The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ludowyke, R. I.
Right arrow Articles by Biden, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ludowyke, R. I.
Right arrow Articles by Biden, T. J.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*L-SERINE
The Journal of Immunology, 2006, 177: 1492-1499.
Copyright © 2006 by The American Association of Immunologists

Phosphorylation of Nonmuscle Myosin Heavy Chain IIA on Ser1917 Is Mediated by Protein Kinase CbetaII and Coincides with the Onset of Stimulated Degranulation of RBL-2H3 Mast Cells1

Russell I. Ludowyke2,{dagger}, Zehra Elgundi2,*, Tanya Kranenburg{dagger}, Justine R. Stehn3,*, Carsten Schmitz-Peiffer*, William E. Hughes* and Trevor J. Biden4,*

* Garvan Institute of Medical Research and {dagger} Centre for Immunology, St. Vincent’s Hospital, Sydney, Australia


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Dynamic remodeling of the actinomyosin cytoskeleton is integral to many biological processes. It is regulated, in part, by myosin phosphorylation. Nonmuscle myosin H chain IIA is phosphorylated by protein kinase C (PKC) on Ser1917. Our aim was to determine the PKC isoform specificity of this phosphorylation event and to evaluate its potential role in regulated secretion. Using an Ab against the phosphorylated form of Ser1917, we show that this site is not phosphorylated in unstimulated RBL-2H3 mast cells. The physiological stimulus, Ag, or the pharmacological activators, PMA plus A23187, induced Ser1917 phosphorylation with a time course coincident with the onset of granule mediator secretion. Dephosphorylation at this site occurred as Ag-stimulated secretion declined from its peak, but dephosphorylation was delayed in cells activated with PMA plus A23187. Phosphate incorporation was also enhanced by PMA alone and by inhibition of protein phosphatase 2A. Gö6976, an inhibitor of conventional PKC isoforms, abolished secretion and Ser1917 phosphorylation with similar dose dependencies consistent with involvement of either PKC{alpha} or PKCbeta. Phorbol ester-stimulated Ser1917 phosphorylation was reconstituted in HEK-293 cells (which lack endogenous PKCbeta) by overexpression of both wild-type and constitutively active PKCbetaII but not the corresponding PKCbetaI or PKC{alpha} constructs. A similar selectivity for PKCbetaII overexpression was also observed in MIN6 insulinoma cells infected with recombinant PKC wild-type adenoviruses. Our results implicate PKC-dependent phosphorylation of myosin H chain IIA in the regulation of secretion in mast cells and suggest that Ser1917 phosphorylation might be a marker of PKCbetaII activation in diverse cell types.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Antigen binding of IgE leads to cross-linking of cell surface Fc{epsilon}RI receptors on mast cells and initiates the release of inflammatory agents such as cytokines, histamine, and proteases that contribute to allergies and asthma (1, 2). Signaling mechanisms triggered downstream of Fc{epsilon}RI receptors have been particularly well characterized using the rat mast cell line RBL-2H3. The rapid release of histamine is mediated by priming, docking, and ultimately, fusion of secretory granules with the plasma membrane (2). There is also a requirement for remodeling of the cortical actin and myosin cytoskeleton that otherwise forms a physical barrier that limits access of granules to the plasma membrane (3). This remodeling is accompanied by morphological alterations, including cell spreading, formation of ruffles on the apical surface, and on the basolateral surface, development of focal adhesions as well as plaques and stress fibers containing actin and myosin (3, 4, 5, 6, 7). All of these events are regulated as a result of various signaling cascades that are initiated following receptor activation (2).

The motor protein myosin is a major site at which converging upstream signaling processes are integrated and transformed into mechanical regulation of the actinomyosin cytoskeleton. Myosin is known to comprise a large family of related proteins (8, 9). The conventional form, myosin II, best implicated in regulation of cytoskeletal remodeling, is widely expressed and exists as a heterotrimer comprising two H chains, two essential L chains, and two regulatory L chains (RLCs).5 As expected from their name, the RLCs were generally considered the major site of control of myosin function via phosphorylation by protein kinases. However, more recent work has focused on phosphorylation of myosin H chain as an important although less well-understood regulatory event (10, 11). Mammalian nonmuscle H chain (MHCII) exists in three forms: myosin H chain IIA, myosin H chain IIB (12), and myosin H chain IIC (13) each of ~220 kDa. Myosin H chain IIB is not present in RBL-2H3 cells, and the expression of myosin H chain IIC has not been reported (14). As with the other forms, myosin H chain IIA comprises a globular head region that binds both ATP and actin, and a long tail that, except for the extreme C terminus, comprises an {alpha}-helix. Dimerization of the tail regions to form a coiled coil rod structure allows the formation of bipolar filaments. The nonhelical tail of myosin H chain contains multiple phosphorylation sites (11). In addition to sites for casein kinase II, phosphorylation of Ser1917 of myosin H chain IIA has been demonstrated as the major site of protein kinase C (PKC) action both in vitro and in vivo (15, 16, 17). In addition to PKC, the protein phosphatase (protein phosphatase 2A (PP2A)) has also been implicated in the regulation of myosin H chain phosphorylation at Ser1917, and Ag-stimulated secretion is accompanied by an increased association of myosin II and protein phosphatases at sites of cytoskeletal rearrangement (7). However, neither the precise biological role of the Ser1917 phosphorylation has been determined, nor has the PKC isoform responsible been identified.

The PKC family has 10 members that are characterized by their molecular structure and activation requirements but not all of these are expressed in mast cells (18). Of the conventional PKCs, which are sensitive to Ca2+ and diacylglycerol, mast cells contain PKCs {alpha}, betaI, and betaII. Also expressed are the members of the novel PKC group comprising PKCs {delta}, {epsilon}, {theta}, and {eta} that are sensitive to diacylglycerol only and the atypical PKC{zeta} that responds to neither diacylglycerol nor Ca2+ (19, 20, 21, 22). Although necessary for histamine secretion in mast cells, activation of PKC is not in itself sufficient for triggering exocytosis (3, 5, 19, 22). However, PKC is required for Fc{epsilon}RI-coupled events, including both activation of secretion (3, 5, 19, 22) and up-regulation of IL-6 gene expression (23). Moreover, the characteristic cytoskeletal remodeling that mast cells undergo upon Ag stimulation is reproduced by pharmacological activators of PKC and blocked by PKC inhibitors (3, 4, 5, 6, 7, 24). This suggests that cytoskeletal alterations are permissive for mast cell exocytosis but insufficient to trigger it. Studies involving global activation or inhibition of PKC are difficult to interpret, however, because differing roles of particular PKC isoforms have been described in RBL-2H3 cells, some of which are actually inhibitory for degranulation (19). Therefore, it is essential to address PKC function at the level of the individual isoforms.

The aims of the current study were to investigate the dynamic regulation of myosin H chain Ser1917 phosphorylation in RBL-2H3 cells and to identify the PKC isoform responsible. This was achieved by generation of an Ab specific for the phosphorylated form of Ser1917. Our results demonstrate that phosphorylation at this residue is very closely correlated with the onset of stimulated secretion and is mediated preferentially by PKCbetaII.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Cell culture

Cell culture supplies were obtained from Invitrogen Life Technologies, except for the FCS, which was obtained from CSL or Thermotrace. The monolayer cultures of RBL-2H3 cells were maintained in RPMI 1640 medium with 10% (v/v) FCS and subcultured as described previously (7). For activation, the cells were subcultured into 12-well culture dishes containing 8.0 x 105 cells/well. For Ag activation, the cells were primed by the addition of 75 ng/ml DNP-specific IgE (Sigma-Aldrich) to each well for overnight incubation. MIN6 cells (25) (passages ~25–42) were maintained in DMEM containing 25 mM glucose, 10 mM HEPES, 10% (v/v) FCS, 50 IU/ml penicillin, and 50 µg/ml streptomycin and were seeded into 24-well plates for experimental treatment (26). HC11 cells were maintained in RPMI 1640 medium with 10% (v/v) FCS. HEK-293 cells were cultured in MEM containing 10% (v/v) FCS.

Cell treatments

RBL-2H3 cells were washed in activation buffer at 37°C consisting of 119 mM NaCl, 5 mM KCl, 5.6 mM Dextrose, 1 mM CaCl2, 0.4 mM MgCl2, 0.1% BSA, and 25 mM PIPES (pH 7.2). Where indicated, the specific Ag DNP24-BSA was used at 100 ng/ml. In some instances, cells were preincubated with inhibitors for 10–60 min before stimulation. For secretion assays, stimulation was stopped by placing the plate on ice and an aliquot of the medium taken for beta-hexosaminidase assay. The total cellular content of beta-hexosaminidase was determined following lysis of unstimulated cells, and the activated release expressed as a percentage of the total. The amount of beta-hexosaminidase released was determined using a fluorescence assay with methylumberiferyl-N-acetyl-beta-D-glucosaminide (Sigma-Aldrich) as the substrate (7). HC11 were stimulated in RPMI 1640 medium without FCS. MIN6 and HEK-293 cells were washed and treated in modified Krebs-Ringer bicarbonate buffer containing 5 mM NaHCO3, 1 mM CaCl2, 0.5% (w/v) BSA, and 10 mM HEPES (pH 7.4) (26).

Cell lysis and Western immunoblotting

After treatment, the medium was removed and cells were extracted into 0.3 ml of an ice-cold, cytoskeletal lysis buffer, and the cells were scraped immediately into microcentrifuge tubes and left on ice for 15 min. The lysis buffer comprised 50 mM KCl, 2 mM MgCl2, 5 mM EGTA, 0.5 mM ATP, 0.5% Triton X-100, and 20 mM PIPES (pH 6.8) with protease inhibitors pepstatin, aprotinin, leupeptin (10 µg/ml), and PMSF (10 mM). The lysate was separated by centrifugation for 20 min at 13,000 x g at 4°C into a supernatant and pellet fraction. Aliquots of the supernatant fraction were removed to determine the protein concentration, and then equal volumes of Laemmli sample buffer were added before heating at 100°C for 6 min. From each sample, equal protein amounts were loaded into each well of a 5% polyacrylamide gel, and the proteins were separated by electrophoresis and immediately electroblotted onto polyvinylidene difluoride membranes using a semidry blotting system. The membrane was blocked overnight with 5% (w/v) skim milk powder in PBS with 0.02% Tween 20 (PBST) and washed three times before addition of the primary Ab in PBST containing 2% skim milk powder for 2 h. Alternatively, cell lysates were denatured in NuPage sample buffer (Invitrogen Life Technologies) disrupted by sonication before separation by SDS-PAGE using 3–8% Tris acetate gels (Invitrogen Life Technologies). Proteins were transferred "wet" to nitrocellulose membranes in 25 mM Tris (unbuffered) and 193 mM glycine buffer using a Bio-Rad TransBlot apparatus. Membranes were blocked in 50 mM Tris-HCl (pH 6.5), 150 mM NaCl, 0.1% Tween 20, and 5% BSA for 2 h. Incubation with the primary Abs was generally for 2 h at room temperature, followed by a 1-h incubation with HRP-conjugated secondary Ab, either donkey anti-rabbit from Jackson ImmunoResearch Laboratories or goat anti-mouse from Zymed Laboratories. Bands were visualized using an ECL detection kit (PerkinElmer) and analyzed on a Personal Densitometer SI (Molecular Dynamics) using IP Lab Gel H software (Signal Analytics).

Generation of Ser1917 Ab

The phospho-specific Ser1917 Ab was generated commercially by Chiron. The Ag CREVSS(phospho)LKNKL was coupled to maleimidocaproyl-N-hydroxy-succinimide, mixed with diptheria toxoid carrier protein, and injected s.c. as an emulsion in Freund’s adjuvant into New Zealand White rabbits. A second injection was made at day 14, and serum was collected by tail puncture at days 35 and 49. Abs were titered by ELISA using biotinylated peptide immobilized on an avidin-coated microtiter plate. The sources of other primary Abs were as follows: phospho (ser) conventional PKC substrate Ab (Cell Signaling Technology); PKC{alpha} (which recognizes all conventional PKCs) (BD Biosciences); PKC{alpha}, PKCbetaI, and PKCbetaII (Santa Cruz Biotechnology); and nonmuscle myosin (Biomedical Technologies).

PKC constructs

The PKC constructs for expression via transient transfection or adenovirus were constructed after PCR-mediated point and deletion mutagenesis from cDNAs encoding PKC{alpha} and the PKCbetaI and betaII splice variants (P. Parker, Cancer Research U.K., London, U.K.). Oligomers were designed to amplify the respective open reading frame (ORF) of bovine PKC{alpha} and human betaII flanked by XhoI (5') and BglII (3') restriction enzyme sites and "attB" recombination sequences for Gateway vectors (Invitrogen Life Technologies) (PKC{alpha}, GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCGAGCGCGCAAGATGGCTGACGTCTTCCCGGCCGCC, and GGGGACCACTTTGTACAAGAAAGCTGGGTAGATCTTCATACCGCGCTCTGCAGGATGGG; PKCbetaII, GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCGAGCGCGCAAGATGGCTGACCCG, and GGGGACCACTTTGTACAAGAAAGCTGGGTAGATCTACACATCTACTTAGCTCTTGACTTCGGG). These were incorporated into the pDONR221 Gateway vector. PKCbetaI oligomers (CTGCTGTATGAAATGTTGGCTGGG and GCGCGCAGATCTCACCTACACATTAATGACAAACTCTGGG), the latter of which also contained a BglII site, 3' to the stop codon, were used to amplify ~450 bp from the COOH terminus of the ORF, a product incorporating both a unique SphI site within the sequence common to both PKCbeta isoforms and the specific PKCbetaI sequence. This PKCbetaI SphI-BglII fragment was substituted into the pDONR221 PKCbetaII construct.

Constitutively active PKC{alpha} (pseudosubstrate site deletion, aa 22–28) was engineered using oligomers to amplify ~900 bp of the ORF of PKC{alpha}, a product incorporating unique NarI and SacI sites and codon changes to encode deletion of aa 22–28 (CGGCGGCGCCGCAGGACGTGGCCAACCGCTTCGCCAAGAACGTGCACGAGGTGAAGAACCACG and CTGCCTGAGCTCCACATTGCCTTCCTCGTCGC). This NarI-SacI fragment was substituted into the pDONR221 PKC{alpha} construct. These PKC products were expressed via pCDNA-DEST40 plasmids or pAd/CMV/V5-DEST adenovirus constructs (Invitrogen Life Technologies). All oligomers were synthesized by Sigma-Aldrich, and all constructs were sequenced at the Australian Genome Research Facility (University of Queensland).

Preparation of recombinant adenovirus

Adenovirus encoding wild-type PKC{alpha} was as reported previously (27). Other adenoviruses were generated using the pAd/CMV/V5-DEST as described previously (28). In brief, the adenoviruses were purified using caesium chloride ultracentrifugation and titrated according to the manufacturer’s instructions with Adeno-X Rapid Titer kit (BD Clontech). MIN6 cells were infected for 4 h with virus at ~50 PFU/cell before transferring to fresh media. Infected cells were maintained in culture for 48 h before stimulation and harvesting of lysates.

In vitro PKC assays

In vitro assays were based on previous protocols (29, 30). A peptide corresponding to the sequence around the myosin H chain IIA Ser1917 site (MNREVSSLKNKLRR) was incubated with 100 µM [{gamma}-32P]ATP (100–200 cpm/pmol) and 10 µl of recombinant PKC{alpha}, betaI, and betaII isoforms (diluted ~1/100; Calbiochem). Phosphorylation of the general PKC substrate, histone type IIIS (HIIIS; 0.5 mg/ml), was measured in parallel to facilitate comparison of PKC activities. One unit of PKC activity was defined as that phosphorylating 1 pmol of substrate/min. Lipids (5 mg/ml in chloroform:methanol (19:1 v/v) were dried under nitrogen and sonicated into 100 mM MOPS (pH 7.5) and 1% (v/v) Triton X-100 until clear before addition to the assay buffer. In addition to PKC isoforms and [{gamma}-32P]ATP, the final assay medium (50 µl) contained 24 mM MOPS (pH 7.5), 0.04% (v/v) Triton X-100, 5 mM Mg(CH2COO)2, 1 mM CaCl2, 125 µg/ml phosphatidylserine, and 2.5 µg/ml dioctanoyl-glycerol. Incubations were at 30°C for 10 min and performed as described previously (29, 30).

Data analysis

Data were fitted to Michaelis-Menten (in vitro phosphorylation assays) or sigmoidal (inhibitor dose response) curves using standard nonlinear least-squares regression techniques implemented as a "solver" routine in Microsoft Excel. Statistical significance was assessed using Student’s t test for unpaired samples using Statview 4.5 for MacIntosh (Abacus Concepts).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The specificity of the Ser1917 Ab

As outlined in Materials and Methods, we have raised an Ab to a peptide corresponding to the phosphorylated form of Ser1917, previously identified as a major PKC phosphorylation site in myosin H chain IIA (16, 17). To verify the specificity of the Ab, several other peptides were also produced in which the Ser1917 residue was either unphosphorylated or changed to alanine or aspartate. As shown in Fig. 1A, this antisera readily detected 1 µg of the phosphorylated peptide but did not recognize even high concentrations of the nonphosphorylated peptides. The fact that the aspartate-substituted peptide, whose negative charge reproduces that of a phosphoserine residue, was not antigenic attests to the high specificity of this antisera for the phosphorylated form of Ser1917. In immunoblots, this Ab readily detected a band at 220 kDa in extracts of RBL-2H3 mast cells prestimulated with the phorbol-ester activator of PKC, PMA (Fig. 1B). This band, which comigrated with myosin H chain IIA (results not shown), was not detected in unstimulated cells. The Ab did cross-react (much more weakly) with a number of other bands, but none of these was stimulus dependent and could easily be distinguished from myosin H chain IIA by their differing molecular weights (Fig. 1B). Most importantly, inclusion of 50 µg of phosphorylated Ser1917 peptide during Ab exposure markedly reduced detection of the myosin H chain IIA band but not the other bands (Fig. 1B). The nonphosphorylated Ser1917 peptide was not effective in these competition studies.


Figure 1
View larger version (55K):
[in this window]
[in a new window]
 
FIGURE 1. Characterization of the phosphoser-1917 antisera. A, Peptides representing the phosphorylated (SS-P), unphosphorylated (SS), alanine-substituted (SA), and aspartate-substituted (SD) sequence surrounding the Ser1917 site of MHCIIA were dried onto nitrocellulose and tested with the Ser1917 antisera (S1917). B, Lysates from RBL-2H3 cells either untreated or treated with 50 nM PMA for 15 min were separated by SDS-PAGE and immunoblotted with the phosphoser-1917 antisera in the presence of 50 µg/ml phosphorylated (SS-P) or unphosphorylated (SS) competing peptides. For further details, see Materials and Methods. Results are representative of two to three independent experiments.

 
Correlation of secretion with Ser1917 phosphorylation of myosin H chain IIA

Having demonstrated the specificity of the Ser1917 Ab, we next sought to characterize myosin H chain IIA phosphorylation during activation of RBL-2H3 mast cells. No phosphorylation at the Ser1917 site was detected in unstimulated cells, but a small response was seen within 0.5 min of receptor cross-linking with Ag (Fig. 2). This increased rapidly to reach a peak at 2 min after stimulation, followed by a gradual dephosphorylation toward baseline levels by 15–30 min. The rate of beta-hexosaminidase release in response to Ag was also investigated over a similar time frame (Fig. 2). It is readily apparent that the kinetics of Ser1917 phosphorylation correlate very closely with those of secretion, especially during the onset of both responses.


Figure 2
View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 2. Time courses of Ag stimulated Ser1917 phosphorylation and granule secretion in RBL-2H3 cells. Cells were treated for the indicated times with 100 ng/ml DNP-BSA, following overnight priming with 75 ng/ml IgE. Upper panels, Cell lysates extracted with cytoskeletal buffer were separated by SDS-PAGE, and then immunoblotted for detection of Ser1917 phosphorylation (S1917) or total myosin H chain IIA (MHCIIA). Lower panel, Stimulated cells were assayed for beta-hexosaminidase secretion and Ser1917 (and total MHCIIA) immunoblots analyzed by densitometry. Results represent mean ± SEM of four independent experiments. Secretion, or ratio of Ser1917 to total MHCIIA, are presented as normalized to the maximal response (2 min) within each experiment. All responses were elevated significantly (p < 0.05) vs the 0 time control, except for beta-hexosaminidase release at 10–30 min.

 
We next examined the kinetics of Ser1917 phosphorylation in response to a variety of pharmacological modulators of PKC. Phosphorylation in response to PMA was very slow but long lasting (Fig. 3A). It was not detected at all before 2 min, remained weak until 5 min, and did not peak until 20 min. It should be noted that, although PMA does promote cytoskeletal remodeling (3, 5, 19, 22), it is not sufficient to induce secretion in the absence of a coincident calcium signal. Coaddition of PMA with the calcium ionophore A23187 shortened the onset of Ser1917 phosphorylation by ~2 min (Fig. 3B), as compared with PMA alone, and produced a correspondingly higher response over the first 1–4 min following stimulation (Fig. 3, A and B). As with PMA alone, a slight decline in Ser1917 phosphorylation was observed after 20 min in the presence of the combined stimuli, although it was still evident at 30 min. We also measured secretion in response to PMA plus A23187 (Fig. 3B, lower panel). Maximal secretion occurred at 2–3 min and thereafter declined to basal levels by 20 min. Importantly, there is good concordance between Ser1917 phosphorylation and secretion during the onset phase of the response to PMA plus A23187, with only modest increases in either parameter over the first minute and a more pronounced elevation from minutes 1 to 2. The discrepancy in the overall correlation at later points where secretion declines, but phosphorylation is maintained, is probably explained by a longer-lived activation of PKC by PMA than by Ag or the potential role of phosphatases in counterregulating protein phosphorylation initiated by the physiological stimulus. Dephosphorylation of PKC substrates is predominantly mediated by PP2A (31). Net increases in phosphorylation, even in the absence of a primary stimulus, have thus been observed at the Ser1/Ser2 site of RLCs in mast cells following pretreatment with concentrations of okadaic acid that are selective for inhibition of PP2A (7). As shown in Fig. 3C, Ser1917 phosphorylation of myosin H chain was also augmented under these conditions. The relatively slow time course, as seen previously for RLCs (7), is probably explained by the reliance on basal PKC activity for phosphate incorporation in unstimulated cells. Taken together, these findings are consistent with the interpretation that myosin H chain IIA Ser1917 phosphorylation occurs rapidly enough in response to secretory stimuli to play a role in the cytoskeletal alterations that are necessary but not sufficient for promoting beta-hexosaminidase release.


Figure 3
View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 3. Stimulation of Ser1917 phosphorylation in RBL-2H3 cells with pharmacological agents. Cells were treated with PMA (50 nM) (A), PMA (50 nM) plus A23187 (0.5 µM) (B), or 1 µM okadaic acid (OA) (C) for the times as described. Ser1917 phosphorylation (S1917) or total myosin H chain IIA (MHCIIA) were detected by immunoblotting as described in the legend to Fig. 2. Results are representative of at least two independent experiments. B, lower panel, Cells were assayed for beta-hexosaminidase release. Results represent mean ± SEM of four independent experiments.

 
Involvement of conventional PKCbeta in Ser1917 phosphorylation

The above results demonstrate that PKC activation is sufficient for Ser1917 phosphorylation. To determine whether it is also necessary, we used the PKC-selective inhibitor bisindolylmaleimide I (32), which inhibits secretion and focal adhesion formation in RBL-2H3 cells (24). This compound also inhibited Ser1917 phosphorylation in a concentration-dependent manner (Fig. 4A). The degree of inhibition was similar whether the stimulus was Ag or PMA plus A23187, but there was no effect on Ser1917 phosphorylation in the absence of activators. Although several PKC isoforms are activated in Ag-stimulated mast cells, it is the conventional PKCbeta and novel PKC{epsilon} that are most strongly implicated as positive regulators of secretion (22). Therefore, we used the selective inhibitor of conventional PKCs, Gö6976 (33), to determine which PKC isoforms might be responsible for Ser1917 phosphorylation. As shown in Fig. 4B, this compound inhibited Ag-stimulated phosphorylation with a dose dependency consistent with the involvement of a conventional PKC, which narrows the choice in RBL-2H3 cells to PKC{alpha}, betaI, or betaII. Similar results were obtained in cells stimulated with PMA plus A23187 (data not shown). Importantly, secretion was inhibited with an almost identical dose dependency (Fig. 4B, lower panel), further attesting to the close correlation between Ser1917 phosphorylation and granule mediator release. Indeed, the Ki for phosphorylation (51.2 ± 30.4 nM) and that for secretion (38.4 ± 24.6 nM) were statistically indistinguishable (p > 0.5, n = 3). Because PKC{alpha} is a negative regulator of mast cell responses (34), these results with Gö6976 most likely support the involvement of the PKCbeta variants in myosin H chain IIA phosphorylation.


Figure 4
View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 4. Conventional PKC mediates Ser1917 phosphorylation. A, RBL-2H3 cells were either treated with 100 ng/ml DNP-BSA for 2.5 min (following overnight priming with 75 ng/ml IgE) or with 50 nM PMA and 0.5 µM A23187 (P+A) for 10 min with or without the indicated concentrations of the general PKC inhibitor bisindolylmaleimide (Bim). B, RBL-2H3 cells were treated with Ag as above, with or without the indicated concentrations of the conventional PKC inhibitor Gö6976. Lower panel, Stimulated cells were assayed for beta-hexosaminidase secretion and Ser1917 (and total MHCIIA) immunoblots analyzed by densitometry. Results represent mean ± SEM of three independent experiments. Secretion, or ratio of Ser1917 to total MHCIIA, is presented as normalized to the maximal response (without Gö6976) within each experiment.

 
Overexpression of PKCbetaII increases Ser1917 phosphorylation of myosin in HEK-293 cells

We next conducted a preliminary screen of several cell lines for endogenous expression of myosin H chain IIA, PKC{alpha}, and PKCbeta isoforms and tested their capacity for Ser1917 phosphorylation. Under basal conditions, no Ser1917 phosphorylation was observed in any cell type, but, as with RBL-2H3 cells, this was augmented in MIN6 insulinoma cells treated with PMA. In contrast, there was no response at all in HEK-293 and HC11 cells (results not shown). Interestingly, whereas the four cell lines expressed myosin H chain IIA, PKC{alpha}, and (with the exception of HEK-293 cells) PKCbetaI, only the MIN6 and RBL-2H3 cells were found to contain detectable levels of PKCbetaII (results not shown). This argues against PKC{alpha} and PKCbetaI as being the kinase responsible for Ser1917 phosphorylation and conversely supports a role for PKCbetaII. We investigated this further by performing overexpression studies in the HEK-293 cells, which are amenable to efficient transfection. As shown in Fig. 5A, overexpression of wild-type PKCbetaII reconstituted a robust Ser1917 phosphorylation in the presence of PMA. Smaller increases were seen in cells similarly transfected with wild-type PKC{alpha} or PKCbetaI. This selectivity for PKCbetaII in phosphorylating the Ser1917 site was confirmed using constitutively active PKC mutants. In this instance, the PKCbetaII construct also increased Ser1917 phosphorylation but in a stimulus-independent manner, whereas constitutively active PKC{alpha} and PKCbetaI mutants had much lesser effects (Fig. 5A). The observed differences between these various constructs were not explained by variations in the efficiency of the PKC transgene expression, nor by variations in myosin H chain IIA total content, as also determined by immunoblotting. Indeed, combined analyses of Ser1917 phosphorylation corrected for total myosin H chain IIA from densitometry scans of four to five experiments revealed that PKCbetaII wild-type was the only construct that significantly increased (p < 0.05) PMA-stimulated Ser1917 phosphorylation (Fig. 5A, lower panel). Of the constitutively active constructs, PKCbetaII was again the most effective (p = 0.05).


Figure 5
View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 5. Overexpression of the PKCbetaII isoform mediates Ser1917 phosphorylation of MHCIIA in HEK-293 cells. Cells were either untransfected or transiently transfected with vectors expressing either PKC{alpha}, PKCbetaI, or PKCbetaII in wild-type or constitutively active forms. After 24 h, cells were transferred to a modified Krebs-Ringer bicarbonate buffer and either treated (+) or untreated (–) with 100 nM PMA for 15 min. A, Cell lysates were separated by SDS-PAGE and then immunoblotted with appropriate antisera for detection of Ser1917 phosphorylation (S1917), total MHCIIA, and total conventional PKC ({alpha} beta {gamma}, cPKC). Lower panel, Ratio of Ser1917 phosphorylation to total MHCIIA expression as determined from densitometric analysis of individual immunoblots. Results are mean ± SEM of four to five independent experiments. The asterisk indicates significantly different (p < 0.05) from the PMA-stimulated, mock-transfected control. B, Cell lysates processed in parallel with those used above were separated by SDS-PAGE and probed with a commercial anti-phosphoserine Ab raised against a consensus sequence for conventional PKC substrates. Arrows point to bands showing increased intensity in cells transfected with individual PKC isoforms as indicated or to a band increased by all transfected PKCs (*).

 
As a further important control, we made use of a commercial anti-phosphoserine Ab raised against a consensus phosphorylation sequence for conventional PKC substrates. We have used this previously to detect changes in the phosphorylation status in the subset of conventional PKC substrates that are recognized in this manner (35). As shown in Fig. 5B, this Ab detected increased phosphorylation in a range of proteins in PMA-stimulated control cells. Overexpression of wild-type or constitutively active PKC further augmented the phosphorylation of several of these bands. In some instance, most notably with a protein of ~180 kDa (marked with an asterisk in Fig. 5B), the increase was seen with all kinase constructs, which is suggestive of a substrate with little selectivity. In other instances, bands showed more discrimination for an individual kinase (marked with respective arrows). In any event, these results confirm that the selective modulation of Ser1917 phosphorylation by PKCbetaII is not explained by a lack of functionality of the PKCbetaI and PKC{alpha} constructs. Note also that a band corresponding to myosin H chain IIA is not detected by the generic phosphoserine Ab, because the epitope to which this was raised shows only limited homology to the sequence surrounding Ser1917.

Overexpression of PKCbetaII constructs modulates Ser1917 phosphorylation of myosin in MIN6 cells

To extend our findings to another secretory cell type, we turned to the MIN6 cells, shown above to express PKCbetaI, betaII, and {alpha} and, accordingly, show Ser1917 phosphorylation in response to PMA (Fig. 6). Recombinant adenovirus was used for overexpression in this instance, which facilitates transgene expression in >90% of MIN6 cells (results not shown). Consistent with results obtained using HEK-293 cells, Ser1917 phosphorylation was further augmented in cells overexpressing PKCbetaII, compared with PKCbetaI or PKC{alpha} (Fig. 6). Indeed, when densitometric analyses from several experiments were combined, only PKCbetaII overexpression augmented phosphorylation to a statistically significant extent.


Figure 6
View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 6. The PKCbetaII isoform mediates Ser1917 phosphorylation of MHCIIA in MIN6 insulinoma cells. MIN6 cells were infected with control adenovirus (pShuttle) or adenovirus-expressing PKC{alpha}, PKCbetaI, and PKCbetaII wild-type isoforms (WT). After 48 h, cells were transferred to a modified Krebs-Ringer bicarbonate medium and either treated (+) or not (–) with 500 nM PMA for 15 min. Cell lysates were separated by SDS-PAGE and then immunoblotted with appropriate antisera where indicated for detection (upper panels) of either Ser1917 phosphorylation (S1917), total MHCIIA, or total conventional PKC ({alpha} beta {gamma}, cPKC). Lower panel, Ratio of Ser1917 phosphorylation to total MHCIIA expression as determined from densitometric analysis of individual immunoblots. Results are mean ± SEM of four independent experiments. The asterisk indicates significantly different (p < 0.05) from the PMA-stimulated, mock-transfected control.

 
In vitro analysis of PKC isoform specificity of Ser1917 phosphorylation of myosin

To determine whether the apparent specificity of Ser1917 phosphorylation for PKCbetaII is inherent to the sequence of the substrate, we investigated in vitro phosphorylation of the Ser1917 peptide by recombinant PKC isoforms. As shown in Fig. 7, the peptide was an excellent substrate for PKCbetaI and less so for PKC{alpha}. Interestingly, PKCbetaII in vitro phosphorylated the peptide rather poorly with a Vmax ~20% of that of PKCbetaI (1.7 ± 0.9 vs 8.2 ± 1.8 U normalized to activity toward HIIIS, p < 0.05, n = 3). The Vmax for PKC{alpha} (2.0 ± 0.2 U) differed significantly from that of PKCbetaI (p < 0.05) but not PKCbetaII. The Km for PKCbetaII (1.0 ± 0.3 µM, n = 3) was the lowest of the three kinases, although this did not differ significantly from those of PKC{alpha} (1.3 ± 0.8) or PKCbetaI (1.6 ± 0.4). These results indicate that the specificity of Ser1917 phosphorylation shown in intact cells is not a function of the sequence immediately surrounding the Ser1917 site but most probably explained by the subcellular localization of PKCbetaII, which, unlike PKCbetaI, possesses an actin-binding domain (36).


Figure 7
View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 7. Phosphorylation of a Ser1917 peptide in vitro by recombinant conventional PKC isoforms. Phosphorylation of CMNREVSSLKNKLRR by PKC{alpha} (diamonds), betaI (squares), and betaII (triangles) was determined in the presence of CaCl2, {alpha}-phosphatidyl-l-serine, and 1,2-dioctanoyl sn-glycerol as described under Materials and Methods. To facilitate direct comparison of the data, peptide phosphorylation over a range of concentrations was normalized to the activity of each isoform toward histone 0.5 mg/ml HIIIS measured under identical conditions. Results shown are the mean values from one experiment conducted in triplicate, representative of three independent experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
We have developed and characterized an antisera that was shown to be specific to the phosphorylated form of Ser1917 in myosin H chain IIA. Access to the novel reagent has allowed us to undertake the most extensive characterization yet reported of Ser1917 phosphorylation in vivo. We additionally provide new evidence strongly implicating Ser1917 phosphorylation as a regulatory event in Ag-stimulated secretion from RBL-2H3 mast cells. First, we show that both parameters were inhibited with almost identical dose dependencies by the conventional PKC inhibitor Gö6976. While a role for conventional PKCs in regulating mast cell responses has been widely reported previously (22), data linking secretion with phosphorylation of an individual substrate have been less forthcoming. Our results now point to PKC-dependent myosin H chain IIA phosphorylation as playing an important role in exocytosis (see below). The second piece of evidence linking Ser1917 phosphorylation and secretion is that both parameters showed essentially similar time courses following Ag stimulation. These results clearly demonstrate that the phosphorylation of myosin H chain IIA on Ser1917 occurs sufficiently rapidly for it to play a regulatory role in the secretory process. The importance of this observation is highlighted by comparison with the kinetics of MLC phosphorylation by PKC in Ag-stimulated RBL-2H3 cells, which appear to lag behind that of beta-hexosaminidase release (37).

The moment-to-moment correlation of secretion with Ser1917 phosphorylation was, however, not observed with stimuli other than Ag. For example, inhibition of PP2A with okadaic acid actually inhibits mast cell degranulation (7), despite augmenting the phosphorylation of Ser1917 (Fig. 3C). But this agent will enhance phosphorylation of multiple proteins, so it is not surprising that some of these might act distally to myosin H chain IIA to block secretion. Moreover, PMA is unable to stimulate secretion from mast cells, although as shown here (Fig. 3A), it did induce a relatively slow increase in Ser1917 phosphorylation. The simplest reconciliation of these findings is that, as with PKC activation (3, 5, 19, 22), Ser1917 phosphorylation is necessary but not sufficient for mast cell degranulation. This would also be consistent with the example of stimulation with PMA plus A23187, where a later decline in the rate of degranulation coincided with ongoing Ser1917 phosphorylation. This is probably explained by the pharmacological agents bypassing, or overriding, counterregulatory mechanisms that operate to limit the duration of receptor-binding agonists. The essential point, however, is that Ser1917 phosphorylation and secretion occur in parallel during the first 2–3 min following stimulation, irrespective of whether the secretory stimulus is Ag or PMA plus A23187. This is consistent with a requirement for myosin H chain IIA phosphorylation during the onset of exocytosis.

Alterations in the actinomyosin cytoskeleton have been well documented to accompany stimulated secretion in many cell types (38, 39, 40). Although phosphorylation of RLC is undoubtedly important in regulating the motor function of myosin, there is growing evidence that remodeling of the cortical actin web through turnover of myosin filaments, which is thought to be vital for allowing secretory granules to fuse with the plasma membrane, is controlled by phosphorylation of myosin H chains (11, 17, 39, 41, 42, 43). Activation of neurons and pancreatic beta cells results in threonine phosphorylation of myosin H chain IIA in a manner that is Ca2+ dependent but not mediated by CaM kinase (39, 42, 44). Most importantly, insulin secretion, in terms of both kinetics and degree, correlates much better with threonine phosphorylation of myosin H chain IIA than with the RLC phosphorylation events (44). In contrast, threonine phosphorylation of myosin H chain IIA in Ag-stimulated RBL-2H3 cells peaks at 10 min (45), which is considerably later than the maximal rate of secretion as shown here and in many earlier studies. In addition, this threonine phosphorylation in the RBL-2H3 cells appears to be mediated by CaM kinase, and the phosphorylated residue, Thr1940, is not found in human myosin H chain IIA. All of these results suggest that if myosin H chain IIA phosphorylation is to be implicated in the regulation of secretion from mast cells, as it has in other cell types, phosphorylation of Thr1940 is an unlikely candidate (45). At least two other phosphorylation sites have been mapped on myosin H chain IIA, Ser1917 and Ser1944, which were further identified as major sites of phosphorylation by PKC and casein kinase, respectively (15, 16, 46). Whereas Ser1944 appears to be constitutively phosphorylated in vivo, stoichiometric incorporation of phosphate into the PKC site has been shown to occur in RBL-2H3 cells activated with various stimuli (7, 47). Both these serine residues are located at the C terminus of myosin H chain IIA; Ser1917 occurs near the end of a putative {alpha} helical domain and Ser1944 in the nonhelical tail piece (11). This tail piece is known to contribute to filament formation, so it is likely that phosphorylation of residues in, or close to, this region would have regulatory potential (17, 41, 48). Indeed, this has been shown to be the case for analogous phosphorylation events in the C terminus of myosin H chain 2B (17).

The second major finding of our study is the identification of PKCbeta, and particularly PKCbetaII, as the major isoform responsible for mediating phosphorylation at Ser1917. Earlier work had shown that C-terminal fragments of myosin H chain IIA (17), or small peptides corresponding to the sequence surrounding Ser1917 (48), could be directly phosphorylated in vitro by a mixture of PKCs. Our results demonstrated that although recombinant PKCbetaI effectively phosphorylated a peptide containing Ser1917 in vitro, the overexpression data pointed to a more important role for PKCbetaII. These differences strongly suggest that effective Ser1917 phosphorylation depends in intact cells, upon the close association of myosin H chain IIA with actin, to which PKCbetaII, but not PKCbetaI, is known to bind (36). This conclusion is also consistent with the reported failure to demonstrate direct interactions of myosin H chain IIA with various PKC isoforms by immunoprecipitation (49). Our results are consistent with PKCbetaII also having a role in the control over cytoskeletal remodeling.

Activation of PKC is essential for important aspects of mast cell activation, in particular, granule secretion and IL-6 expression (22). More specifically, PKC{epsilon} plays a role in mediating degranulation (19, 20, 22), whereas PKCs {alpha} and {delta} appear to be responsible for down-regulation of mast cell activation (34). The strongest evidence, however, points to a pre-eminent role of PKCbeta in controlling both secretion and gene expression (22). This is based on repletion of PKC-down-regulated cells with purified PKC isoforms (19), overexpression studies (20), and investigations of mast cells from PKCbeta knockout mice (23). None of these studies specifically discriminated between PKCbetaI and PKCbetaII as one study revealed that Ag-stimulated histamine secretion was restored equally well by retroviral transfection of either PKCbetaI or PKCbetaII in mast cells from PKCbeta–/– mice (50). It is possible that both isoforms might contribute in their own differing ways to the regulation of secretion. More recently, a selective role for PKCbetaII has been proposed in mast cells via phosphorylation of the serine/threonine kinase akt on its C-terminal activation domain at Ser473 (51). However, the relevance of this finding to degranulation is unclear.

Taken together, our results would suggest that Ser1917 phosphorylation of myosin H chain IIA by PKCbetaII might be involved in some aspect of the remodeling of the cytoskeleton that accompanies secretion. How this might occur is unclear since phosphorylation at this site does not directly destabilize myosin H chain IIA filament formation, at least in vitro, as it appears to do at the equivalent site in myosin H chain 2B (17). However, it is possible that Ser1917 phosphorylation modulates recruitment of a regulatory factor, such as Mts1, which is known to bind to this region of myosin H chain IIA, and thereby directly inhibits filament assembly (41). Interestingly, Mts1 binding was also shown to inhibit Ser1917 phosphorylation of myosin H chain IIA in vitro (48). However, our results have highlighted a specific phosphorylation site on a protein believed to play a critical role in secretion and, in addition, the kinase and phosphatase that are likely to regulate this phosphorylation. This should allow a more targeted approach to therapies designed to inhibit the release of inflammatory mediators from mast cells and thus treat allergies and asthma.

Finally, it should be highlighted that myosin H chain IIA is an abundant and widely expressed protein, as is PKCbeta, and that activation of PKCbeta, especially PKCbetaII, has important functions in addition to mast cell activation and the pathophysiology of asthma (50). This PKC isoform also plays a role in multiple tissues in mediating diabetes complications (52) and is closely associated with various forms of cancer, particularly bowel cancer (53). This suggests that Ser1917 phosphorylation might be useful as a marker for PKCbeta activation in these disease states and as a research tool for delineating the role of this PKC isoform in the pathologies of diabetes complications, cancer, asthma, and potentially other diseases.


    Acknowledgments
 
We thank Peter Parker (Cancer Research U.K.) for provision of PKC clones, Rekha Wilks for technical assistance, and Paul Timpson and Georg Ramm for critical review of this manuscript.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by project grants from the National Health and Medical Research Council Australia (to T.J.B.) and the Asthma Foundation of New South Wales (to R.I.L.). Back

2 R.I.L. and Z.E. contributed equally to this study. Back

3 Current address: Oncology Research Unit, Westmead Children’s Hospital, Westmead, Australia. Back

4 Address correspondence and reprint requests to Dr. Trevor J. Biden, Garvan Institute of Medical Research, 384 Victoria Street, Darlinghurst 2010, Australia. E-mail address: t.biden{at}garvan.org.au Back

5 Abbreviations used in this paper: RLC, regulatory L chain; HIIIS, histone type IIIS; ORF, open reading frame; PKC, protein kinase C; PP2A, protein phosphatase 2A; MHCII, nonmuscle H chain II. Back

Received for publication December 27, 2005. Accepted for publication May 10, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Krishnaswamy, G., J. Kelley, D. Johnson, G. Youngberg, W. Stone, S. K. Huang, J. Bieber, D. S. Chi. 2001. The human mast cell: functions in physiology and disease. Front. Biosci. 6: D1109-D1127. [Medline]
  2. Blank, U., J. Rivera. 2004. The ins and outs of IgE-dependent mast-cell exocytosis. Trends Immunol. 25: 266-273. [Medline]
  3. Pfeiffer, J. R., J. C. Seagrave, B. H. Davis, G. G. Deanin, J. M. Oliver. 1985. Membrane and cytoskeletal changes associated with IgE-mediated serotonin release from rat basophilic leukemia cells. J. Cell Biol. 101: 2145-2155. [Abstract/Free Full Text]
  4. Liu, Z. Y., J. I. Young, E. L. Elson. 1987. Rat basophilic leukemia cells stiffen when they secrete. J. Cell Biol. 105: 2933-2943. [Abstract/Free Full Text]
  5. Apgar, J. R.. 1991. Regulation of the antigen-induced F-actin response in rat basophilic leukemia cells by protein kinase C. J. Cell Biol. 112: 1157-1163. [Abstract/Free Full Text]
  6. Ludowyke, R. I., K. Kawasugi, P. W. French. 1994. PMA and calcium ionophore induce myosin and F-actin rearrangement during histamine secretion from RBL-2H3 cells. Cell Motil. Cytoskeleton 29: 354-365. [Medline]
  7. Holst, J., A. T. Sim, R. I. Ludowyke. 2002. Protein phosphatases 1 and 2A transiently associate with myosin during the peak rate of secretion from mast cells. Mol. Biol. Cell 13: 1083-1098. [Abstract/Free Full Text]
  8. Ruppel, K. M., J. A. Spudich. 1996. Structure-function analysis of the motor domain of myosin. Annu. Rev. Cell. Dev. Biol. 12: 543-573. [Medline]
  9. Sellers, J. R.. 2000. Myosins: a diverse superfamily. Biochim. Biophys. Acta 1496: 3-22. [Medline]
  10. Brzeska, H., E. D. Korn. 1996. Regulation of class I and class II myosins by heavy chain phosphorylation. J. Biol. Chem. 271: 16983-16986. [Free Full Text]
  11. Bresnick, A. R.. 1999. Molecular mechanisms of nonmuscle myosin-II regulation. Curr. Opin. Cell Biol. 11: 26-33. [Medline]
  12. Simons, M., M. Wang, O. W. McBride, S. Kawamoto, K. Yamakawa, D. Gdula, R. S. Adelstein, L. Weir. 1991. Human nonmuscle myosin heavy chains are encoded by two genes located on different chromosomes. Circ. Res. 69: 530-539. [Abstract/Free Full Text]
  13. Golomb, E., X. Ma, S. S. Jana, Y. A. Preston, S. Kawamoto, N. G. Shoham, E. Goldin, M. A. Conti, J. R. Sellers, R. S. Adelstein. 2004. Identification and characterization of nonmuscle myosin II-C, a new member of the myosin II family. J. Biol. Chem. 279: 2800-2808. [Abstract/Free Full Text]
  14. Choi, O. H., C. S. Park, K. Itoh, R. S. Adelstein, M. A. Beaven. 1996. Cloning of the cDNA encoding rat myosin heavy chain-A and evidence for the absence of myosin heavy chain-B in cultured rat mast (RBL-2H3) cells. J. Muscle Res. Cell Motil. 17: 69-77. [Medline]
  15. Conti, M. A., J. R. Sellers, R. S. Adelstein, M. Elzinga. 1991. Identification of the serine residue phosphorylated by protein kinase C in vertebrate nonmuscle myosin heavy chains. Biochemistry 30: 966-970. [Medline]
  16. Moussavi, R. S., C. A. Kelley, R. S. Adelstein. 1993. Phosphorylation of vertebrate nonmuscle and smooth muscle myosin heavy chains and light chains. Mol. Cell. Biochem. 127–128: 219-227.
  17. Murakami, N., S. S. Singh, V. P. Chauhan, M. Elzinga. 1995. Phospholipid binding, phosphorylation by protein kinase C, and filament assembly of the COOH terminal heavy chain fragments of nonmuscle myosin II isoforms MIIA and MIIB. Biochemistry 34: 16046-16055. [Medline]
  18. Tan, S. L., P. J. Parker. 2003. Emerging and diverse roles of protein kinase C in immune cell signalling. Biochem. J. 376: 545-552. [Medline]
  19. Ozawa, K., Z. Szallasi, M. G. Kazanietz, P. M. Blumberg, H. Mischak, J. F. Mushinski, M. A. Beaven. 1993. Ca2+-dependent and Ca2+-independent isozymes of protein kinase C mediate exocytosis in antigen-stimulated rat basophilic RBL-2H3 cells: reconstitution of secretory responses with Ca2+ and purified isozymes in washed permeabilized cells. J. Biol. Chem. 268: 1749-1756. [Abstract/Free Full Text]
  20. Chang, E. Y., Z. Szallasi, P. Acs, V. Raizada, P. C. Wolfe, C. Fewtrell, P. M. Blumberg, J. Rivera. 1997. Functional effects of overexpression of protein kinase C-{alpha}, -beta, -{delta}, -{epsilon}, and -{eta} in the mast cell line RBL-2H3. J. Immunol. 159: 2624-2632. [Abstract]
  21. Liu, Y., C. Graham, V. Parravicini, M. J. Brown, J. Rivera, S. Shaw. 2001. Protein kinase C {theta} is expressed in mast cells and is functionally involved in Fc{epsilon}receptor I signaling. J. Leukocyte. Biol. 69: 831-840. [Abstract/Free Full Text]
  22. Nechushtan, H., E. Razin. 2001. Studies of different aspects of the role of protein kinase C in mast cells. Int. Arch. Allergy Immunol. 124: 130-132. [Medline]
  23. Nechushtan, H., M. Leitges, C. Cohen, G. Kay, E. Razin. 2000. Inhibition of degranulation and interleukin-6 production in mast cells derived from mice deficient in protein kinase Cbeta. Blood 95: 1752-1757. [Abstract/Free Full Text]
  24. Kawasugi, K., P. W. French, R. Penny, R. I. Ludowyke. 1995. Focal adhesion formation is associated with secretion of allergic mediators. Cell Motil. Cytoskeleton 31: 215-224. [Medline]
  25. Miyazaki, J., K. Araki, E. Yamato, H. Ikegami, T. Asano, Y. Shibasaki, Y. Oka, K. Yamamura. 1990. Establishment of a pancreatic beta cell line that retains glucose-inducible insulin secretion: special reference to expression of glucose transporter isoforms. Endocrinology 127: 126-132. [Abstract/Free Full Text]
  26. Busch, A. K., D. Cordery, G. S. Denyer, T. J. Biden. 2002. Expression profiling of palmitate- and oleate-regulated genes provides novel insights into the effects of chronic lipid exposure on pancreatic beta cell function. Diabetes 51: 977-987. [Abstract/Free Full Text]
  27. Carpenter, L., D. Cordery, T. J. Biden. 2001. Protein kinase C{delta} activation by interleukin-1beta stabilizes inducible nitric-oxide synthase mRNA in pancreatic beta cells. J. Biol. Chem. 276: 5368-5374. [Abstract/Free Full Text]
  28. Hughes, W. E., Z. Elgundi, P. Huang, M. A. Frohman, T. J. Biden. 2004. Phospholipase D1 regulates secretagogue-stimulated insulin release in pancreatic beta cells. J. Biol. Chem. 279: 27534-27541. [Abstract/Free Full Text]
  29. Selbie, L. A., K. Darby, C. Schmitz-Peiffer, C. L. Browne, H. Herzog, J. Shine, T. J. Biden. 1995. Synergistic interaction of Y1-neuropeptide Y and {alpha}1b-adrenergic receptors in the regulation of phospholipase C, protein kinase C, and arachidonic acid production. J. Biol. Chem. 270: 11789-11796. [Abstract/Free Full Text]
  30. Burchfield, J. G., A. J. Lennard, S. Narasimhan, W. E. Hughes, V. C. Wasinger, G. L. Corthals, T. Okuda, H. Kondoh, T. J. Biden, C. Schmitz-Peiffer. 2004. Akt mediates insulin-stimulated phosphorylation of Ndrg2: evidence for cross-talk with protein kinase C{theta}. J. Biol. Chem. 279: 18623-18632. [Abstract/Free Full Text]
  31. Millward, T. A., S. Zolnierowicz, B. A. Hemmings. 1999. Regulation of protein kinase cascades by protein phosphatase 2A. Trends Biochem. Sci. 24: 186-191. [Medline]
  32. Toullec, D., P. Pianetti, H. Coste, P. Bellevergue, T. Grand-Perret, M. Ajakane, V. Baudet, P. Boissin, E. Boursier, F. Loriolle, et al 1991. The bisindolylmaleimide GF 109203X is a potent and selective inhibitor of protein kinase C. J. Biol. Chem. 266: 15771-15781. [Abstract/Free Full Text]
  33. Martiny-Baron, G., M. G. Kazanietz, H. Mischak, P. M. Blumberg, G. Kochs, H. Hug, D. Marme, C. Schachtele. 1993. Selective inhibition of protein kinase C isozymes by the indolocarbazole Gö6976. J. Biol. Chem. 268: 9194-9197. [Abstract/Free Full Text]
  34. Ozawa, K., K. Yamada, M. G. Kazanietz, P. M. Blumberg, M. A. Beaven. 1993. Different isozymes of protein kinase C mediate feedback inhibition of phospholipase C and stimulatory signals for exocytosis in rat RBL-2H3 cells. J. Biol. Chem. 268: 2280-2283. [Abstract/Free Full Text]
  35. Carpenter, L., C. J. Mitchell, Z. Z. Xu, P. Poronnik, G. W. Both, T. J. Biden. 2004. PKC{alpha} is activated but not required during glucose-induced insulin secretion from rat pancreatic islets. Diabetes 53: 53-60. [Abstract/Free Full Text]
  36. Blobe, G. C., D. S. Stribling, D. Fabbro, S. Stabel, Y. A. Hannun. 1996. Protein kinase C betaII specifically binds to and is activated by F-actin. J. Biol. Chem. 271: 15823-15830. [Abstract/Free Full Text]
  37. Choi, O. H., R. S. Adelstein, M. A. Beaven. 1994. Secretion from rat basophilic RBL-2H3 cells is associated with diphosphorylation of myosin light chains by myosin light chain kinase as well as phosphorylation by protein kinase C. J. Biol. Chem. 269: 536-541. [Abstract/Free Full Text]
  38. Trifaro, J. M.. 1990. The 1989 Upjohn Award lecture: cellular and molecular mechanisms in hormone and neurotransmitter secretion. Can. J. Physiol. Pharmacol. 68: 1-16. [Medline]
  39. van Leeuwen, F. N., S. van Delft, H. E. Kain, R. A. van der Kammen, J. G. Collard. 1999. Rac regulates phosphorylation of the myosin-II heavy chain, actinomyosin disassembly and cell spreading. Nat. Cell Biol. 1: 242-248. [Medline]
  40. Wilson, J. R., R. I. Ludowyke, T. J. Biden. 2001. A redistribution of actin and myosin IIA accompanies Ca2+-dependent insulin secretion. FEBS Lett. 492: 101-106. [Medline]
  41. Murakami, N., L. Kotula, Y. W. Hwang. 2000. Two distinct mechanisms for regulation of nonmuscle myosin assembly via the heavy chain: phosphorylation for MIIB and mts 1 binding for MIIA. Biochemistry 39: 11441-11451. [Medline]
  42. Wilson, J. R., R. I. Ludowyke, T. J. Biden. 1998. Nutrient stimulation results in a rapid Ca2+-dependent threonine phosphorylation of myosin heavy chain in rat pancreatic islets and RINm5F cells. J. Biol. Chem. 273: 22729-22737. [Abstract/Free Full Text]
  43. An, J., G. Zhao, L. M. Churgay, J. J. Osborne, J. E. Hale, G. W. Becker, G. Gold, L. E. Stramm, Y. Shi. 1999. Threonine phosphorylations induced by RX-871024 and insulin secretagogues in betaTC6-F7 cells. Am. J. Physiol. 277: E862-E869.
  44. Wilson, J. R., T. J. Biden, R. I. Ludowyke. 1999. Increases in phosphorylation of the myosin II heavy chain, but not regulatory light chains, correlate with insulin secretion in rat pancreatic islets and RINm5F cells. Diabetes 48: 2383-2389. [Abstract]
  45. Buxton, D. B., R. S. Adelstein. 2000. Calcium-dependent threonine phosphorylation of nonmuscle myosin in stimulated RBL-2H3 mast cells. J. Biol. Chem. 275: 34772-34779. [Abstract/Free Full Text]
  46. Murakami, N., G. Healy-Louie, M. Elzinga. 1990. Amino acid sequence around the serine phosphorylated by casein kinase II in brain myosin heavy chain. J. Biol. Chem. 265: 1041-1047. [Abstract/Free Full Text]
  47. Ludowyke, R. I., I. Peleg, M. A. Beaven, R. S. Adelstein. 1989. Antigen-induced secretion of histamine and the phosphorylation of myosin by protein kinase C in rat basophilic leukemia cells. J. Biol. Chem. 264: 12492-12501. [Abstract/Free Full Text]
  48. Kriajevska, M., S. Tarabykina, I. Bronstein, N. Maitland, M. Lomonosov, K. Hansen, G. Georgiev, E. Lukanidin. 1998. Metastasis-associated Mts1 (S100A4) protein modulates protein kinase C phosphorylation of the heavy chain of nonmuscle myosin. J. Biol. Chem. 273: 9852-9856. [Abstract/Free Full Text]
  49. Straussman, R., L. Even, S. Ravid. 2001. Myosin II heavy chain isoforms are phosphorylated in an EGF-dependent manner: involvement of protein kinase C. J. Cell Sci. 114: 3047-3057.
  50. Kawakami, T., Y. Kawakami, J. Kitaura. 2002. Protein kinase Cbeta (PKCbeta): normal functions and diseases. J. Biochem. 132: 677-682. [Abstract/Free Full Text]
  51. Kawakami, Y., H. Nishimoto, J. Kitaura, M. Maeda-Yamamoto, R. M. Kato, D. R. Littman, M. Leitges, D. J. Rawlings, T. Kawakami. 2004. Protein kinase C betaII regulates Akt phosphorylation on Ser473 in a cell type- and stimulus-specific fashion. J. Biol. Chem. 279: 47720-47725. [Abstract/Free Full Text]
  52. Way, K. J., N. Katai, G. L. King. 2001. Protein kinase C and the development of diabetic vascular complications. Diabet. Med. 18: 945-959. [Medline]
  53. Gokmen-Polar, Y., N. R. Murray, M. A. Velasco, Z. Gatalica, A. P. Fields. 2001. Elevated protein kinase C betaII is an early promotive event in colon carcinogenesis. Cancer Res. 61: 1375-1381. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
K. B. Sanborn, G. D. Rak, S. Y. Maru, K. Demers, A. Difeo, J. A. Martignetti, M. R. Betts, R. Favier, P. P. Banerjee, and J. S. Orange
Myosin IIA Associates with NK Cell Lytic Granules to Enable Their Interaction with F-Actin and Function at the Immunological Synapse
J. Immunol., June 1, 2009; 182(11): 6969 - 6984.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
P. Bhat and P. Thorn
Myosin 2 Maintains an Open Exocytic Fusion Pore in Secretory Epithelial Cells
Mol. Biol. Cell, March 15, 2009; 20(6): 1795 - 1803.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ludowyke, R. I.
Right arrow Articles by Biden, T. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ludowyke, R. I.
Right arrow Articles by Biden, T. J.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*L-SERINE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS