|
|
||||||||
and the TCR
-Chain-FCp33 Complex1
Division of Thoracic Surgery, Department of Surgery, Brigham and Womens Hospital, Boston, MA 02115
| Abstract |
|---|
|
|
|---|
-chain (TCR
) and a 33-kDa protein, FCp33. The current study confirms that CD3
and TCR
expression are present on the FC at the time of transplantation and demonstrates that the majority of cells in the FC population express the TCR signaling molecule, FcR
, rather than the more conventional CD3
receptor. Of particular significance, we have now demonstrated that FC-mediated allogeneic SC reconstitution is critically dependent on FcR
expression and that FcR
coprecipitates with the TCR
-FCp33 heterodimer. The mandatory requirement of TCR
and FcR
for FC function provides the first evidence of a previously undescribed role for FcR
in the facilitation of allogeneic SC reconstitution and establishes that FcR
is part of the TCR
-FCp33 complex uniquely expressed on FC. | Introduction |
|---|
|
|
|---|
Immunoprecipitation studies of biotinylated FC lysates using the TCR
-chain (TCR
) or CD3
mAb revealed a unique 33-kDa protein named FCp33, together with TCR
and CD3
proteins in a single disulfide-linked complex on the FC cell surface (6). Recent studies have demonstrated that the majority of cells in the FC population express markers consistent with a plasmacytoid precursor dendritic cell (p-preDC) phenotype (5). Given that murine BM p-preDC have not been shown to express CD3
and TCR
on the cell surface, the importance of expression of these proteins on the FC has been questioned. However, several studies using knockout mice have demonstrated loss of facilitating function by the FC population when CD3
/, TCR
/, or RAG/ strains are used as FC donors (6, 7). These findings provide compelling evidence that CD3
and TCR
-chain gene expression are required for FC function and/or development.
TCR
-associated signal transduction occurs via the transmembrane immunotyrosine receptors CD3
and FcR
-chain (FcR
) (8, 9, 10, 11, 12), in association with the CD3

core complex expressed on T cells. In the setting of TCR expression, CD3
and FcR
are expressed as homodimers (
or 
) or heterodimers (
), and are associated with Ag receptor signal transduction in T cells and NKT cells (13, 14, 15, 16, 17, 18, 19). CD3
is the dominant TCR
-associated signal transduction molecule used by mature T cells. However, transfection of FcR
into CD3
/ cells has demonstrated that FcR
can function in TCR
signal transduction and induce IL-2 transcription in vitro, yet evidence of a distinct physiologic role for TCR
-FcR
signaling in mature T cells has not been described in vivo (14, 20, 21, 22, 23). Although originally described as the
-chain within the IgE receptor complex, FcR
is the signaling molecule for several other receptors including Fc
RIII (CD16) and the 
and 
TCRs (24).
Unlike mature alloreactive T cells, allogeneic FC transplantation is associated with the absence of GVHD and the induction of donor-specific tolerance, suggesting that TCR
signaling differs between mature T cells and the FC (3, 4). Although mature T cells preferentially express and use the CD3
homodimer, differences in CD3
or FcR
gene expression are noted during various stages of thymocyte development and presumably result in the use of alternative signaling pathways with specific downstream effects (12, 25, 26, 27, 28). These differences suggest that although both CD3
and FcR
are capable of functioning in TCR
-chain signaling, there is selective association with TCR
during cell development. Given the loss of function in FC derived from TCR
/ and CD3
/ donors, we hypothesized that FC function uses a TCR
-associated signaling pathway that is distinct from conventional alloreactive T cells responsible for GVHD.
The current study firmly establishes the molecular and biochemical expression of TCR
and CD3
within the FC population at the time of transplantation and investigates the mechanism of FC function in allogeneic reconstitution by assessing the expression and in vivo function of the TCR
-signaling molecules, CD3
and FcR
within the FC population. These findings further characterize the FC population and the unique TCR
-FCp33 complex. Notably, this is the first evidence for a physiologic and potentially clinically relevant role for a TCR
-FcR
complex in allogeneic hemopoietic SC reconstitution in vivo.
| Materials and Methods |
|---|
|
|
|---|
Six- to 8-wk-old female C57BL/6J (B6), B10.BRSgSnJ (B10.BR) CD3
/ (B6.129S4-CD3
tm1Lov), CD16/ (B6.129-Fc
R3tm1Sjv), and TCR
/ (B6.129P2-TCR
tm1Mom/J) mice were purchased from The Jackson Laboratory. FcR
/ (B6.129P2-Fcer1gtm1Rav/J) mice were purchased from Taconic Farms. All animals were housed in a specific pathogen-free facility at the Dana-Farber Cancer Institutes under the guidelines of the National Institutes of Health for care and use of laboratory animals.
Monoclonal Abs and flow cytometry
The following mAbs were used to sort CD8+TCR FC or CD8+CD3
+ TCR: anti-CD8
(53-6.7) PE, anti-TCR
(H57-597) FITC, anti-TCR 
chain (GL3) FITC, and anti-CD3
biotin (145-2C11) with secondary streptavidin (SA) PE-Cy5. To sort ScaI+c-kitdim/int SC: Ly6A/E (Sca-1) PE, c-kit biotin with secondary SA PE-Cy5, and a mixture of FITC-conjugated anti-lineage (Lin) mAbs: B220, CD8
, GR-1, CD11b, 
TCR, and 
TCR were used. To sort B220+CD11bCD11cdim/int p-preDC: anti-B220 allophycocyanin, anti-CD11b FITC, and anti-CD11c biotin, with SA PE-Cy5 were used. All sort mAb and the hamster IgG isotype control for CD3
were from BD Biosciences. Anti-FcR
Ab and rabbit IgG isotype control were purchased from Upstate Biotechnology, anti-CD3
(3F67) from U.S. Biological, and murine anti-PDCA-1 Ab was purchased from Miltenyi Biotec.
BM cell preparation
BM preparation was performed as previously described (3, 4). Briefly, BM was isolated from the long bones of mice by flushing with cold HBSS (Invitrogen Life Technologies). After washing with HBSS, BM cells were resuspended in sterile cell sort medium (CSM; Invitrogen Life Technologies) (CSM:HBSS without phenol red, 2% FCS, 2 µg/ml HEPES buffer and 30 µg/ml gentamicin).
Purified SC and FC sorting
SC and FC from donor BM were sorted as previously described (3, 4). Briefly, BM cells were incubated for 30 min at 4°C with mAbs listed previously, to isolate murine SC as ScaI+ c-kitdim/int Lin. After incubation with primary Abs, the cells were washed twice with CSM and incubated with SA PE-Cy5 for 30 min. BM-derived FC were similarly isolated as CD8+


TCR or as CD8
+CD3
+


TCR. Spleen T cells were isolated as CD8
+


TCR+ and p-preDC were purified as B220+CD11bCD11cdim/int phenotype. Cells were washed and resuspended to a final concentration of 2 x 108 cells/ml in CSM before multiparameter sterile live cell sorting within the conventional lymphoid gate on a MoFlo flow cytometric cell sorter (Cytomation). Postsort purity was determined with respect to forward and side scatter parameters and the designated cell surface markers. Postsort purity for all experimental samples was
90%.
BM transplantation (BMT)
For allogeneic BMT, B10.BR recipients were lethally irradiated (950cGy) followed by transplantation with 50,000 FC from donor BM of normal B6, CD3
/, FcR
/, TCR
/, or CD16/ mice and 10,000 purified donor SC obtained from normal B6 mice or control B10.BR mice received 10,000 donor SC alone. The syngeneic controls (B6 mice) received 2,000 purified donor SC obtained from B6 mice. To maintain homogeneity within a given experiment, recipients were of the same age, from same shipment of mice and underwent transplantation with donor populations. Allogeneic SC engraftment in the recipients was confirmed by flow cytometric PBL typing of donor MHC Ag expression 28 days posttransplant.
Surface protein biotinylation
Sulfo-N-hydroxy succinimidester-LC-biotin (Pierce) was used for surface protein biotinylation, as described previously (6). Sorted FC were washed in cold PBS (pH 8) and resuspended in 200 µl of 0.5 mg/ml sulfo-N-hydroxy succinimidester LC-biotin in PBS. Cells were rotated end-over-end for 30 min at room temperature. After the incubation, cell suspensions were diluted to 1 ml with cold PBS and centrifuged at 2000 x g for 10 min, followed by solubilization in lysis buffer (20 mM Tris-HCl (pH 7.6), 150 mM NaCl, and 1% digitonin with proteinase inhibitors PMSF, iodoacetamide, aprotinin, and leupeptin) for subsequent immunoprecipitation.
Immunoprecipitation and Western blotting
Surface biotinylated or nonbiotinylated cell pellets were solubilized in lysis buffer and immunoprecipitations were performed by preincubating anti-CD3
, anti-FcR
, or anti-TCR
Ab with protein G-Sepharose beads (Amersham Biosciences). Equal numbers of cells were compared in each experiment. Reduced SDS-PAGE was conducted as described previously (29) using reducing SDS sample buffer (4% SDS, 20% glycerol, 125 mM Tris-HCl (pH 6.8), 0.025% bromphenol blue, and 10% 2-ME). Protein Sepharose pellets of coprecipitates in sample buffer were separated by either 11.5 or 12.5% PAGE. The proteins were transferred to ECL-polyvinylidene difluoride membrane (Amersham Biosciences) in Tris-glycine transfer buffer (pH 8.3) (25 mM Tris, 192 mM glycine, and 20% methanol) and blocked with 5% milk in PBS-T (PBS (pH 7.4) with 0.05% Tween 20). The membranes were blotted with primary Ab (anti-CD3
or anti-FcR
) followed by blotting with HRP-conjugated secondary Abs. Biotinylated samples were blotted with SA-HRP. All blots were visualized using the Supersignal West Pico detection system (Pierce).
Intracellular staining
BM cells were harvested as previously described and resuspended in PBS. The cells were first stained extracellularly with surface Abs for CD8
(CD8
-PE) and TCR
and TCR
(


TCR-FITC) for 30 min at 4°C. The cells were washed with PBS-BSA buffer (PBS with 0.05% BSA) then fixed with 2% paraformaldehyde in PBS for 7 min at room temperature, followed by incubation with 300 µg/ml mouse IgG in PBS-BSA for 15 min. The cells were permeabilize with 0.05% Triton X-100 in PBS-BSA for 10 min at room temperature. Primary Abs for intracellular staining (anti-FcR
or isotype control rabbit IgG) were incubated for 45 min at 4°C. Goat anti-rabbit-Cy5 was used as the secondary Ab for intracellular FcR
staining (Jackson Immunological) and was incubated for 40 min at 4°C. Cells were washed twice in PBS-BSA and resuspended in 2% paraformaldehyde in PBS.
RNA isolation and conventional RT-PCR
Total RNA was isolated from FC, p-preDC, and Spleen T cells using the RNeasy System (Qiagen) and converted to cDNA (Ambion), as recommended by the manufacturers. Primer sequences for FcR
, CD3
, CD3
, CD3
, CD3
,
-actin, and TCR
were selected from published sequences for conventional PCR amplification (7, 15, 30).
-actin, FcR
, CD3

, and CD3
cDNAs were amplified for 35 cycles using cycling conditions 1 min each at 94°C, 57°C, and 72°C. TCR
cDNA was amplified for 40 cycles with cycling conditions 1 min at 94°C, 2 min at 60°C, and 3 min at 72°C with a final extension of 10 min at 72°C. PCR products were visualized on a 1.5% agarose gel stained with ethidium bromide (EtBr).
Real-time quantitative RT-PCR
Real-time PCR was performed using 13 µl of FC cDNA mixed with diethyl pyrocarbonate-treated water, SYBR green PCR master mix (Applied Biosystems) and the primer pair for CD3
(sense, CAATCCTGTGCCAGCGTCTT and antisense, TGGCCATGGACTCCACAGA) or FcR
(sense, CAAGAT CCAGGTCCGAAAGG and antisense, GCATCTGCTTTCTCACGGCT) in a 20-µl reaction. The specific primer pairs used were designed with Primer Express software (Applied Biosystems). The specific cDNAs were amplified for 40 cycles using the Gene Amp 5700 Sequence Detection System (Applied Biosystems). Nontemplate controls and dissociation curves were used to detect nonspecific amplification and the formation of primer-dimers. All experiments were run in duplicate and gene expression was normalized to the expression of the housekeeping gene, GAPDH.
Southern blotting
TCR
transcript was amplified by conventional PCR using cDNA from FC, T cells (positive control), or p-preDC (negative control). The PCR products were electrophoresed for
1 h at 100 V on a 1.5% agarose gel. Gels were stained with EtBr at 1 µg/ml, rinsed and photographed under UV light. Capillary transfer was performed to transfer the DNA to the membrane (31).
Prehybridization
All membranes were briefly rinsed in 3x standard saline citrate phosphate/EDTA, air-dried for 15 min and cross-linked for 2 h at 8090°C. Prehybridization was performed using 1x Perfect-Hyb Plus hybridization buffer (Sigma-Aldrich) for 1 h at 40°C.
Hybridization
Five micrograms of biotin-conjugated DNA oligonucleotide probe, complementary to an internal region of the mature TCR
transcript, was added to the solution and all membranes were incubated overnight at 40°C. Membranes were rinsed and washed with 1x PBST for 10 min then blocked with 0.5% nonfat milk in PBST for 30 min followed by 1-h incubation in SA-HRP solution. The membranes were washed for 1.5 h in PBS-T. Chemiluminescence was detected using the Super Signal West Pico detection system.
| Results |
|---|
|
|
|---|
transcription and protein expression by the FC at the time of transplantation
Although initially characterized as CD8+CD3
+
TCR and 
TCR (


TCR), significant controversy remains as to the identity and characteristic phenotype of the FC. The CD8+TCR FC population contains both CD3
low and negative subsets as demonstrated by flow cytometric analysis of protein expression (6, 7). However, given the low level of CD3
expression detected on the FC some investigators have questioned whether CD3
is intrinsic to the FC at the time of transplantation.
In the setting of this controversy, we have characterized the gene transcription and protein expression of CD3
within the CD8+CD3
+


TCR FC population to establish that CD3
surface expression was not merely the result of increased background staining. As shown in Fig. 1A, CD3
protein expression as established vs an isotype control within the CD8
+


TCR FC population is characterized by a CD3
+ population (7.2 ± 0.27%) and a large CD3
population. The CD3
+ FC subset, purified from C57BL/6 (B6) BM using high-speed flow cytometric cell sorting within the lymphoid gate, was analyzed for gene expression of CD3
and the other components of the CD3 core, CD3
, and
using RT-PCR. As demonstrated in Fig. 1B, the CD3 core transcripts CD3
, CD3
, and CD3
are expressed within the CD3
+ FC population. These results establish that CD3
gene and protein expression are present within a subset of the FC population at the time of transplantation and corroborates the requirement for CD3
previously identified in the in vivo knockout studies (7). Given recent reports that demonstrated the FC population contains a p-preDC subset (5) and p-preDC have not been shown to express surface CD3
, we hypothesized that p-preDC reside in the CD3
FC subset. Using flow cytometric analysis, 99.8 ± 0.1% of all FC cells positive for the p-preDC marker (PDCA-1) are contained within the CD3
FC subset. These findings support previous reports demonstrating the absence of surface CD3
on p-preDC.
|
expression by the FC
Similar to FC isolated from CD3
/ donors, the failure of RAG/ or TCR
/ FC donors to facilitate allogeneic SC engraftment across complete MHC barriers suggested that TCR
rearrangement and expression must occur within the FC population. Unfortunately, an Ab capable of Western blotting the murine TCR
protein has not been identified and therefore coprecipitation studies have been used as evidence that TCR
protein is present within the FC (6). We hypothesize that the presence of TCR
transcription in normal FC would suggest that the loss of facilitating function by RAG/ and TCR
/ FC donors was due to the need for TCR
expression on the FC at the time of transplantation. In contrast, the absence of TCR
transcript in normal FC would suggest that RAG/ and TCR
/ FC do not facilitate secondary to a failure in FC development. To determine whether the TCR
transcript is present within the FC at the time of cotransplantation with allogeneic SC, total RNA was isolated from 20,000 FC, T cells (positive control) and B220+CD11bCD11cdim/int p-preDC (negative control) and analyzed for the presence of mature TCR
transcript. RT-PCR was performed and the PCR products were analyzed by Southern blotting using an internal probe complementary to the mature TCR
transcript. As evident in Fig. 2, the TCR
transcript was detected in both the T cell and FC populations. However, as expected the p-preDC population does not express the TCR
transcript, corroborating previous reports demonstrating the absence of the TCR
transcript in murine p-preDC. Importantly, the presence of TCR
transcript in the FC and the failure of TCR
/ FC to facilitate SC reconstitution demonstrate that the requirement for TCR
is characteristic of an FC subset separate from p-preDC yet critical to FC-mediated SC reconstitution.
|
and TCR
transcripts are present within the FC population at the time of transplantation with allogeneic SC. Evidence that FC-mediated reconstitution is dependent on protein expression of CD3
and TCR
on the FC, together with the description of the TCR
-FCp33 receptor (6, 7), provides significant evidence that a functional TCR
receptor complex is present on the FC and is required for FC-mediated SC reconstitution. We hypothesized that the TCR
-dependent FC function in FC-mediated SC reconstitution is dependent on one of the two described TCR
signaling molecules, CD3
or FcR
.
FcR
expression is critical for reconstitution of allogeneic hemopoietic SC in vivo.
The TCR
has the ability to associate with and use immunotyrosine receptors CD3
or FcR
. We asked whether CD3
or FcR
is critical for FC-mediated reconstitution of allogeneic SC in vivo and further characterized the nature of FC function using CD3
/ and FcR
/ mice. Lethally irradiated (950 cGy) B10.BR mice were reconstituted with 10,000 donor SC isolated from normal B6 mice coadministered with 50,000 donor FC obtained from normal B6, CD3
/, or FcR
/ mice (Fig. 3). Control B10.BR mice received 10,000 allogeneic SC alone and syngeneic B6 mice served as controls for SC reconstitution and received 2,000 SC alone (Table I). FC were isolated by flow cytometric cell sorting for the standard CD8+


TCR FC phenotype to compare our results with the previously established SC + FC model. Previous studies have shown that donor FC alone do not engraft nor induce tolerance. Furthermore, lethally irradiated B10.BR recipients of SC alone failed to survive longer than 25 days, as allogeneic SC alone do not reconstitute (Table I). As expected, the transplantation of SC plus FC from normal B6 donors into lethally irradiated B10.BR recipients resulted in 100% survival (Fig. 3). Surprisingly, B10.BR recipients reconstituted with SC from B6 donors and FC derived from CD3
/ donors also survived and engrafted, demonstrating that CD3
is not critical for FC function in allogeneic SC reconstitution (Fig. 3). The reconstituted recipients demonstrated >90% donor B6 chimerism. In contrast, all recipients reconstituted with B6 SC and FC from FcR
/ donors failed to engraft resulting in a 35-day mortality of 100% (Fig. 3). Moreover, the failure of engraftment is not due to loss of p-preDC because FcR
/ and normal B6 mice have similar numbers of p-preDC as determined by B220+CD11bCD11cdim/int flow cytometric analysis (4.5 ± 1.2% and 3.6 ± 0.9%, respectively). These findings suggest that FC-mediated SC reconstitution may be critically dependent on the expression of FcR
within a different FC subset.
|
|
expression is important in CD16 function, we addressed the possibility that the requirement for TCR
and FcR
expression may reflect the coexpression of these molecules, with FcR
functioning as part of the CD16 receptor independent of the TCR
. Therefore, lethally irradiated B10.BR mice were reconstituted with SC isolated from normal B6 mice coadministered with FC isolated from the BM of normal B6 mice or CD16/ donors. As expected, all SC + FC recipients of normal B6 inocula survived. Similarly, recipients of FC isolated from CD16/ donors also exhibited 100% survival at 45 days (Table I). Donor lymphocyte typing of these recipients demonstrated 90.2 ± 6.4% donor chimerism, confirming that FC from CD16/ donors are capable of promoting allogeneic donor SC reconstitution. A composite of the in vivo experimental findings for controls and CD16/, CD3
/, TCR
/, and FcR
/ FC donors is shown in Table I.
The FC expresses high levels of the FcR
transcript
The current in vivo studies have now shown that FcR
and TCR
expression is required for FC function. We next characterized FcR
expression within the FC at the molecular level. FC were analyzed for gene expression of CD3
and FcR
. Studies of early thymic cell development have demonstrated that FcR
gene expression is greater than CD3
expression within the precursor cells of early maturing thymocytes (12, 27). Therefore, it is likely that differential gene expression could be directly associated with the selective use of one of these proteins within FC, likely FcR
. To assess differential gene expression within FC, real-time quantitative PCR was performed using equal concentrations of cDNA from FC. Gene expression of CD3
and FcR
in FC was normalized to GAPDH gene expression and is shown as percent of GAPDH. FcR
gene expression within the FC population is significantly greater than CD3
expression (Fig. 4A). Moreover, the difference in gene expression was further confirmed by analysis of PCR products on an EtBr-stained agarose gel (Fig. 4B).
|
-expressing cells are predominant within the FC population
We subsequently investigated whether the higher FcR
gene expression in the FC population results in predominant expression of the FcR
protein by Western blotting and FACS analysis. Equal numbers of FC and T cells were solubilized and sequentially immunoprecipitated with anti-FcR
followed by anti-CD3
Abs. Subsequent analysis of protein expression by Western blotting revealed that within the FC population FcR
protein expression is greater than CD3
, which was extremely low or undetectable (Fig. 5A). As expected, CD3
was abundant in lysates from T cells. Similar results were seen when CD3
immunoprecipitations were performed first. To assess the degree of FcR
expression in terms of the percentage of FcR
+ cells, intracellular staining of FcR
within the FC was performed and revealed that 84.13 ± 9% of the FC population expresses FcR
(Fig. 5B).
|
is associated with the TCR
complex on FC
Given the abundance of FcR
expression on FC and the dependence of FC-mediated SC reconstitution on FcR
and TCR
expression, we next examined whether FcR
associates with the TCR
complex on the FC in vitro, as part of the TCR
-FCp33 receptor complex critical for FC-mediated SC reconstitution. Such an association would offer rationale to explain the absence of FC function in TCR
and FcR
-deficient donors. To confirm this hypothesis, immunoprecipitation of FC lysates were performed using anti-TCR
Ab. TCR
immunoprecipitation of surface biotinylated FC lysates demonstrates the presence of the TCR
-FCp33 receptor on the FC (Fig. 6A). Subsequent Western blotting with anti-FcR
Ab of nonbiotinylated FC lysates following TCR
immunoprecipitation revealed the 12-kDa FcR
protein within the TCR
immunoprecipitated complex on the FC (Fig. 6B). These results provide evidence that FcR
is associated with the unique TCR
-FCp33 receptor complex expressed on an FC subset and previously shown to be critical for FC-mediated SC reconstitution.
|
| Discussion |
|---|
|
|
|---|
+


TCR FC subset (3, 4). Subsequent in vivo studies characterizing FC-mediated allogeneic SC reconstitution revealed the unexpected dependence on both CD3
and TCR
expression by FC, as FC derived from CD3
/ and TCR
/ donors fail to facilitate allogeneic SC reconstitution (6, 7). Biochemical analysis has resolved this dichotomy by demonstrating that the TCR
is present on FC, but not within the conventional 
TCR complex. Instead, TCR
on the FC is disulfide linked to FCp33, a unique 33-kDa protein that is distinct from previously described TCR proteins including pre-TCR
(6). Furthermore, the TCR
-FCp33 heterodimer coprecipitates with CD3
.
In the current study, we provide further molecular and in vivo functional characterization of the FC population and the TCR
-FCp33 complex. Given that in vivo facilitation is dependent on TCR
expression (6), evidence for the presence of a TCR
-associated signaling molecule in FC would provide insight into the mechanisms associated with FC-mediated SC reconstitution. We now show for the first time that the FC function is dependent on the expression of the TCR
-associated signaling molecule FcR
, as demonstrated by the failure of FC derived from FcR
/ donors to facilitate allogeneic SC reconstitution (Fig. 3). In contrast, facilitation of alloreconstitution is undeterred when FC from CD3
/ or CD16/ donors are used (Fig. 3 and Table I).
Fugier-Vivier et al. (5) showed that the majority of the CD8+


TCR FC population consists of a B220+CD11c+ phenotype that resembles plasmacytoid precursor dendritic cells (p-preDC), a DC subset that does not express CD3
and TCR
on the cell surface. It is important to note that the FC population in these studies was isolated as CD8+


TCR and thus included a CD3
subset in which p-preDC should reside. Fig. 1 demonstrates that CD8+


TCR FC population contains both a CD3
+ and CD3
subset. Fig. 2 confirms that cells other than p-preDC are also contained in the FC population as the TCR
transcript is not present within the p-preDC population, but is clearly identified in the CD8+


TCR FC population. Because facilitation has been shown to be dependent on CD3
and TCR
expression, and p-preDC express neither, it is not unexpected that p-preDC do not facilitate SC reconstitution as effectively as the entire CD8+


TCR FC population or the CD3
+ FC subset (3, 4, 5). Together with the present data, this evidence supports the hypothesis that TCR
, CD3
and FcR
expression is intrinsic to the FC at the time of transplantation and are required for FC-mediated SC reconstitution. We now show that all three required components are incorporated within the TCR
-FCp33 receptor complex present within the FC population.
The FC requirement for TCR
and FcR
but not CD3
expression for facilitation is similar to studies of early thymic cell development in which FcR
gene expression is greater than CD3
expression within thymic precursor cells. Such differential expression suggests that CD3
and FcR
are not merely interchangeable, but in fact demonstrate specificity requirements during the development of self tolerance in thymocytes (12, 15, 25, 27). Similarly, we now demonstrate that FcR
gene expression is dominant within the FC population (Fig. 4), at a time when the FC is involved in the establishment of SC reconstitution and the induction of transplantation tolerance. We have also demonstrated that the dominance in FcR
gene expression directly correlates with the predominant expression of FcR
protein (Fig. 5). Interestingly, the extent of FcR
expression (84 ± 9%) suggests that at least some p-preDC within the FC population are FcR
positive. Therefore, it is possible that p-preDC development is inhibited in FcR
/ donors resulting in the loss of FC-mediated SC reconstitution. We have excluded this hypothesis by demonstrating that the percent of BM p-preDC in FcR
/ and normal B6 donors is similar at 4.5 ± 1.2% and 3.6 ± 0.9%, respectively. Thus, the loss of facilitation when using FcR
/ donor is not due to the absence of p-preDC and therefore suggests a difference in the signaling requirement for FC and p-preDC function in facilitation. This is consistent with the absence of CD3
and TCR
expression on the p-preDC as demonstrated in this study and the less efficient facilitation of SC reconstitution exhibited by p-preDC as demonstrated by Fugier-Vivier et al. (5).
Given the requirement for TCR
expression and the predominance of FcR
-expressing cells within the FC population, we hypothesized that FcR
associates with the TCR
-FCp33 complex present on a subset of the FC. This hypothesis was supported by TCR
-FcR
coprecipitation studies and subsequently supports the hypothesis that the signaling requirement for the less efficient p-preDC population differs from the FC subset that contains the TCR
-FCp33-FcR
(Fig. 6).
Although the functional importance of TCR
signaling via FcR
in hemopoietic SC reconstitution in vivo has not previously been identified, the concept that FcR
plays an important role in hemopoietic SC reconstitution and induction of tolerance has gained support through investigations with NK cells. The CD16 receptor on NK cells plays a pivotal role in fetal thymocyte and NK/NKT development via an FcR
-signaling pathway, and cross-linking of the CD16 receptor expressed on pre-T cells has been shown to alter development and induces a higher ratio of 
to 
T cells (32). Demonstration that immature thymocytes that express FcR
and CD16 contain precursors for both NK cells and 
T cells, suggests that CD16-FcR
signaling is essential to early precursor development and thus may also play a role in FC development. The dual dependence of allogeneic SC reconstitution on TCR
and FcR
expression suggests that FC use either a common TCR
-FcR
complex, as demonstrated in early thymocytes in vitro, or independent TCR
and FcR
-signaling pathways, as in NKT cells which use both TCR
-CD3
and CD16-FcR
-signaling pathways. This latter possibility was effectively excluded by demonstrating that FC derived from CD3
/ or CD16/ donors remain functional and result in reconstitution of allogeneic SC across complete MHC barriers (Table I). Therefore, the demonstration that the FC function requires FcR
, but not CD3
or CD16 expression, suggests the presence of an alternative FcR
-associated receptor complex. This association was demonstrated by the coprecipitation of TCR
, FCp33, and FcR
from the FC population and provides the first evidence that a TCR
-FcR
complex is associated with FC-mediated allogeneic SC reconstitution (Fig. 6).
In summary, these studies establish the expression of TCR
and CD3
within the FC population at the time of transplantation. Furthermore, the FC population is distinct from conventional T cells and contains a CD3
+ subset separate from the less efficient facilitating p-preDC cells that do not express CD3
or TCR
proteins. In contrast to CD3
, a protein that does not affect allogeneic SC reconstitution, we have demonstrated that FcR
expression is critically important for FC-mediated facilitation of allogeneic SC reconstitution in vivo. The coprecipitation studies revealed that FcR
associates with the TCR
-FCp33 receptor, known to be required for facilitation of allogeneic SC reconstitution in vivo. Further characterization of the TCR
-FCp33-FcR
complex and FcR
-dependent signaling will be critical to understanding the mechanism by which the FC facilitates allogeneic SC reconstitution and for the identification of potential therapeutic targets for the clinical induction of tolerance in the future.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by Grant R01 HL074150-01 from the National Institutes of Health. ![]()
2 Address correspondence and reprint requests to Dr. Yolonda L. Colson, Division of Thoracic Surgery, Department of Surgery, Brigham and Womens Hospital, 75 Francis Street, Boston, MA 02115. E-mail address: ylcolson{at}bics.bwh.harvard.edu ![]()
3 Abbreviations used in this paper: SC, stem cell; GVHD, graft-vs-host disease; BM, bone marrow; FC, facilitating cell; p-preDC, plasmacytoid precursor dendritic cell; TCR
, TCR
-chain; CSM, cell sort medium; BMT, BM transplantation, SA, streptavidin; EtBr, ethidium bromide; int, intermediate. ![]()
Received for publication December 29, 2005. Accepted for publication April 28, 2006.
| References |
|---|
|
|
|---|
-chain heterodimer expressed on a CD8+ bone marrow subpopulation that promotes allogeneic stem cell engraftment. Nat. Med. 6: 904-909. [Medline]
and
chains of the T-cell receptor and the
chain of Fc receptors. Nature 347: 189-191. [Medline]
chain to the surface expression of the T cell receptor among T cells localized in epithelia: analysis of FcR
-deficient mice. Eur. J. Immunol. 25: 2107-2110. [Medline]
expression promotes maturation of T cells expressing Fc
RI
containing TCR/CD3 complexes. J. Immunol. 166: 6616-6624.
receptor and the mast cell receptor for IgE share an identical subunit. Nature 341: 752-754. [Medline]
subunit (Fc
RI
) facilitates T cell receptor expression and antigen/major histocompatibility complex-driven signaling in the absence of CD3
and CD3
. J. Biol. Chem. 266: 15974-15978.
-
TCR+CD4CD8 and
-
TCR+CD4CD8 cells. J. Exp. Med. 179: 1957-1972.
/
+ T cells and expansion of NK1.1+ TCR-
/
+ T cell development in CD3
-deficient mice. J. Exp. Med. 182: 891-895.
-Fc
RI
heterodimers on CD4CD8 NK1.1+ T cells selected by specific class I MHC antigen. Immunity 3: 427-438. [Medline]
. Int. Immunol. 7: 287-293.
-chains in immature thymocytes. J. Immunol. 162: 2589-2596.
/ mutant mice and identification of a novel T cell population in the intestine. EMBO J. 12: 4863-4875. [Medline]
/
gene. EMBO J. 12: 4347-4355. [Medline]
chain and a 33 kd glycoprotein. Cell 75: 283-294. [Medline]
RII/III+ T and natural killer cell precursors in Fc
RI
transgenic mice. J. Exp. Med. 184: 1725-1735.
: implications for the mechanism of pT
action. J. Immunol. 161: 11-16.
-receptor ligand: potential role in T-cell development. Proc. Natl. Acad. Sci. USA 91: 12857-12861. This article has been cited by other articles:
![]() |
T. Banovic, K. A. Markey, R. D. Kuns, S. D. Olver, N. C. Raffelt, A. L. Don, M. A. Degli-Esposti, C. R. Engwerda, K. P. A. MacDonald, and G. R. Hill Graft-versus-Host Disease Prevents the Maturation of Plasmacytoid Dendritic Cells J. Immunol., January 15, 2009; 182(2): 912 - 920. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bridenbaugh, L. Kenins, E. Bouliong-Pillai, C. P. Kalberer, E. Shklovskaya, A. Gratwohl, and A. Wodnar-Filipowicz Clinical stem-cell sources contain CD8+CD3+ T-cell receptor-negative cells that facilitate bone marrow repopulation with hematopoietic stem cells Blood, February 1, 2008; 111(3): 1735 - 1738. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. N. Taylor, V. R. Shinde-Patil, E. Cohick, and Y. L. Colson Induction of FoxP3+CD4+25+ Regulatory T Cells Following Hemopoietic Stem Cell Transplantation: Role of Bone Marrow-Derived Facilitating Cells J. Immunol., August 15, 2007; 179(4): 2153 - 2162. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |