The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gursel, M.
Right arrow Articles by Klinman, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gursel, M.
Right arrow Articles by Klinman, D. M.
The Journal of Immunology, 2006, 177: 1575-1580.
Copyright © 2006 by The American Association of Immunologists

CXCL16 Influences the Nature and Specificity of CpG-Induced Immune Activation1,2

Mayda Gursel3, Ihsan Gursel3, Howard S. Mostowski and Dennis M. Klinman4

Section of Retroviral Research, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Unmethylated CpG motifs are present at high frequency in bacterial DNA. They provide a danger signal to the mammalian immune system that triggers a protective immune response characterized by the production of Th1 and proinflammatory cytokines and chemokines. Although the recognition of CpG DNA by B cells and plasmacytoid dendritic cells is mediated by TLR 9, these cell types differ in their ability to bind and respond to structurally distinct classes of CpG oligonucleotides. This work establishes that CXCL16, a membrane-bound scavenger receptor, influences the uptake, subcellular localization, and cytokine profile induced by D oligonucleotides. This is the first example of a surface receptor modifying the cellular specificity and nature of the immune response mediated by an intracellular TLR.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
B lymphocytes and plasmacytoid dendritic cells (pDC)5 play key roles in protecting the host from bacterial infection. Both cell types express TLR9, a pattern-recognition molecule that contributes to the detection of unmethylated CpG motifs present at high frequency in bacterial DNA (1, 2, 3). Synthetic oligonucleotides (ODN) that express CpG motifs mimic the immunostimulatory activity of bacterial DNA and have shown efficacy in clinical trials as immunoprotective agents, vaccine adjuvants, and/or for cancer therapy (4, 5, 6).

Several structurally distinct classes of CpG ODN have been identified that differentially activate pDC vs B cells (7, 8). D class ODN (also referred to as A class (7, 8, 9), contain a single palindromic CpG motif linked to a poly(G) tail at the 3' end. D ODN trigger pDCs to produce high levels of IFN-{alpha} but fail to stimulate B cells (9, 10). K-class ODN, referred to as B class by some investigators (7, 11, 12, 13), typically express multiple CpG motifs but lack a poly(G) tail. K ODN stimulate B cells to produce IgM and IL-6 while triggering pDC to produce TNF-{alpha} rather than IFN-{alpha} (7, 8, 11, 12, 13). Despite these differences in cellular specificity and functional activity, both K- and D-class CpG ODN are recognized by the same intracytoplasmic receptor (TLR 9) and signal through a conserved TLR9–MyD88 pathway (14). Neither the mechanism underlying the differential cellular specificity of D vs K ODN, nor their distinct functional effects, have been elucidated. In this study, we show that these differences can be attributed to CXCL16, a scavenger receptor expressed on human pDC but not B cells, that selectively recognizes and mediates the subcellular localization of D ODN.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Reagents

Endotoxin-free ODN were synthesized at the Center for Biolgoics Evaluation and Research core facility (Bethesda, MD). Sequences of ODN used (5'->3') were: K3, ATCGACTCTCGAGCGTTCTC; K3-flip, ATGCACTCTGCAGGCTTCTC; K23, TCGAGCGTTCTC; K24, TCGTTCGTGTTCT; D19, GgtgcatcgatgcagGGGGG; D29, GgtgcacggtgcagGGGG; D35, GGtgcatcgatgcaggggGG; D no poly(G), GGtgcttcgatgcaaaaaAA and D3CG, GGtcgatcgatcgaggggGG. Bases shown in capital letters are phosphorothioate, and those in lower case are phosphodiester. Note that control ODN maintained the structure and phosphorothioate composition of CpG ODN. FITC or Cy3 was conjugated to the 5' end of some ODN. FITC- and PE-conjugated BDCA-2 and BDCA-4 magnetic cell isolation kits were purchased from Miltenyi Biotec. All other FITC-, PE-, and PE-Cy5-conjugated Abs were purchased from BD Pharmingen.

Polyclonal goat anti-human CXCL16 (purified and biotin labeled) and matching affinity-purified isotype control goat IgG were obtained from R&D Systems. The CXCL16 encoding plasmid was obtained from InvivoGen. Fucoidan and chondroitin sulfate were purchased from Sigma-Aldrich, GM6001 from Calbiochem, and O-sialoglycoprotein endopeptidase from Cedarlane Laboratories. LysoTracker Green and AlexaFluor 488-conjugate transferrin were purchased from Molecular Probes.

Cells and cell cultures

PBMCs and elutriated monocytes (2–4 x 106/ml) from normal donors were obtained from the National Institutes of Health Department of Transfusion Medicine (Bethesda, MD). These were cultured in RPMI 1640 medium containing 5% FCS, 50 U/ml penicillin, 50 µg/ml streptomycin, 0.3 µg/ml L-glutamine, 1 µM nonessential amino acids, 1 µM sodium pyruvate, 10 mM HEPES, and 10–5 M 2-ME. Cells were stimulated with 1–3 µM ODN. Surface protein expression was modified/blocked by treating cells with 50 µM GM6001, 25 µg/ml O-sialoglycoprotein endopeptidase (from Pasteurella hemolytica), or 50 µg/ml dextran sulfate, fucoidan, or chondroitin sulfate for 30 min at 37°C.

HEK293 cells and stably transfected HEK293 cells expressing hTLR9 were maintained in complete DMEM (10% FCS) medium as described previously (2). In some experiments, anti-CXCL16 or its isotype control were added to cells at a final concentration of 25 µg/ml. ODN binding was analyzed after 1 h, while changes in cytokine production and cell surface marker expression were examined after 4–48 h.

Flow cytometric analysis

Cells were washed in cold PBS and then fixed and stained with CD19 (B cells) or CD123 plus BDCA-2 (pDC) as described previously (10). Data (20,000–50,000 events) were obtained using a FACSCalibur flow cytometer (BD Biosciences) and analyzed using CellQuest software (BD Biosciences).

ELISA

The 96-well microtiter plates (Millipore) were coated with Abs that recognize human IFN-{alpha}, TNF-{alpha}, IL-6, or IFN-{gamma}-inducible protein 10 (10). The plates were blocked with PBS-5% BSA. Supernatants from cultured cells were added, and their cytokine content quantitated by the addition of biotin-labeled anti-cytokine Ab followed by phosphatase-conjugated avidin and phosphatase-specific colorimeteric substrate. Standard curves were generated using known amounts of recombinant human cytokine. All assays were performed in duplicate.

TLR9 assay

A total of 5 x 104 cells was transfected using FuGENE 6 (Roche) plus 0.5 µg of p5xNF-{kappa}B-luc (both from Stratagene) and/or 1 µg of a CXCL16 expression vector for 24 h as described previously (2). Following stimulation with ODN for 24 h, NF-{kappa}B activation was determined using the luciferase assay as recommended by the manufacturer (Promega).

Confocal microscopy

CXCL16 or mock-transfected HEK293 cells expressing hTLR9 were incubated with 3 µM FITC-conjugated CpG ODN at 37°C for 20' and then stained for CXCL16 expression. To assess the subcellular distribution of ODN, cells were incubated with 3 µM Cy3-CpG ODN at 37°C for 60' together with 1 µM LysoTracker-Green (marker for the lysosomal compartment) or 20 µg/ml transferrin-AlexaFluor 488 conjugate (marker for early endosomes). All samples were then analyzed using a confocal microscope under a x63 objective (Zeiss).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
D ODN activity is influenced by modifications of the pDC membrane

Previous studies established that TLR9 alone is sufficient to confer cellular responsiveness to K but not to D ODN. For example, HEK293 cells became responsive to K but not D ODN when transfected to express TLR9 (8, 15). We postulated that a cell surface receptor might contribute to the recognition of D ODN. To evaluate this possibility, pDC were treated with O-sialoglycoprotease (which digests membrane-bound receptors) or GM6001 (which stabilizes membrane-bound molecules). Consistent with our hypothesis, O-sialoglycoprotease significantly reduced D ODN mediated pDC activation, while GM6001 significantly increased this response (p < 0.05 for both parameters; Fig. 1A). Neither treatment had any effect on the stimulatory activity of K ODN, nor did an excess of K ODN block D ODN binding (Fig. 1B). Taken together, these findings suggested that a molecule on the surface of pDC contributed to the recognition of D ODN but not of K ODN.


Figure 1
View larger version (37K):
[in this window]
[in a new window]
  		FIGURE 1. D ODN activity is influenced by treatments that alter the cell surface proteins. A, PBMC from three to six donors were treated with 50 M GM6001 or 25 g/ml O-sialoglycoprotein endopeptidase for 30 min at 37°C. The cells were then stimulated with 3 µM D ODN or 1 µM K ODN for 24 h and cytokine production monitored by ELISA. The change in cytokine levels was calculated for each donor independently, and then averaged. B, Purified pDC were incubated with 50 g/ml the SR ligands dextran sulfate (DS) or fucoidan or a 50-fold molar excess of cold-competitor ODN. Chondroitin sulfate (CS) was included as a negative control. The binding of 1 µM FITC-conjugated ODN was monitored by flow cytometry. Results represent the mean ± SD of three independent experiments. C, Purified pDC were stimulated with K or D ODN with or without dextran sulfate. Up-regulation of HLA-DR and CD54 expression was analyzed by FACS. Note that dextran sulfate significantly reduced the ability of D, but not, K ODN to up-regulate HLA-DR/CD54 expression. *, p < 0.05.

 
ODN of the D class are characterized by their expression of a 3' poly(G) tail (7, 8, 9). Previous studies showed that removing this tail reduced the binding and abrogated the stimulatory interaction of D ODN with target cells (7, 16, 17, 18). Because members of the scavenger family of surface receptors are known to bind molecules expressing poly(G) motifs (19, 20), we examined whether ligands that block scavenger receptors (SR) might inhibit D ODN-mediated cellular activation. As seen in Fig. 1B, two different SR ligands, dextran sulfate and fucoidan, significantly reduced D ODN binding to pDC (p < 0.01). Dextran sulfate also inhibited the ability of D ODN to up-regulate HLA-DR/CD54 expression by pDCs (Fig 1C). These SR ligands had no effect on the binding or activity of K ODN (which do not express a poly(G) tail).

CXCL16 enhances the uptake and stimulatory activity of D ODN

CXCL16 is a scavenger receptor when expressed on the surface of pDCs and acts as a chemokine when proteolytically cleaved and released into the circulation (21, 22, 23, 24, 25, 26, 27). Based on the finding that SR ligands block the recognition of D ODN, we examined whether CXCL16 played a role in D ODN uptake. In vitro studies showed that recombinant purified CXCL16 bound to various D-type ODN in a dose-dependent manner but did not bind to K ODNs (p < 0.001, Fig. 2a and data not shown). Consistent with a role for CXCL16 in D ODN binding, HEK293 cells transfected to express CXCL16 significantly improved their recognition of D but not K ODN (p < 0.001, Fig. 2b). Confocal microscopy of these transfected cells showed that the D ODN colocalized with CXCL16 on the cell surface (Fig. 2c).


Figure 2
View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 2. CXCL16 selectively interacts with D ODN. a, 0.04–1.0 µM biotin-conjugated K ({blacksquare}) or D ODN (•) were incubated on plates coated with anti-CXCL16 Ab (dashed lines) plus recombinant CXCL16 (dark lines). ODN binding was detected colorimetrically using phosphatase-conjugated avidin followed by K-Gold PNPT substrate. Results represent the average ± SD of three independent experiments. b, HEK293 cells were transfected to express CXCL16 and/or TLR9. Forty-eight hours later, cells were washed and incubated with 1 µM FITC-ODN for 10 min at 37°C. Mean fluorescence intensity (MFI) determined by flow cytometry is shown for mock-transfected cells (open bars), cells transfected with CXCL16 (black stripes), TLR9 (gray bars) or CXCL16 plus TLR9 (gray bars with black stripes). Results represent the mean ± SD of four independent experiments. c, CXCL16 transfected HEK293 cells were incubated with 3 µM FITC-conjugated CpG ODN (green) at 37°C for 20 min and then stained for CXCL16 expression (red). Confocal microscopy identifies the colocalization of ODN with CXCL16 (yellow). Results are representative of six independent experiments. *, p < 0.05; **, p < 0.01; Student’s t test.

 
The effect of CXCL16 expression on responsiveness to D and K ODN was then evaluated. Consistent with previous results, HEK 293 cells transfected with TLR9 alone gained responsiveness to K but not D ODN. This was reflected by a significant increase in their expression of NF-{kappa}B and secretion of IL-8 (p < 0.01, Fig. 3). In contrast, responsiveness to D ODN required that HEK293 cells be transfected to express both TLR9 and CXCL16 (p < 0.01, Fig. 3). Both the binding and activation of CXCL16 transfected cells were abrogated by removal of the poly(G) tail from the D ODN (Fig. 2b and data not shown). Taken together, these findings indicate that D ODN preferentially bind to cells that express CXCL16 but that cells must express both CXCL16 and TLR9 to become functionally responsive to D ODN.


Figure 3
View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 3. HEK293 cells (open bars) were transfected with p5xNF-{kappa}B-luc plus CXCL16 (black stripes), TLR9 (gray bars), or CXCL16 plus TLR9 (gray bars with black stripes). Cells were then stimulated with ODN for 24 h. a, NF-{kappa}B production was monitored by luciferase expression. Fold induction in NF-{kappa}B production over control ODN-treated samples is shown. b, IL-8 levels in culture supernatants were measured by ELISA. Data represent the average of three independent experiments. Similar results were obtained in studies of three different D and K ODN (see Materials and Methods for sequence data). **, p < 0.01, Student’s t test.

 
D ODN preferentially activate pDCs expressing CXCL16

FACS analysis of human PBMCs showed that 25–40% of pDC expressed CXCL16 on their surface, whereas B cells were CXCL16negative (Fig. 4). This pattern of CXCL16 expression (confirmed by RT-PCR analysis of mRNA from purified cell populations) paralleled the ability of D ODN to stimulate pDC but not B cells. It also raised the possibility that only those pDC that expressed CXCL16 might be responsive to D ODN. Consistent with such a possibility, CXCL16bright pDC were uniquely triggered by D ODN to secrete IFN-{alpha} (p < 0.001, Fig. 5). By comparison, both the CXCL16bright and CXCL16dull/negative pDC responded to K ODN by producing TNF-{alpha} (Fig. 5). Similar results were obtained when pDC were sort purified on the basis of CXCL16 expression: only the population enriched for CXCL16bright cells up-regulated HLA-DR/CD86 expression in response to D ODN whereas both CXCL16bright and CXCL16dull/negative populations responded to K ODN (Fig. 6).


Figure 4
View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 4. CXCL16 is present on the surface of pDCs but not B cells. PBMCs were stained with anti-CXCL16 or an isotype-matched control serum. pDCs were enriched from human PBMC using the BDCA-4 magnetic cell separation kit, and identified on the basis of CD123 and BDCA-2 expression. B cells were identified on the basis of CD19 expression. Cross-grids were established based on staining with the control serum. Data are representative of five independent experiments.

 

Figure 5
View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 5. D ODN selectively stimulate pDCs that express CXCL16. PBMCs were cultured with control, K, or D ODN in the presence of brefeldin A (10 g/ml) for 4.5 h (TNF-{alpha}) or 12 h (IFN-{alpha}, with brefeldin A being added after 8-h incubation). Intracytoplasmic staining was used to identify cells secreting TNF-{alpha} or IFN-{alpha}, while pDC were identified on the basis of size, CD123 and BDCA-2 expression. Cross-grids were established based on staining with the control serum. Results are representative of three independent experiments showing that CXCL16 expression influences pDC responsiveness to D ODN.

 

Figure 6
View larger version (44K):
[in this window]
[in a new window]
  		FIGURE 6. pDC lacking CXCL16 do not respond to D ODN. BDCA-2/CD123 double-positive pDC were sorted on the basis of CXCL16 expression. Sorting parameters were established to yield a CXCL16 negative population that was 99% pure, while enriching the CXCL16 positive population to 35%. Both populations were stimulated with K or D ODN for 24 h. Note that K ODN stimulated both populations to up-regulate expression of HLA-DR/CD86, while D ODN stimulated only that population containing CXCL16-positive pDC.

 
Anti-CXCL16 Ab blocks D ODN-mediated immune activation

pDC were stimulated with K or D ODN in the presence of 25 µg/ml polyclonal goat anti-human CXCL16 Ab. As seen in Table I, this treatment significantly reduced the binding and stimulatory activity of D ODN (p < 0.001). Isotype-matched control goat antiserum had no such effect, while anti-CXCL16 Abs did not reduce the binding or stimulation mediated by K ODN (Table I). These findings support the conclusion that CXCL16 recognizes and contributes to the activation mediated by D, but not K, ODN.


View this table:
[in this window]
[in a new window]
  		Table I. Anti-CXCL16 Ab selectively blocks the binding and activity of D ODN

 
CXCL16 alters the intracellular localization of D ODN

Although both classes of CpG ODN bind to and activate pDC, K ODN stimulate these cells to produce TNF-{alpha} whereas D ODN trigger them to secrete IFN-{alpha} (8, 9, 14). Recent findings demonstrate that TNF-{alpha} production dominates when CpG stimulation proceeds through the TLR9–MyD88–IRF5 pathway, whereas IFN-{alpha} production dominates when the TLR9–MyD88–IRF7 pathway is used (28, 29). Because the former pathway dominates in lysosomal vesicles and the latter in early endosomes (28, 29), we examined whether CXCL16 altered the intracellular localization of CpG ODN.

HEK293 cells stably transfected to express TLR9 were used to examine the effect of CXCL16 on D ODN internalization. As shown previously, K ODN accumulated in the lysosomal vesicles of these HEK293/TLR9 cells (Fig. 7). Neither the uptake nor localization of K ODN was affected by coexpression of CXCL16 (Fig. 7). In contrast, the presence of CXCL16 significantly altered the uptake and intracellular localization of D ODN (Fig. 7). In the absence of CXCL16, D ODN mimicked K ODN by trafficking to lysosomal vesicles. When CXCL16 was present, the uptake of D rose significantly, and the ODN then localized to transferrin-containing recycling endosomes (Fig. 7) (30).


Figure 7
View larger version (41K):
[in this window]
[in a new window]
  		FIGURE 7. Expression of CXCL16 by HEK293 cells stably transfected with TLR9 alters intracellular trafficking of D ODN. HEK293 cells stably transfected with TLR9 were mock transfected or transfected with CXCL16. Cells were incubated with Cy3-CpG ODN plus either the lysosomal marker LysoTracker-Green or the early endosomal marker transferrin-Alexa488 at 37°C. The localization of ODN in specific vesicles was determined after 60' by confocal microscopy.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
This work demonstrates that CXCL16, a receptor expressed on the surface of pDC, contributes to the binding, uptake, and stimulatory activity of D-type CpG ODN. This interaction resulted in the accumulation of D ODN in early endosomes rather than lysosomal vesicles, thereby altering the type of cytokine produced by activated pDC. In this context, the TLR9-MyD88 signaling pathway triggered by D ODN in early endosomes proceeds through IRF7 and culminates in the production of IFN-{alpha}, whereas the TLR9-MyD88 signaling pathway that occurs in lysosomal vesicles uses IRF5 and culminates in the production of TNF-{alpha} (28, 29). Our observation that CXCL16 impacts the intracellular localization of D ODN is supported by the recent work of Honda et al. (28) showing that K ODN localize to lysosomal vesicles whereas D ODN persist in early endosomal vesicles. The effect of ODN location on cytokine production is consistent with evidence that K ODN targeted to early endosomes (by encapsulation in DOTAP liposomes) trigger the production of IFN-{alpha} rather than TNF-{alpha} (28, 31, 32).

The observation that a cell surface receptor contributes to D ODN recognition is supported by several findings. 1) Treatment that inhibited the degradation of surface membrane proteins (GM6001) increased D mediated pDC activity, while digestion of membrane proteins (O-sialoglycoprotease) had the opposite effect (Fig. 1). Of note, GM6001 and O-sialoglycoprotease are known to modulate CXCL16 expression (23, 24, 26), with the magnitude of this effect being proportional to observed changes in D ODN-mediated pDC activation (data not shown). 2) The scavenger receptor ligands dextran sulfate and fucoidan selectively inhibited the pDC activation mediated by D but not K ODN (Fig. 1). 3) Both in vitro binding studies and in vivo confocal analysis indicated that CXCL16 interacted with D ODN (Fig. 2). 4) Transfection studies established that CXCL16 expression improved cellular uptake of D ODN, although activation required that cells express both CXCL16 and TLR9 (Fig. 3). 5) D ODN binding and activation were abrogated by the addition of anti-CXCL16 Ab (Table I). Finally, only those pDCs expressing CXCL16 were responsive to D ODN, whereas both CXCL16-positive and CXCL16-negative pDC responded to K ODN (Figs. 5 and 6). In all experiments, CXCL16 expression had no impact on the binding or activation mediated by K ODN, while control antiserum had no effect on D ODN-mediated cell activation.

An important distinction between CpG ODN classes is that D ODN uniquely express a poly(G) tail. Previous studies established that these poly(G) motifs contribute to the formation of higher-ordered structures (G-tetrads) via intermolecular Hoogsteen bonds (19, 20, 33, 34, 35). Although the molecular specificity of CXCL16 is not well known, a number of scavenger receptors recognize structures containing G-tetrads (19, 20, 34, 35). In this context, control ODNs lacking a poly(G) tail, but otherwise identical in sequence to stimulatory D ODNs, were unable to bind CXCL16 in vitro or stimulate pDCs in vivo (Fig. 2 and data not shown). These findings indicate that the poly(G) tail of D ODN may play an important role in CXCL16 recognition.

Cells of the innate immune system rely on a restricted number of germline encoded pattern recognition receptors (PRR) to detect invasive pathogens. Most PRRs are expressed on the cell surface, where they come into direct contact with circulating pathogens. Ancillary receptors have been described that improve pathogen recognition by surface bound TLRs (such as dectin-1 with TLR2 and CD36 with TRL2/6). However, these interactions do not alter the specificity of ligand binding or the nature of the ensuing immune response (36, 37, 38). In contrast, intracellular PRRs (e.g., TLRs 7–9) cannot directly sense circulating pathogens (39). In the case of TLR9, current findings indicate that this limitation can be overcome by an ancillary surface receptor. Results show that CXCL16 both improves the uptake of D ODN and directs them into endosomes rather than lysosomal vesicles, thereby shifting the response of pDC away from TNF-{alpha} and toward IFN-{alpha} production. Current findings demonstrate that CXCL16 contributes to the recognition of D ODN but do not exclude the possibility that other cell surface receptors contribute to the uptake of this or other TLR ligands.

In a broader context, these results indicate that ancillary membrane receptors can influence the cellular specificity, magnitude and nature of the immune response induced by TLR ligands. This could benefit the host by expanding the repertoire of responses generated by a limited number of highly conserved PRR. Because members of the TLR family must recognize and protect against a wide array of infectious pathogens, the possibility that TLR activity is modified by additional surface receptors has broad biologic implications.


   Acknowledgments
 
We thank Jacquelin Conover for technical assistance, and Drs. William Paul, Fred Steinberg, and Georgio Trinchieri for helpful comments on the manuscript.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
M. Gursel, I. Gursel, and D. M. Klinman are inventors on patents concerning the use of CpG DN and the influence of CXCL16. These patents are owned by the Food and Drug Administration, and some are licensed to Coley Pharmaceuticals.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by Military Interdepartmental Purchase Request MM8926, and is not subject to US copyright. Back

2 The assertions in this study are the private ones of the authors and are not to be construed as official or as reflecting the views of the Food and Drug Administration. Back

3 M.G. and I.G. contributed equally to this work. Back

4 Address correspondence and reprint requests to Dr. Dennis M. Klinman, Building 29A, Room 3D 10, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892. E-mail address: klinman{at}cber.fda.gov Back

5 Abbreviations used in this paper: pDC, plasmacytoid dendritic cell; ODN; oligonucleotide, SR; scavenger receptor; PRR, pattern-recognition receptor. Back

Received for publication February 15, 2006. Accepted for publication April 28, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Hemmi, H., O. Takeuchi, T. Kawai, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408: 740-745. [Medline]
  2. Takeshita, F., C. A. Leifer, I. Gursel, K. Ishii, S. Takeshita, M. Gursel, D. M. Klinman. 2001. Cutting edge: role of Toll-like receptor 9 in CpG DNA-induced activation of human cells. J. Immunol. 167: 3555-3558. [Abstract/Free Full Text]
  3. Hornung, V., S. Rothenfusser, S. Britsch, A. Krug, B. Jahrsdorfer, T. Giese, S. Endres, G. Hartmann. 2002. Quantitative expression of Toll-like receptor 1–10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J. Immunol. 168: 4531-4537. [Abstract/Free Full Text]
  4. Klinman, D. M.. 2004. Immunotherapeutic uses of CpG oligodeoxynucleotides. Nat. Rev. Immunol. 4: 249-258. [Medline]
  5. Klinman, D. M., D. Currie, I. Gursel, D. Verthelyi. 2004. Use of of CpG oligodeoxynucleotides as immune adjuvants. Immunol. Rev. 199: 201-216. [Medline]
  6. Krieg, A. M.. 2004. Antitumor applications of stimulating Toll-like receptor 9 with CpG oligodeoxynucleotides. Curr. Oncol. Rep. 6: 88-95. [Medline]
  7. Verthelyi, D., K. J. Ishii, M. Gursel, F. Takeshita, D. M. Klinman. 2001. Human peripheral blood cells differentially recognize and respond to two distinct CpG motifs. J. Immunol. 166: 2372-2377. [Abstract/Free Full Text]
  8. Vollmer, J., R. Weeratna, P. Payette, M. Jurk, C. Schetter, M. Laucht, T. Wader, S. Tluk, M. Liu, H. L. Davis, A. M. Krieg. 2004. Characterization of three CpG oligodeoxynucleotide classes with distinct immunostimulatory activities. Eur.J. Immunol. 34: 251-262. [Medline]
  9. Krug, A., S. Rothenfusser, V. Hornung, B. Jahrsdorfer, S. Blackwell, Z. K. Ballas, S. Endres, A. M. Krieg, G. Hartmann. 2001. Identification of CpG CpG oligonucleotide sequences with high induction of interferon-{alpha}beta in plasmacytoid dendritic cells. Eur. J. Immunol. 31: 2154-2163. [Medline]
  10. Gursel, M., D. Verthelyi, I. Gursel, K. J. Ishii, D. M. Klinman. 2002. Differential and competitive activation of human immune cells by distinct classes of CpG oligodeoxynucleotide. J. Leukocyte Biol. 71: 813-820. [Abstract/Free Full Text]
  11. Hartmann, G., A. M. Krieg. 2000. Mechanism and function of a newly identified CpG DNA motif in human primary B cells. J. Immunol. 164: 944-953. [Abstract/Free Full Text]
  12. Hartmann, G., G. J. Weiner, A. M. Krieg. 1999. CpG DNA: a potent signal for growth, activation and maturation of human dendritic cells. Proc. Natl. Acad. Sci. USA 96: 9305-9310. [Abstract/Free Full Text]
  13. Kwon, H. J., K. W. Lee, S. H. Yu, J. H. Han, D. S. Kim. 2003. NF-{kappa}B-dependent regulation of tumor necrosis factor-{alpha} gene expression by CpG-oligodeoxynucleotides. Biochem. Biophys. Res. Commun. 311: 129-138. [Medline]
  14. Hemmi, H., T. Kaisho, K. Takeda, S. Akira. 2003. The roles of Toll-like receptor 9, MyD88, and DNA-dependent protein kinase catalytic subunit in the effects of two distinct CpG DNAs on dendritic cell subsets. J. Immunol. 170: 3059-3064. [Abstract/Free Full Text]
  15. Klinman, D. M., F. Takeshita, I. Gursel, C. Leifer, K. J. Ishii, D. Verthelyi, M. Gursel. 2002. CpG DNA: Recognition by and activation of monocytes. Microbes Infect. 4: 897-901. [Medline]
  16. Dalpke, A. H., S. Zimmermann, I. Albrecht, K. Heeg. 2002. Phosphodiester CpG oligonucleotides as adjuvants: polyguanosine runs enhance cellular uptake and improve immunostimulative activity of phosphodiester CpG oligonucleotides in vitro and in vivo. Immunology 106: 102-112. [Medline]
  17. Bartz, H., Y. Mendoza, M. Gebker, T. Fischborn, K. Heeg, A. Dalpke. 2004. Poly-guanosine strings improve cellular uptake and stimulatory activity of phosphodiester CpG oligonucleotides in human leukocytes. Vaccine 23: 148-155. [Medline]
  18. Lee, S. W., M. K. Song, K. H. Baek, Y. Park, J. K. Kim, C. H. Lee, H. K. Cheong, C. Cheong, Y. C. Sung. 2000. Effects of hexameric deoxyriboguanosine run conjugation into CpG oligodeoxynucleotides on their immunostimulatory potentials. J. Immunol. 165: 3631-3639. [Abstract/Free Full Text]
  19. Pearson, A. M., A. Rich, M. Krieger. 1993. M. Polynucleotide binding to macrophage scavenger receptors depends on the formation of base-quartet stabilized four-stranded helices. J. Biol. Chem. 268: 3546-3554. [Abstract/Free Full Text]
  20. Suzuki, K., T. Doi, T. Imanishi, T. Kodama, T. Tanaka. 1999. Oligonucleotide aggregates bind to the macrophage scavenger receptor. Eur J. Biochem. 260: 855-860. [Medline]
  21. Shimaoka, T., N. Kume, M. Minami, K. Hayashida, H. Kataoka, T. Kita, S. Yonehara. 2000. Molecular cloning of a novel scavenger receptor for oxidized low density lipoprotein, SR-PSOX on macrophages. J. Biol. Chem. 275: 40663-40666. [Abstract/Free Full Text]
  22. Shimaoka, T., T. Nakayama, N. Kume, S. Takahashi, J. Yamaguchi, M. Minami, K. Hayashida, T. Kita, J. Ohsumi, O. Yoshie, S. Yonehara. 2003. Cutting edge: SR-PSOX/CXC chemokine ligand 16 mediates bacterial phagocytosis by APCs through its chemokine domain. J. Immunol. 171: 1647-1651. [Abstract/Free Full Text]
  23. Gough, P. J., K. J. Garton, P. T. Wille, M. Rychlewski, P. J. Dempsey, E. W. Raines. 2004. A disintegrin and metalloproteinase 10-mediated cleavage and shedding regulates the cell surface expression of CXC chemokine ligand 16. J. Immunol. 172: 3678-3685. [Abstract/Free Full Text]
  24. Matloubian, M., A. David, S. Engel, J. E. Ryan, J. G. Cyster. 2000. A transmembrane CXC chemokine is a ligand for HIV-coreceptor Bonzo. Nat. Immunol. 1: 298-304. [Medline]
  25. Tabata, S., N. Kadowaki, T. Kitawaki, T. Shimaoka, S. Yonehara, O. Yoshie, T. Uchiyama. 2005. Distribution and kinetics of SR-PSOX/CXCL16 and CXCR6 expression on human dendritic cell subsets and CD4+ T-cells. J. Leukocyte Biol. 77: 777-786. [Abstract/Free Full Text]
  26. Shimaoka, T., T. Nakayama, N. Fukumoto, N. Kume, S. Takahashi, J. Yamaguchi, M. Minami, K. Hayashida, T. Kita, J. Ohsumi, et al 2004. Cell-surface anchored SR-PSOX/CXC chemokin ligand 16 mediates firm adhesion of CXC chemokine receptor 6-expressing cells. J. Leukocyte Biol. 75: 267-274. [Abstract/Free Full Text]
  27. Abel, S., C. Hundhausen, R. Mentlein, A. Schulte, T. A. Berkhaut, N. Broadway, D. Hartmann, R. Sedlacek, S. Dietrich, B. Muetze, et al 2004. The transmembrane CXC-chemokine ligand 16 is induced by IFN-{gamma} and TNF-{alpha} and shed by the activity of the disintegrin-like metalloproteinase ADAM 10. J. Immunol. 172: 6362-6372. [Abstract/Free Full Text]
  28. Honda, K., Y. Ohba, H. Yanai, H. Negishi, T. Mizutani, A. Takaoka, C. Taya, T. Taniguchi. 2005. Spatiotemporal regulation of MyD88-IRF-7 signalling for robust type-I interferon induction. Nature 434: 1035-1040. [Medline]
  29. Asselin-Paturel, C., G. Trinchieri. 2005. Production of type I interferons: plasmacytoid dendritic cells and beyond. J. Exp. Med. 202: 461-465. [Abstract/Free Full Text]
  30. Baravalle, G., D. Schober, M. Huber, N. Bayer, R. F. Murphy, R. Fuchs. 2005. Transferrin recycling and dextran transport to lysosomes is differentially affected by bafilomycin, nocodazole and low temperature. Cell Tissue Res. 320: 99-113. [Medline]
  31. Gerosa, F., A. Gobbi, P. Zorzi, S. Burg, F. Briere, G. Carra, G. Trinchieri. 2005. The reciprocal interaction of NK cells with plasmacytoid or myeloid dendritic cells profoundly affects innate resistance functions. J. Immunol. 174: 727-734. [Abstract/Free Full Text]
  32. Wattiaux, R., M. Jadot, N. Laurent, F. Dubois, S. Wattiaux-De Coninck. 1996. Cationic lipids delay the transfer of plasmid DNA to lysosomes. Biochem. Biophys. Res. Commun. 227: 448-454. [Medline]
  33. Kerkmann, M., L. T. Costa, C. Richter, S. Rothenfusser, J. Battiany, V. Hornung, J. Johnson, S. Englert, T. Ketterer, W. Heckl, et al 2005. Spontaneous formation of nucleic-acid based nanoparticles is responsible for high interferon-{alpha} induction by CpG-A in plasmacytoid dendritic cells. J. Biol. Chem. 280: 8086-8093. [Abstract/Free Full Text]
  34. Kaur, H., L. Jaso-Friedmann, D. L. Evans. 2003. Identification of a scavenger receptor homologue on nonspecific cytotoxic cells and evidence for binding to oligodeoxyguanosine. Fish Shellfish Immunol. 15: 169-181. [Medline]
  35. Kaur, H., L. Jaso-Friedmann, J. H. Leary, III, D. L. Evans. 2004. Single-base oligodeoxyguanosine-binding proteins on nonspecific cytotoxic cells: identification of a new class of pattern-recognition receptor. Scand. J. Immunol. 60: 238-248. [Medline]
  36. Mukhopadhyay, S., J. Herre, G. D. Brown, S. Gordon. 2004. The potential for Toll-like receptors to collaborate with other innate immune receptors. Immunology. 112: 521-530. [Medline]
  37. Gantner, B. N., R. M. Simmons, S. J. Canavera, S. Akira, D. M. Underhill. 2003. Collaborative induction of inflammatory responses by dectin-1 and toll-like receptor 2. J Exp. Med. 197: 1107-1117. [Abstract/Free Full Text]
  38. Hoebe, K., P. Georgel, S. Rutschmann, X. Du, S. Mudd, K. Crozat, S. Sovath, L. Shamel, T. Hartung, U. Zahringer, B. Beutler. 2005. CD36 is a sensor of diacylglycerides. Nature 433: 523-527. [Medline]
  39. Nishiya, T., A. L. DeFranco. 2004. Ligand-regulated chimeric receptor approach reveals distnctive subcellular localization and signaling properties of the Toll-like receptors. J. Biol. Chem. 279: 19008-19017. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Leukoc. Biol.Home page
D. Klinman, H. Shirota, D. Tross, T. Sato, and S. Klaschik
Synthetic oligonucleotides as modulators of inflammation
J. Leukoc. Biol., October 1, 2008; 84(4): 958 - 964.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
R. B. Anderson, G. J. Cianciolo, M. N. Kennedy, and S. V. Pizzo
{alpha}2-Macroglobulin binds CpG oligodeoxynucleotides and enhances their immunostimulatory properties by a receptor-dependent mechanism
J. Leukoc. Biol., February 1, 2008; 83(2): 381 - 392.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Magnusson, R. Tobes, J. Sancho, and E. Pareja
Cutting Edge: Natural DNA Repetitive Extragenic Sequences from Gram-Negative Pathogens Strongly Stimulate TLR9
J. Immunol., July 1, 2007; 179(1): 31 - 35.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. Wang, G. Roderiquez, T. Jones, P. McPhie, and M. A. Norcross
Control of In Vitro Immune Responses by Regulatory Oligodeoxynucleotides through Inhibition of pIII Promoter Directed Expression of MHC Class II Transactivator in Human Primary Monocytes
J. Immunol., July 1, 2007; 179(1): 45 - 52.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
F. H. Wikstrom, B. M. Meehan, M. Berg, S. Timmusk, J. Elving, L. Fuxler, M. Magnusson, G. M. Allan, F. McNeilly, and C. Fossum
Structure-Dependent Modulation of Alpha Interferon Production by Porcine Circovirus 2 Oligodeoxyribonucleotide and CpG DNAs in Porcine Peripheral Blood Mononuclear Cells
J. Virol., May 15, 2007; 81(10): 4919 - 4927.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
M. Puig, A. Grajkowski, M. Boczkowska, C. Ausin, S. L. Beaucage, and D. Verthelyi
Use of thermolytic protective groups to prevent G-tetrad formation in CpG ODN type D: structural studies and immunomodulatory activity in primates
Nucleic Acids Res., December 2, 2006; 34(22): 6488 - 6495.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. A. Leifer, J. C. Brooks, K. Hoelzer, J. Lopez, M. N. Kennedy, A. Mazzoni, and D. M. Segal
Cytoplasmic Targeting Motifs Control Localization of Toll-like Receptor 9
J. Biol. Chem., November 17, 2006; 281(46): 35585 - 35592.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gursel, M.
Right arrow Articles by Klinman, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gursel, M.
Right arrow Articles by Klinman, D. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS