DAPI, FITC, Cy3, and Cy5 channels were collected using a Marianas deconvolution fluorescence microscope (3I) equipped with SlideBook software (3I). Images were converted to RGB, colored and overlaid using Adobe Photoshop software (Version 7.0; Adobe Systems).

Flow cytometric analysis of eYFP+ cells in draining lymph nodes following LPS injection

Axillary, brachial, and inguinal lymph node DC were isolated from untreated mice or mice injected s.c. with 100 µg of LPS split among four sites on the back. CD11c+ cells were analyzed for expression of eYFP (p40), CD11b, I-Ab, CD8{alpha}, CD205, CD40, and B220 as indicated. Samples were analyzed on a MoFlo (DakoCytomation) or FACSCalibur cytometer (BD Biosciences). Where designated, 1 µg of pertussis toxin (EMI Biosciences) per injection site was added to the LPS. L-selectin binding was blocked by injecting 500 µg of MEL-14 Ab i.v. 24 h before and at the time of LPS injection.

In vitro activation of Ag-specific T cells

BMDC from yet40 and yet40 x p35–/– mice were generated as described and incubated for 12 h in the presence of CpG. The CD11c+ cells were sorted into eYFP+ and eYFP subsets and were plated in serial twofold dilutions starting at 20,000 DC per well of a 96-well plate. OT-II TCR-C{alpha}–/– T cells were isolated from lymph nodes and purified by negative selection using MACS CD4 beads (Miltenyi Biotec). Twenty thousand OT-II T cells were added to each well and pulsed with 300 nM OVA323–339 peptide. T cell proliferation was measured on day 3 by [3H]thymidine incorporation after incubation with 1 µCi/ml for the last 17 h of culture as described (19). IL-2 secretion was analyzed after 5 days of culture by ELISA (Quantikine IL-2 ELISA kit; R&D Systems).

IFN-{gamma} and IL-4 production was accessed by culturing DAPI, CD4+, CD8, CD62Lhigh DO11.10 4get/yeti T cells with CD11c+, eYFP+, or eYFP BMDC. Cytokine expression was quantitated based on GFP and YFP expression among the T cells.

In vivo migration and stimulation of Ag-specific T cells by eYFP+ DC

BMDC were stimulated with CpG for 12 h and sorted into CD11c+ eYFP and CD11c+ eYFP+ subsets. These sorted DC subsets were labeled with 2 µM 5-(and -6)-(((4-chloromethyl)benzoyl)amino)tetramethylrhodamine (CMTMR) (Molecular Probes) and incubated for 2 h with 300 µg of OVA323–339 peptide before s.c. injection in the footpads of C57BL/6 Thy1.1+ mice that had previously received 3 x 106 OT-II x TCR C{alpha}–/– T cells from congenic C57BL/6 Thy1.2+ mice. To visualize migration of the injected cells, popliteal lymph nodes draining the site of injection were isolated 24 h after injection and frozen in OCT. Tissue sections were obtained and dehydrated in acetone before staining. Sections were fixed briefly in 1% formaldehyde and stained with biotin-conjugated anti-Thy1.2, followed by FITC-tyramide amplification to visualize the Ag-specific OT-II T cells. B cell areas were identified using allophycocyanin-conjugated anti-B220 Ab.

To address T cell proliferation and cytokine production, single-cell suspensions were prepared from the popliteal lymph nodes draining both the injected and uninjected footpad and the spleen of recipient mice 72 h after injection. An aliquot was used to quantitate numbers of OT-II T cells, and the rest of the cells were incubated with PMA/ionomycin for 4 h before intracellular cytokine staining as described using FITC-conjugated anti-Thy1.2, PerCP-Cy5.5-conjugated anti-CD4, and allophycocyanin-conjugated anti-IL-2.

L. monocytogenes infection and analysis

Yet40 mice were injected subcutaneously with 105 L. monocytogenes (strain: 10403S) at four different sites in the back (21). At 24 or 48 h after infection, eYFP+ and eYFP DC were isolated and analyzed by flow cytometry.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Generation of yet40 and get40 mice

An IL-12 genomic bacterial artificial chromosome clone, including exons 5–8, was used to introduce a loxP-flanked neomcyin selection cassette linked to the IRES-eYFP and IRES-eGFP constructs downstream of the translational stop codon and upstream of the endogenous polyadenylation signal in the 3' untranslated region of exon 8 (Fig. 1a). After selection with G418, ES cell clones were screened for correct integration using Southern blotting (Fig. 1b) and injected into C57BL/6 blastocysts. Chimeric males were bred to C57BL/6, and offspring were screened for the presence of the reporter and absence of the Cre transgene (Fig. 1b and data not shown). The targeted mice, which were healthy and fertile and exhibited no obvious phenotype, were designated as yet40 and get40.


Figure 1
View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 1. Targeting of the IRES-eYFP/eGFP reporter into the murine il12p40 gene locus. a, Targeting strategy for the eYFP p40 reporter mouse. b, Southern blot analysis of DNA from both ES clones and tail biopsies of offspring from heterozygous mice. Genomic DNAs were digested with XbaI and hybridized with the1.2 kb 3' probe (dark line). Due to a new XbaI site introduced by the targeting construct, digesting the wild-type allele results in a 8.5-kb band, and the targeted allele results in a 6.5-kb band (ES cells) or a 5.5-kb band after cre-mediated excision of the neomycin (mice). Genotypes are indicated as wild-type (+/+), heterozygous knockin (y/+). (X, XbaI; B, BamHI; Xh, XhoI). c, The expression of eGFP and eYFP was analyzed on CD11c+ cells from the draining lymph nodes of homozygous get40 (g/g), yet40 (y/y), and yet40/get40 (y/g) mice 16 h after s.c. injection of LPS.

 
IL-12/23p40 expression from the bicistronic allele

To assess expression from each of the marked alleles, we crossed get40 and yet40 mice to generate mice containing one get40 and one yet40 IL-12/p40 allele (IL-12/p40 y/g). Following isolation of DC from draining lymph nodes of LPS-treated mice, p40 expression was assessed by the distinct emission spectra of eGFP and eYFP. Under these conditions, essentially all eGFP+ DC expressed eYFP, consistent with activation of gene expression from both alleles (Fig. 1c). Because both get40 and yet40 mice revealed similar results, we chose to use yet40 mice in the remainder of the experiments.

To ensure that p40 protein was expressed at physiologic levels from the altered bicistronic knockin allele, we crossed heterozygous yet40 (y/+) mice that have one yet40 knockin allele and one wild-type allele with IL-12p40 knockout (–/–) mice to generate littermates of IL-12p40 (y/–) and (+/–) animals that contain only the yet40 knockin allele or the wild-type allele, respectively. Thus, IL-12p40 production could be compared directly from the wild-type p40 and knockin yet40 alleles. CD11c+, CD11b+, and CD80+ (data not shown) BMDC were incubated for 24 h with LPS, peptidoglycan, synthetic CpG oligonucleotides, or control GpC oligonucleotides, and supernatants were collected for IL-12 p40 determination by ELISA (Fig. 2a). Comparable amounts of IL-12 were detected in the supernatants of stimulated cells, indicating that p40 production by the knockin allele was not different from production by the wild-type allele. Additional confirmation that the knockin allele was a reliable reporter was established on a per-cell basis by intracellular cytokine staining. BMDC from p40 (+/–) and p40 (y/–) mice were incubated with LPS for 16 h and analyzed for simultaneous expression of p40 protein and eYFP (Fig. 2b). Comparable numbers of cells expressed p40 protein in both mice, corroborating faithful p40 production from the knockin allele. Although a small percentage of cells in p40 (y/–) mice were p40+ and eYFP, kinetic analysis revealed that all p40+ cells eventually became eYFP+, presumably reflecting a delay in folding of eYFP to a fluorescent-competent state (data not shown).


Figure 2
View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 2. Production of IL-12/p40 from the knockin allele by BMDC from yet40 mice is unaltered, compared with the wild-type IL-12/p40 allele. Wild-type or yet40 mice were crossed to p40-deficient animals to generate heterozygous IL-12 p40 (y/–) and (+/–) mice that contained only one knockin p40 or wild-type p40 allele, respectively. a, BMDC from (y/–) ({blacksquare}) or (+/–) ({square}) mice were cultured for 24 h without stimulus or with LPS, PGN, CpG, or GpC. Supernatants were collected and analyzed for IL-12 by ELISA. b, Intracellular cytokine staining was performed on BMDC from (y/–) and (+/–) mice after stimulation with LPS for 16 h, and cells were analyzed for intracellular p40 and eYFP by flow cytometry. c, Flt3L-induced plasmacytoid BMpDC from homozygous yet40 (y/y) mice were incubated with CpG and analyzed for eYFP by flow cytometry. d, Peritoneal macrophages from yet40 mice were analyzed by FACS for expression of eYFP 16 h after stimulation with 100 U/ml IFN-{gamma} alone or additionally with LPS. All data are representative of at least two independent experiments.

 
Induction of IL-12/23p40 from DC and macrophages in vitro

To investigate whether other DC subsets could produce IL-12/p40, Flt3L-induced, BMpDC were generated. BMpDC began to express eYFP ~3 h after stimulation with CpG (Fig. 2c). Correspondingly, challenge of GM-CSF/IL-4-derived BMDC in vitro with LPS resulted in increasing numbers of eYFP+ cells beginning at ~5 h after stimulation (data not shown). Activation of eYFP expression was dose dependent using both sets of conditions (Fig. 2c and data not shown). The induction of fluorescence observed using this reporter is in close agreement with experimental results examining transcription, translation, and the appearance of p40 protein in wild-type cells (22, 23, 24, 25).

We next isolated thioglycollate-elicited peritoneal macrophages by adherence and determined their capacity to activate the fluorescent reporter after priming with IFN-{gamma} and incubation with LPS. Stimulation with LPS elicited strong fluorescence and IL-12 production in supernatants (Fig. 2d). Taken together, these data suggest that the reporter faithfully marks cells of the DC and macrophage lineages that produce p40 following stimulation with TLR ligands.

Activation of eYFP in yet40 mice in vivo by TLR ligands

To assess the reliability of the reporter in vivo, we injected yet40 mice subcutaneously with 25 µg of LPS and followed the kinetics of fluorescence and p40 expression in the draining lymph nodes by immunohistochemistry. Whether assessed by examining eYFP or bona fide p40 protein staining, a small number of p40+ cells were detectable in the draining lymph nodes of naive mice, and these cells were confined to the center of the paracortex or T cell zones (Fig. 3a and data not shown). However, as early as 8 h after s.c. LPS injection, large numbers of cells were observed throughout the entire paracortex. The number of eYFP+ cells peaked between 16 and 18 h and then declined over the next 40 h. Of note, the number and positioning of eYFP+ cells was comparable in both yet40 mice and yet40 x p35–/– mice, indicating that IL-12/p70 itself plays no role in this orchestrated accumulation of p40-expressing cells (data not shown). The concurrence of eYFP and p40 protein confirms again that cells producing p40 protein have been marked reliably using this knockin strategy.


Figure 3
View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 3. Kinetics of p40 induction and protein production in situ after s.c. LPS injection. The yet40 mice were injected with 25 µg of LPS, and the draining popliteal lymph nodes were isolated at the indicated times. a, Sections from draining popliteal lymph nodes were stained with anti-GFP/FITC (green, upper) or anti-IL-12/Cy3 (red) and anti-B220/FITC (green, lower). Individual x100 images were merged to form the composite picture of the whole lymph node. b, Individual x100 image of the draining lymph node at 8 h from a, stained with anti-p40/Cy3 (red) and anti-B220/FITC (green). Composites (c–e) or individual x100 images (f–h) of sections from the draining lymph nodes 8 h after s.c. LPS injection. Sections (c and f) are stained with anti-p40/Cy3 (red), MECA-79/Cy5 (blue), and anti-VEFGR-III/FITC (green). Sections (d and g) were stained with anti-GFP/FITC (green), anti-MECA79/Cy5 (blue), and anti-VEGFR-III/Cy3 (red). Sections (e and h) are stained with isotype control (red), MECA-79/Cy5 (blue), and anti-VEFGR-III/FITC (green).

 
IL-12/p40 protein is sequestered by HEV in the draining lymph node

Intriguingly, eYFP staining remained tightly associated with cell bodies, whereas staining for IL-12 protein suggested coating of the abluminal surface of HEV, consistent with the trapping of IL-12 by matrix proteins optimized to enhance interactions with newly emigrant T cells (Fig. 3b). To confirm this, draining lymph nodes were stained with MECA-79 mAb to detect HEV (Fig. 3, c–h). Indeed, eYFP+ cells were found in close proximity to HEV 8 h after LPS injection, and only HEV in close proximity to eYFP+ cells stained positive for IL-12 (Fig. 3, d and g). Although IL-12 is positioned in association with the HEV network (Fig. 3, c and f), IL-12 is not similarly positioned in close proximity to lymphatic vessels, as revealed by VEGFR-III staining of lymphatic endothelial cells (Fig. 3, c–h), suggesting specificity for cytokine trapping within the lymphoid compartment rather than transport via the lymph to the HEV through the reticular network as has been shown for chemokines (26). Although it is known that chemokines bind to and are expressed by HEV, the extent that this occurs with cytokines is not known (27). This provides the first direct evidence in vivo that a secreted cytokine, such as IL-12p40, can bind directly to HEV and may represent a novel mechanism by which DC regulate lymphocyte differentiation.

Characterization of eYFP+ cells accumulating in draining lymph nodes after TLR stimulation

The capacity to mark viable cells with eYFP allowed us to isolate and characterize the phenotype(s) of fluorescent p40-expressing cells before and after LPS activation. Using magnetic bead selection, we isolated and enriched CD11c+ cells from the draining lymph nodes and used a panel of DC markers to characterize p40-expressing cells. In resting mice, a variety of DC subsets were evident, but eYFP fluorescence under basal conditions was restricted to a subset of CD11c+, CD11blow, CD8{alpha}, CD205+/–, and B220 cells (Fig. 4a and data not shown). Following LPS injection, a new eYFP+ population appeared, characterized as CD11c+, CD11blow, CD8{alpha}+, CD205+/–, and B220, that was clearly distinct from the basal population of fluorescent cells in uninjected mice (Fig. 4a and data not shown).


Figure 4
View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 4. Characterization of p40-expressing DC in the draining LN after s.c. injection of LPS or L. monocytogenes. CD11c+ cells were isolated from the draining axillary, brachial, and inguinal lymph nodes of mice left uninjected or injected 16 h previously with 100 µg of LPS dispersed over four sites on the back. a, After pooling six draining lymph nodes and gating on CD11c+ cells, eYFP+, and eYFP cells were analyzed for CD8{alpha} expression. The number represents the percentage of total DC that fall into the designated gate. b, CD11c+ cells were isolated from the draining lymph nodes of uninjected wild-type or yet40 mice or mice injected with LPS plus pertussis toxin or LPS plus MEL14 Ab. CD11c+ eYFP+ ({square}) or eYFP ({blacksquare}) cells were analyzed for CD8{alpha} expression. The graph represents the percentage ± SEM (n = 13–15 mice per group from nine independent experiments) before LPS injection or 16 h after s.c. LPS administration. The bar designated PTX represents the percentage ± SEM (n = 4 mice from four independent experiments) 16 h after LPS injection in the presence of pertussis toxin. The bar designated LPS + MEL14 represents the percentage ± SD (n = 2 mice per group from one experiment) of mice that received two injections of MEL14 Ab i.v. on the day of and one day before LPS injection. c, Mice were injected with 400,000 Listeria distributed over four sites on the back. The draining lymph nodes were harvested at the indicated times. Cells were gated by CD11c+CD3 expression to exclude T cells and analyzed for CD8{alpha} and eYFP. The numbers represent the percentage of total DC that fall into the designated gate. d, CD11c+ cells were isolated from the draining lymph nodes of uninjected yet40 mice or mice injected with Listeria with or without pertussis toxin. CD11c+eYFP+ or CD11c+eYFP cells were analyzed for CD11b and CD8{alpha} expression. The graph represents the percentage ± SEM (n = 4–6 mice from three independent experiments) of CD8{alpha}+, CD11c+, and CD3 cells within the CD11c+eYFP+ gate 48 h after Listeria infection in the presence or absence of pertussis toxin.

 
To assess whether this new population of cells represented immigrant DC, we coinjected pertussis toxin with LPS to block G protein-coupled migration. This specifically inhibits chemokine-mediated trafficking shown to be critical for DC emigration from the skin (28). Inclusion of pertussis toxin blocked the appearance of the CD8{alpha}+eYFP+ DC population in the lymph node but had no effect on the percentage of CD8{alpha}+eYFP DC (Fig. 4b). This would suggest that the appeareance of CD8{alpha}+eYFP+ DC is dependent on emigration from tissue or blood. In addition, in mice injected twice previously with MEL14 Ab to block L-selectin-facilitated recruitment from the blood, we saw a similar increase in the percentage and number of CD8{alpha}+eYFP+ DC after LPS injection (Fig. 4b). Thus, these CD8{alpha}+, p40-expressing DC are unlikely to represent cells that have been recruited from the blood via the HEV. Taken together, these data indicate that a significant population of p40-expressing DC appearing in the draining lymph node after LPS injection is dependent on emigrants from the inflammatory site. These data are most consistent with the hypothesis that a skin-resident DC subset, likely dermal DC or Langerhan cells, is induced to express p40 upon activation and migrates to the lymph node. However, it is possible that the induction of p40 expression is from a preexisting lymph node-resident DC population that is induced to express CD8{alpha} and p40 upon interaction with a p40-negative skin emigrant.

To address whether the increase in the CD8{alpha}+eYFP+ DC subset in the draining nodes could be seen during infectious challenges, we injected yet40 mice with L. monocytogenes. The CD8{alpha}+, p40-expressing DC subset also increased after infection with Listeria, although maximal accumulation did not occur until 48 h postinfection (Fig. 4c). As observed with LPS injection, this population was reduced by coinjection of pertussis toxin (Fig. 4d).

The induction of an inflammatory response to LPS and Listeria coincides temporally with the identification of these p40-expressing skin-emigrant DC populations. Consistent with this idea, CD8{alpha}+ DC have been described to be primary producers of IL-12 (29, 30, 31). However, it was unclear from these studies the extent to which IL-12 production was dependent on skin-emigrating DC. The above experiments demonstrate that DC immigrants from the skin play a substantial role in IL-12p40 production early during an immune response.

DC populations activated to express IL-12/23p40 migrate more efficiently to lymph nodes and promote greater proliferation and cytokine production from naive, Ag-specific CD4 T cells

Our observation of an emigrant population of DC from the skin accumulating in lymph nodes after peripheral Ag deposition in the skin is in agreement with prior observations in other systems (32, 33, 34, 35). Although a number of DC subsets have been implicated in Th cell differentiation, it remains unclear whether skin-emigrant DC populations are truly responsible for Th cell activation in situ. A recent study suggests that Ag can be presented by a number of different DC subsets in vivo, but that immigrating DC were required to invoke a strong effector response, as assessed using delayed-type hypersensitivity (32). An interesting hypothesis is that DC activated to express IL-12/23p40 might represent a functionally important subset of cells that integrated sufficient maturation signals to mediate efficient T cell activation. To test this possibility, BMDC from yet40 mice were stimulated with CpG for 12 h in vitro, and sorted into CD11c+ populations that were positive or negative for eYFP fluorescence. The sorted cells were incubated with OVA peptide, labeled with fluorescent dye CMTMR, washed, and injected into wild-type mice that had been reconstituted previously with a small percentage of naive OVA-specific OT-II TCR-transgenic CD4 T cells. After 24 h, significantly more of the transferred eYFP+ DC were observed in the draining lymph nodes, compared with the transferred eYFP DC, consistent with a substantial migratory advantage for p40-expressing DC (Fig. 5a). Furthermore, significantly greater numbers of OVA-specific T cells (Fig. 5b), as well as those that could produce IL-2 (Fig. 5c), were present in lymph nodes from mice that had received eYFP+ DC.


Figure 5
View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 5. eYFP+ BMDC migrate more efficiently to the draining lymph nodes and induce greater clonal expansion and IL-2 production from Ag-specific T cells than eYFP BMDC. CD11c+eYFP+ or CD11c+eYFP BMDC were pulsed with 300 nM OVA peptide, labeled with CMTMR, and injected into the foot pads of Thy1.1 congenic C57BL/6 mice that had previously received Thy1.2 OT-II CD4+ T cells. Images of popliteal lymph nodes from mice injected with eYFP+ or eYFP BMDC 24 h earlier (a). Sections were stained with anti-B220/Cy5 (blue), Thy1.2/FITC (green), and CMTMR-labeled DC appear red. The left image is a composite of the entire lymph node from individual x100 images, and the right image is a higher-power view of the same section. Graphs represent the total number of OT-II T cells (b) or the total number of OT-II T cells producing IL-2 protein (c) on day 3.5 after injection of eYFP+ DC ({square}), eYFP DC ({cjs2108}), or uninjected ({blacksquare}) in the draining or nondraining popliteal lymph nodes and spleen as assessed by FACS analysis. d, [3H]Thymidine incorporation into OT-II T cells after 3 days in vitro culture with indicated numbers of eYFP+ BMDC (•) or eYFP BMDC ({circ}). e, IL-2 production by OT-II T cells after 5 days of in vitro culture with indicated numbers of OVA-peptide pulsed eYFP+ BMDC (•) or eYFP BMDC ({circ}) as assayed by ELISA. Data are representative of two or more independent experiments performed in triplicate.

 
To assess whether the enhanced proliferation and cytokine production by Ag-specific T cells observed after introduction of eYFP+ DC was due solely to a greater efficiency of p40-expressing DC to enter lymph nodes or due to an enhanced ability to activate T cells, we titered the numbers of OVA-pulsed eYFP+ and eYFP DC with OT-II-transgenic T cells and measured their capacity to induce T cell proliferation and IL-2 production in vitro. Consistent with the data derived in vivo, the eYFP+ DC were more efficient at inducing naive T cell proliferation and IL-2 production across a wide range of T cell:DC ratios (Fig. 5, d and e).

Thus, by a variety of in vitro and in vivo assays, activation of IL-12/23 p40 marks immigrant DC populations that are particularly efficient at lymph node entry and activation of naive CD4 T cells. Intriguingly, p40-expressing p35-deficient DC were comparable with p40-expressing p35-sufficient DC in their superior capacity to migrate into lymph nodes and to activate naive T cells (data not shown), indicating that IL-12 protein itself is not required to mediate these activities. Whether IL-23 or p40 homodimers are compensating for the lack of IL-12 to mediate these events remains to be determined.

DC producing p40 express high levels of costimulatory molecules and promote Th1 differentiation

To elucidate the underlying mechanism for their enhanced capacity to activate naive T cells, we analyzed expression of costimulatory markers. The eYFP+ DC showed higher levels of both MHC class II and costimulatory molecules on the cell surface, compared with eYFP DC that expressed levels similar to unstimulated BMDC (Fig. 6a and data not shown). To assess whether p40-expression by DC affected Th cell differentiation, we made use of DO11.10 TCR-transgenic mice that had been crossed to the cytokine-reporter mice 4get (IL-4) and yeti (IFN-{gamma}) (14, 20). The potential to produce IL-4 and IFN-{gamma} was assessed by the respective induction of eGFP and eYFP in CD4 T cells from these mice. Naive DO11.10 4get/yeti CD4+ T cells were cultured with eYFP+ and eYFP BMDC in the presence of cognate Ag. T cells stimulated by p40-expressing BMDC exhibited a 2- to 3-fold greater capacity to generate IFN-{gamma}, compared with T cells cultured with eYFP DC (Fig. 6, b and c). No significant IL-4 production was observed in either culture condition (data not shown). Interestingly, the greater capacity to generate Th1 cells in cultures containing eYFP+ BMDC was not due to higher levels of IL-12 protein, because the same trend was observed when anti-IL-12 Ab was added to the cultures (Fig. 6c). These findings are consistent with previous studies indicating that the activation state of the APC is a critical factor in determining the cytokine potential of CD4 T cells during the early stages of T cell differentiation (25).


Figure 6
View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 6. Competency for early IFN-{gamma} by naive CD4+ T cells is dependent on the activation state of CpG-stimulated BMDC but is independent from IL-12 protein production. BMDC from yet40 mice were stimulated for 16 h with or without CpG. a, Expression of CD40, CD80, CD86, and I-Ad was analyzed on CD11c+, eYFP (unstimulated, filled histogram; CpG-stimulated, dashed histogram) and eYFP+ (CpG stimulated, open histogram) BMDC. BMDC, stimulated as described above, were sorted into CD11c+, eYFP+, and eYFP subsets and cultured with naive CD62Lhigh, GFP, YFP DO11.10 4get/yeti CD4+ T cells. Histograms are representative data from three independent experiments plated in duplicate or triplicate. b, IFN-{gamma} expression was assessed in naive DO11.10 4get/yeti CD4+ T cells after 3 days of in vitro culture with CpG-stimulated eYFP+ or eYFP BMDC in the presence (day 3) or absence (day 0) of OVA peptide. CD8{alpha}+ and DAPI+ events were excluded, and cells were gated on KJ1–26+, CD4+ cells. c, The percentage (±SD) of DO11.10 CD4+ T cells expressing eYFP after culture with CpG-stimulated eYFP+ DC ({blacksquare}), CpG-stimulated eYFP DC ({square}), and unstimulated eYFP DC ({cjs2108}) in the presence or absence of anti-IL-12 Ab. Data are representative of two independent experiments plated in triplicate.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
We describe the generation of IL-12/23 p40 reporter mice, designated yet40 and get40, by creating knockin bicistronic p40-IRES-eYFP and p40-IRES-eGFP alleles, respectively. The knockin marker approach provides several advantages over conventional cytokine detection systems, including the introduction of the marker into the endogenous locus to preserve cis-acting control elements and preservation of the cytokine itself. Despite evidence of monoallelic expression of cytokines in T cells, only biallelic expression of p40 was observed during activation of DC from mice expressing the two fluorescent markers from each p40 allele (36). Further studies will be required to determine whether the biallelic expression of p40 observed in macrophages and DC is a common feature of cytokine expression in these cell types. Importantly, the fluorescent marker protein was expressed coincident with p40 protein, and reliably marked DC and macrophages that secreted p40 protein in vitro and in vivo. In addition, the detection of eYFP and IL-12 protein in tissue sections in vivo was highly concordant, suggesting the eYFP/eGFP half-life is sufficiently close to the half-life of IL-12 protein such that reliable identification of p40-secreting cells can be achieved.

In accordance to what has been observed with chemokines, an intriguing observation was the localization of IL-12 protein near activated DC at the abluminal surface around HEV. Accumulation of IL-12 at this location may ensure its positioning at sites where naive T cells will encounter activated DC, express IL-12 receptors, and be stimulated to differentiate toward the Th1, IFN-{gamma}-producing subset (37). IL-12 is required to up-regulate the core acetylglucosaminyltransferase necessary to generate functional PSGL-1, a P-selectin ligand essential for the immigration of Th1 cells to inflammatory sites in the periphery (38, 39). Although cytokines such as IFN-{gamma} have been implicated in HEV function, it remains to be examined whether DC, which traffic to the abluminal HEV in lymph nodes, might contribute to maintenance of basal PNAd expression, through elaboration of IL-12, IL-23, or other cytokines (40, 41, 42).

An important advantage of these mice is the capacity to isolate and purify fluorescent cells that have been marked functionally by their production of IL-12/IL-23 p40, without the need for further manipulation. Expression of p40 correlated with increased levels of MHC class II and costimulatory molecules, markers of mature activated DC, and p40-expressing cells possessed the capacity to drive naive T cells into proliferative cycles in vitro and in vivo. Additionally, these cells, after passive transfer, demonstrated greater efficiency in trafficking to lymph nodes in vivo, and the expression of p40 also correlated with the ability of BMDC to drive Th1 differentiation. Thus, p40 expression reflects the level of DC activation in these mice. Of interest, many of the activities of p40-expressing cells, including emigration kinetics in vivo and activation of naive T cells, were independent of heterodimeric p35/p40 IL-12 cytokine, because cells from mice crossed onto the p35-deficient background or treated with anti-IL-12 Ab shared these activities. Thus, these data indicate that the enhanced costimulation conferred upon the T cells by p40-expressing BMDC can compensate for IL-12p70 and plays an important role in early differentiation toward IFN-{gamma} production. This idea is consistent with a model where the cytokine milieu plays a greater role in commitment and stabilization of T cell fate rather then directing its early differentiation. It is possible that IL-23 or p40 homodimers are compensating for the lack of IL-12 in this system; however, this appears unlikely because of recent evidence suggesting its involvement in the stabilization of IL-17 producing cells (43, 44, 45). Collectively, these results indicate that the IL-12/23 p40 promoter, which integrates a number of activating signal cascades, constitutes a reliable biological sensor for the activated DC phenotype.

Our kinetic studies of p40 expression in vivo revealed the appearance of a novel CD8{alpha} DC subset that is not present under unimmunized conditions. This population peaks around 12–16 h after LPS injection or 48 h after Listeria inoculation, correlating with the second wave of activated DC in draining lymph nodes indicated by prior studies (32, 34). In those studies, the second wave represents emigration from sites of Ag deposition, as opposed to the first wave, which represents activation of resident DC in the lymph node, presumably in response to soluble Ags and cytokines arriving via afferent lymphatics. Data here suggest that the p40-expressing CD8{alpha} DC are emigrating from the skin, as established by their sensitivity to pertussis toxin, which blocks chemotaxis. Further, expression of CD8{alpha} is consistent with the surface phenotypes of activated dermal DC and Langerhans cells, which can be induced to express CD8{alpha} (46). Our finding that p40-expression is linked to an immigrating DC population helps to explain why the second wave is required to develop a delayed-type hypersensitivity response and establishes a critical requirement for these cells in promoting T cell-mediated effector immune function. Indeed, these findings are in agreement with recent reports suggesting that CD8{alpha}+ DC are critical for generating Th1 cells and CTLs (33, 47, 48). Although these experiments clearly show that p40-expressing DC are important in T cell activation, further study is required to identify the specific roles that IL-12 and IL-23 are playing in vivo. This remains an important area of research because of the divergent biological outcomes associated with these two cytokines.

Using a number of phenotypic and functional criteria, we have identified a DC subpopulation responsible for activation of adaptive immunity within the skin-draining lymph nodes. These mice should prove invaluable in understanding how signals become efficiently transferred from innate to adaptive cells in activating effector/memory functions of the vertebrate immune system important to infectious diseases, vaccine efficacy, tumor immunity, and screening of novel compounds that can act as adjuvants to promote more effective immune responses (49).


    Acknowledgments
 
The authors thank T. Yoshimoto (University of Tokyo, Tokyo, Japan), M. Mohrs (Trudeau Institute, Saranac Lake, NY), and S. Rosen (University of California, San Francisco, CA) for reagents; M. Krummel (University of California, San Francisco, CA), L. Fong (University of California, San Francisco), and T. Petro (University of Nebraska Medical Center, College of Dentistry, Lincoln, NE) for reviewing the manuscript; and N. Flores, L. Stowring, and C. McArthur for expert technical assistance.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Grant AI30663 from the National Institutes of Allergy and Infectious Diseases and the Howard Hughes Medical Institute. R.M.L. is a Senior Scholar of the Ellison Medical Foundation for Global Infectious Diseases. S.H. was supported by Korea Research Foundation Grant R08-2003-000-10915-0 and Nanobioresearch and Development Program Grant M10416020001-05N1602-00130 from the Ministry of Science and Technology. R.L.R. is a Juvenile Diabetes Research Foundation-Irvington Institute Fellow. S.-J.K. is a Cancer Research Institute Fellow. Back

2 R.L.R. and S.H. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Richard M. Locksley, University of California, 513 Parnassus Avenue, Room S1004, San Francisco, CA 94143-0795. E-mail address: locksley{at}medicine.ucsf.edu Back

4 Abbreviations used in this paper: DC, dendritic cell; IRES, internal ribosome entry site; BMDC, bone marrow-derived DC; BMpDC, BM-derived plasmacytoid IFN-producing DC; VEGFR-III, vascular endothelial growth factor receptor III; HEV, high endothelial venule; DAPI, 4',6'-diamidine-2'-phenylindole dihydrochloride; ES, embryonic stem; CMTMR, 5-(and -6)-(((4-chloromethyl)benzoyl)amino)tetramethylrhodamine. Back

Received for publication January 31, 2006. Accepted for publication May 5, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Trinchieri, G.. 2003. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat. Rev. Immunol. 3: 133-146. [Medline]
  2. Perussia, B., S. H. Chan, A. D’Andrea, K. Tsuji, D. Santoli, M. Pospisil, D. Young, S. F. Wolf, G. Trinchieri. 1992. Natural killer (NK) cell stimulatory factor or IL-12 has differential effects on the proliferation of TCR-{alpha}beta+: TCR-{gamma}{delta}+ T lymphocytes, and NK cells. J. Immunol. 149: 3495-3502. [Abstract]
  3. Robinson, D., K. Shibuya, A. Mui, F. Zonin, E. Murphy, T. Sana, S. B. Hartley, S. Menon, R. Kastelein, F. Bazan, A. O’Garra. 1997. IGIF does not drive Th1 development but synergizes with IL-12 for interferon-{gamma} production and activates IRAK and NF-{kappa}B. Immunity 7: 571-581. [Medline]
  4. Yang, J., T. L. Murphy, W. Ouyang, K. M. Murphy. 1999. Induction of interferon-{gamma} production in Th1 CD4+ T cells: evidence for two distinct pathways for promoter activation. Eur. J. Immunol. 29: 548-555. [Medline]
  5. Lertmemongkolchai, G., G. Cai, C. A. Hunter, G. J. Bancroft. 2001. Bystander activation of CD8+ T cells contributes to the rapid production of IFN-{gamma} in response to bacterial pathogens. J. Immunol. 166: 1097-1105. [Abstract/Free Full Text]
  6. Hsieh, C. S., S. E. Macatonia, C. S. Tripp, S. F. Wolf, A. O’Garra, K. M. Murphy. 1993. Development of TH1 CD4+ T cells through IL-12 produced by Listeria-induced macrophages. Science 260: 547-549. [Abstract/Free Full Text]
  7. Macatonia, S. E., N. A. Hosken, M. Litton, P. Vieira, C. S. Hsieh, J. A. Culpepper, M. Wysocka, G. Trinchieri, K. M. Murphy, A. O’Garra. 1995. Dendritic cells produce IL-12 and direct the development of Th1 cells from naive CD4+ T cells. J. Immunol. 154: 5071-5079. [Abstract]
  8. Oppmann, B., R. Lesley, B. Blom, J. C. Timans, Y. Xu, B. Hunte, F. Vega, N. Yu, J. Wang, K. Singh, et al 2000. Novel p19 protein engages IL-12p40 to form a cytokine. IL-23, with biological activities similar as well as distinct from IL-12. Immunity 13: 715-725. [Medline]
  9. Murphy, C. A., C. L. Langrish, Y. Chen, W. Blumenschein, T. McClanahan, R. A. Kastelein, J. D. Sedgwick, D. J. Cua. 2003. Divergent pro- and anti-inflammatory roles for IL-23 and IL-12 in joint autoimmune inflammation. J. Exp. Med. 198: 1951-1957. [Abstract/Free Full Text]
  10. Lankford, C. S., D. M. Frucht. 2003. A unique role for IL-23 in promoting cellular immunity. J. Leukocyte Biol. 73: 49-56. [Abstract/Free Full Text]
  11. Kamath, A. T., S. Henri, F. Battye, D. F. Tough, K. Shortman. 2002. Developmental kinetics and lifespan of dendritic cells in mouse lymphoid organs. Blood 100: 1734-1741. [Abstract/Free Full Text]
  12. Ruedl, C., P. Koebel, M. Bachmann, M. Hess, K. Karjalainen. 2000. Anatomical origin of dendritic cells determines their life span in peripheral lymph nodes. J. Immunol. 165: 4910-4916. [Abstract/Free Full Text]
  13. Garg, S., A. Oran, J. Wajchman, S. Sasaki, C. H. Maris, J. A. Kapp, J. Jacob. 2003. Genetic tagging shows increased frequency and longevity of antigen-presenting, skin-derived dendritic cells in vivo. Nat. Immunol. 4: 907-912. [Medline]
  14. Mohrs, M., K. Shinkai, K. Mohrs, R. M. Locksley. 2001. Analysis of type 2 immunity in vivo with a bicistronic IL-4 reporter. Immunity 15: 303-311. [Medline]
  15. Barnden, M. J., J. Allison, W. R. Heath, F. R. Carbone. 1998. Defective TCR expression in transgenic mice constructed using cDNA-based {alpha}- and beta-chain genes under the control of heterologous regulatory elements. Immunol. Cell Biol. 76: 34-40. [Medline]
  16. Yoshimoto, T., K. Kojima, T. Funakoshi, Y. Endo, T. Fujita, H. Nariuchi. 1996. Molecular cloning and characterization of murine IL-12 genes. J. Immunol. 156: 1082-1088. [Abstract]
  17. Gu, H., Y. R. Zou, K. Rajewsky. 1993. Independent control of immunoglobulin switch recombination at individual switch regions evidenced through Cre-loxP-mediated gene targeting. Cell 73: 1155-1164. [Medline]
  18. O’Gorman, S., N. A. Dagenais, M. Qian, Y. Marchuk. 1997. Protamine-Cre recombinase transgenes efficiently recombine target sequences in the male germ line of mice, but not in embryonic stem cells. Proc. Natl. Acad. Sci. USA 94: 14602-14607. [Abstract/Free Full Text]
  19. Alferink, J., I. Lieberam, W. Reindl, A. Behrens, S. Weiss, N. Huser, K. Gerauer, R. Ross, A. B. Reske-Kunz, P. Ahmad-Nejad, et al 2003. Compartmentalized production of CCL17 in vivo: strong inducibility in peripheral dendritic cells contrasts selective absence from the spleen. J. Exp. Med. 197: 585-599. [Abstract/Free Full Text]
  20. Stetson, D. B., M. Mohrs, R. L. Reinhardt, J. L. Baron, Z. E. Wang, L. Gapin, M. Kronenberg, R. M. Locksley. 2003. Constitutive cytokine mRNAs mark natural killer (NK) and NK T cells poised for rapid effector function. J. Exp. Med. 198: 1069-1076. [Abstract/Free Full Text]
  21. Lauvau, G., S. Vijh, P. Kong, T. Horng, K. Kerksiek, N. Serbina, R. A. Tuma, E. G. Pamer. 2001. Priming of memory but not effector CD8 T cells by a killed bacterial vaccine. Science 294: 1735-1739. [Abstract/Free Full Text]
  22. Jiang, H. R., E. Muckersie, M. Robertson, H. Xu, J. Liversidge, J. V. Forrester. 2002. Secretion of interleukin-10 or interleukin-12 by LPS-activated dendritic cells is critically dependent on time of stimulus relative to initiation of purified DC culture. J. Leukocyte Biol. 72: 978-985. [Abstract/Free Full Text]
  23. Schulz, O., A. D. Edwards, M. Schito, J. Aliberti, S. Manickasingham, A. Sher, C. Reis e Sousa. 2000. CD40 triggering of heterodimeric IL-12 p70 production by dendritic cells in vivo requires a microbial priming signal. Immunity 13: 453-462. [Medline]
  24. Gilliet, M., A. Boonstra, C. Paturel, S. Antonenko, X. L. Xu, G. Trinchieri, A. O’Garra, Y. J. Liu. 2002. The development of murine plasmacytoid dendritic cell precursors is differentially regulated by FLT3-ligand and granulocyte/macrophage colony-stimulating factor. J. Exp. Med. 195: 953-958. [Abstract/Free Full Text]
  25. Boonstra, A., C. Asselin-Paturel, M. Gilliet, C. Crain, G. Trinchieri, Y. J. Liu, A. O’Garra. 2003. Flexibility of mouse classical and plasmacytoid-derived dendritic cells in directing T helper type 1 and 2 cell development: dependency on antigen dose and differential toll-like receptor ligation. J. Exp. Med. 197: 101-109. [Abstract/Free Full Text]
  26. Gretz, J. E., C. C. Norbury, A. O. Anderson, A. E. Proudfoot, S. Shaw. 2000. Lymph-borne chemokines and other low molecular weight molecules reach high endothelial venules via specialized conduits while a functional barrier limits access to the lymphocyte microenvironments in lymph node cortex. J. Exp. Med. 192: 1425-1440. [Abstract/Free Full Text]
  27. Miyasaka, M., T. Tanaka. 2004. Lymphocyte trafficking across high endothelial venules: dogmas and enigmas. Nat. Rev. Immunol. 4: 360-370. [Medline]
  28. Ohl, L., M. Mohaupt, N. Czeloth, G. Hintzen, Z. Kiafard, J. Zwirner, T. Blankenstein, G. Henning, R. Forster. 2004. CCR7 governs skin dendritic cell migration under inflammatory and steady-state conditions. Immunity 21: 279-288. [Medline]
  29. Hochrein, H., K. Shortman, D. Vremec, B. Scott, P. Hertzog, M. O’Keeffe. 2001. Differential production of IL-12, IFN-{alpha}, and IFN-{gamma} by mouse dendritic cell subsets. J. Immunol. 166: 5448-5455. [Abstract/Free Full Text]
  30. Maldonado-Lopez, R., T. De Smedt, P. Michel, J. Godfroid, B. Pajak, C. Heirman, K. Thielemans, O. Leo, J. Urbain, M. Moser. 1999. CD8{alpha}+ and CD8{alpha} subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J. Exp. Med. 189: 587-592. [Abstract/Free Full Text]
  31. Reis e Sousa, C., S. Hieny, T. Scharton-Kersten, D. Jankovic, H. Charest, R. N. Germain, A. Sher. 1997. In vivo microbial stimulation induces rapid CD40 ligand-independent production of interleukin 12 by dendritic cells and their redistribution to T cell areas. J. Exp. Med. 186: 1819-1829. [Abstract/Free Full Text]
  32. Itano, A. A., S. J. McSorley, R. L. Reinhardt, B. D. Ehst, E. Ingulli, A. Y. Rudensky, M. K. Jenkins. 2003. Distinct dendritic cell populations sequentially present antigen to CD4 T cells and stimulate different aspects of cell-mediated immunity. Immunity 19: 47-57. [Medline]
  33. Allan, R. S., C. M. Smith, G. T. Belz, A. L. van Lint, L. M. Wakim, W. R. Heath, F. R. Carbone. 2003. Epidermal viral immunity induced by CD8{alpha}+ dendritic cells but not by Langerhans cells. Science 301: 1925-1928. [Abstract/Free Full Text]
  34. Misslitz, A. C., K. Bonhagen, D. Harbecke, C. Lippuner, T. Kamradt, T. Aebischer. 2004. Two waves of antigen-containing dendritic cells in vivo in experimental Leishmania major infection. Eur. J. Immunol. 34: 715-725. [Medline]
  35. Shah, J. A., P. A. Darrah, D. R. Ambrozak, T. N. Turon, S. Mendez, J. Kirman, C. Y. Wu, N. Glaichenhaus, R. A. Seder. 2003. Dendritic cells are responsible for the capacity of CpG oligodeoxynucleotides to act as an adjuvant for protective vaccine immunity against Leishmania major in mice. J. Exp. Med. 198: 281-291. [Abstract/Free Full Text]
  36. Smale, S. T., A. G. Fisher. 2002. Chromatin structure and gene regulation in the immune system. Annu. Rev. Immunol. 20: 427-462. [Medline]
  37. Bajenoff, M., S. Granjeaud, S. Guerder. 2003. The strategy of T cell antigen-presenting cell encounter in antigen-draining lymph nodes revealed by imaging of initial T cell activation. J. Exp. Med. 198: 715-724. [Abstract/Free Full Text]
  38. Lim, Y. C., H. Xie, C. E. Come, S. I. Alexander, M. J. Grusby, A. H. Lichtman, F. W. Luscinskas. 2001. IL-12. STAT4-dependent up-regulation of CD4+ T cell core 2beta-1,6-N-acetylglucosaminyltransferase, an enzyme essential for biosynthesis of P-selectin ligands. J. Immunol. 167: 4476-4484. [Abstract/Free Full Text]
  39. Blander, J. M., I. Visintin, C. A. Janeway, Jr, R. Medzhitov. 1999. {alpha}-(1,3)-Fucosyltransferase VII and {alpha}(2,3)-sialyltransferase IV are up-regulated in activated CD4 T cells and maintained after their differentiation into Th1 and migration into inflammatory sites. J. Immunol. 163: 3746-3752. [Abstract/Free Full Text]
  40. Twisk, A. J., P. H. Groeneveld, G. Kraal. 1988. The effects of bacterial lipopolysaccharide (LPS) on high endothelial venules and interdigitating cells in mouse lymph nodes. Immunobiology 176: 410-422. [Medline]
  41. Manolios, N., C. L. Geczy, L. Schrieber. 1988. High endothelial venule morphology and function are inducible in germ-free mice: a possible role for interferon-{gamma}. Cell. Immunol. 117: 136-151. [Medline]
  42. Chin, Y. H., J. P. Cai, K. Johnson. 1990. Lymphocyte adhesion to cultured Peyer’s patch high endothelial venule cells is mediated by organ-specific homing receptors and can be regulated by cytokines. J. Immunol. 145: 3669-3677. [Abstract]
  43. Harrington, L. E., R. D. Hatton, P. R. Mangan, H. Turner, T. L. Murphy, K. M. Murphy, C. T. Weaver. 2005. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat. Immunol. 6: 1123-1132. [Medline]
  44. Park, H., Z. Li, X. O. Yang, S. H. Chang, R. Nurieva, Y. H. Wang, Y. Wang, L. Hood, Z. Zhu, Q. Tian, C. Dong. 2005. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat. Immunol. 6: 1133-1141. [Medline]
  45. Veldhoen, M., R. J. Hocking, C. J. Atkins, R. M. Locksley, B. Stockinger. 2006. TGF-beta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity 24: 179-189. [Medline]
  46. Henri, S., D. Vremec, A. Kamath, J. Waithman, S. Williams, C. Benoist, K. Burnham, S. Saeland, E. Handman, K. Shortman. 2001. The dendritic cell populations of mouse lymph nodes. J. Immunol. 167: 741-748. [Abstract/Free Full Text]
  47. Lemos, M. P., F. Esquivel, P. Scott, T. M. Laufer. 2004. MHC class II expression restricted to CD8{alpha}+ and CD11b+ dendritic cells is sufficient for control of Leishmania major. J. Exp. Med. 199: 725-730. [Abstract/Free Full Text]
  48. Belz, G. T., C. M. Smith, D. Eichner, K. Shortman, G. Karupiah, F. R. Carbone, W. R. Heath. 2004. Cutting edge: conventional CD8{alpha}+ dendritic cells are generally involved in priming CTL immunity to viruses. J. Immunol. 172: 1996-2000. [Abstract/Free Full Text]
  49. Im, W., H. Kim, D. Yun, S. Y. Seo, S. H. Park, R. M. Locksley, S. Hong. 2005. Cytokine reporter mouse system for screening novel IL12/23 p40-inducing compounds. Mol. Cells 20: 288-296. [Medline]



This article has been cited by other articles:


Home page
Int ImmunolHome page
S. Kim, J. Y. Yang, K. Lee, K. H. Oh, M. Gi, J. M. Kim, D. J. Paik, S. Hong, and J. Youn
Bacillus subtilis-specific poly-{gamma}-glutamic acid regulates development pathways of naive CD4+ T cells through antigen-presenting cell-dependent and -independent mechanisms
Int. Immunol., August 1, 2009; 21(8): 977 - 990.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. G. Rothfuchs, J. G. Egen, C. G. Feng, L. R. V. Antonelli, A. Bafica, N. Winter, R. M. Locksley, and A. Sher
In Situ IL-12/23p40 Production during Mycobacterial Infection Is Sustained by CD11bhigh Dendritic Cells Localized in Tissue Sites Distinct from Those Harboring Bacilli
J. Immunol., June 1, 2009; 182(11): 6915 - 6925.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C.-H. Qiu, Y. Miyake, H. Kaise, H. Kitamura, O. Ohara, and M. Tanaka
Novel Subset of CD8{alpha}+ Dendritic Cells Localized in the Marginal Zone Is Responsible for Tolerance to Cell-Associated Antigens
J. Immunol., April 1, 2009; 182(7): 4127 - 4136.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Melli, R. S. Friedman, A. E. Martin, E. B. Finger, G. Miao, G. L. Szot, M. F. Krummel, and Q. Tang
Amplification of Autoimmune Response through Induction of Dendritic Cell Maturation in Inflamed Tissues
J. Immunol., March 1, 2009; 182(5): 2590 - 2600.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
H. K. Lee, M. Zamora, M. M. Linehan, N. Iijima, D. Gonzalez, A. Haberman, and A. Iwasaki
Differential roles of migratory and resident DCs in T cell priming after mucosal or skin HSV-1 infection
J. Exp. Med., February 16, 2009; 206(2): 359 - 370.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. Louvet, G. L. Szot, J. Lang, M. R. Lee, N. Martinier, G. Bollag, S. Zhu, A. Weiss, and J. A. Bluestone
Tyrosine kinase inhibitors reverse type 1 diabetes in nonobese diabetic mice
PNAS, December 2, 2008; 105(48): 18895 - 18900.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. T. Robinson, S. A. Khader, R. M. Locksley, E. Lien, S. T. Smiley, and A. M. Cooper
Yersinia pestis Evades TLR4-dependent Induction of IL-12(p40)2 by Dendritic Cells and Subsequent Cell Migration
J. Immunol., October 15, 2008; 181(8): 5560 - 5567.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
H. Bouabe, R. Fassler, and J. Heesemann
Improvement of reporter activity by IRES-mediated polycistronic reporter system
Nucleic Acids Res., March 1, 2008; 36(5): e28 - e28.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
S. L. Reiner, F. Sallusto, and A. Lanzavecchia
Division of Labor with a Workforce of One: Challenges in Specifying Effector and Memory T Cell Fate
Science, August 3, 2007; 317(5838): 622 - 625.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
B. Elliott, R. A. Scolyer, S. Suciu, S. Lebecque, D. Rimoldi, O. Gugerli, E. Musat, R. N. Sharma, D. Lienard, U. Keilholz, et al.
Long-Term Protective Effect of Mature DC-LAMP+ Dendritic Cell Accumulation in Sentinel Lymph Nodes Containing Micrometastatic Melanoma
Clin. Cancer Res., July 1, 2007; 13(13): 3825 - 3830.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
E Toubi, A Kessel, G Slobodin, N Boulman, E Pavlotzky, D Zisman, M Rozenbaum, and I Rosner
Changes in macrophage function after rituximab treatment in patients with rheumatoid arthritis
Ann Rheum Dis, June 1, 2007; 66(6): 818 - 820.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. T. Shamshiev, F. Ampenberger, B. Ernst, L. Rohrer, B. J. Marsland, and M. Kopf
Dyslipidemia inhibits Toll-like receptor-induced activation of CD8{alpha}-negative dendritic cells and protective Th1 type immunity
J. Exp. Med., February 19, 2007; 204(2): 441 - 452.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reinhardt, R. L.
Right arrow Articles by Locksley, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reinhardt, R. L.
Right arrow Articles by Locksley, R. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS