HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Taylor, K. N. Articles by Colson, Y. L. Search for Related Content PubMed PubMed Citation Articles by Taylor, K. N. Articles by Colson, Y. L.

Reconstitution of Allogeneic Hemopoietic Stem Cells: The Essential Role of FcR and the TCR -Chain-FCp33 Complex¹

Division of Thoracic Surgery, Department of Surgery, Brigham and Women’s Hospital, Boston, MA 02115

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Transplantation of purified allogeneic hemopoietic stem cells (SC) alone is characterized by a decreased risk of graft-vs-host disease but increased incidence of engraftment failure. It has been established that the facilitating cell (FC) promotes allogeneic SC reconstitution and results in donor-specific transplantation tolerance across MHC disparities, without graft-vs-host disease. Although the requirements for this facilitating function are not well-characterized, it is known that facilitation is dependent on FC expression of a unique heterodimer consisting of the TCR -chain (TCR) and a 33-kDa protein, FCp33. The current study confirms that CD3 and TCR expression are present on the FC at the time of transplantation and demonstrates that the majority of cells in the FC population express the TCR signaling molecule, FcR, rather than the more conventional CD3 receptor. Of particular significance, we have now demonstrated that FC-mediated allogeneic SC reconstitution is critically dependent on FcR expression and that FcR coprecipitates with the TCR-FCp33 heterodimer. The mandatory requirement of TCR and FcR for FC function provides the first evidence of a previously undescribed role for FcR in the facilitation of allogeneic SC reconstitution and establishes that FcR is part of the TCR-FCp33 complex uniquely expressed on FC.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The transplantation of purified allogeneic hemopoietic stem cells (SC)³ decreases the risk of graft-vs-host disease (GVHD), yet fails to establish reliable reconstitution capable of rescuing MHC-disparate allogeneic recipients from radiation-induced aplasia (1, 2, 3). These early studies suggested that additional cell types are required for SC alloengraftment across complete MHC barriers. Cotransplantation studies using purified allogeneic SC have demonstrated that the donor bone marrow (BM)-derived facilitating cell (FC) population permits reliable SC reconstitution across MHC-disparate barriers, results in donor-specific transplantation tolerance, and does not induce GVHD (3, 4, 5).

Immunoprecipitation studies of biotinylated FC lysates using the TCR -chain (TCR) or CD3 mAb revealed a unique 33-kDa protein named FCp33, together with TCR and CD3 proteins in a single disulfide-linked complex on the FC cell surface (6). Recent studies have demonstrated that the majority of cells in the FC population express markers consistent with a plasmacytoid precursor dendritic cell (p-preDC) phenotype (5). Given that murine BM p-preDC have not been shown to express CD3 and TCR on the cell surface, the importance of expression of these proteins on the FC has been questioned. However, several studies using knockout mice have demonstrated loss of facilitating function by the FC population when CD3^–/–, TCR^–/–, or RAG^–/– strains are used as FC donors (6, 7). These findings provide compelling evidence that CD3 and TCR-chain gene expression are required for FC function and/or development.

TCR-associated signal transduction occurs via the transmembrane immunotyrosine receptors CD3 and FcR-chain (FcR) (8, 9, 10, 11, 12), in association with the CD3 core complex expressed on T cells. In the setting of TCR expression, CD3 and FcR are expressed as homodimers ( or ) or heterodimers (), and are associated with Ag receptor signal transduction in T cells and NKT cells (13, 14, 15, 16, 17, 18, 19). CD3 is the dominant TCR-associated signal transduction molecule used by mature T cells. However, transfection of FcR into CD3^–/– cells has demonstrated that FcR can function in TCR signal transduction and induce IL-2 transcription in vitro, yet evidence of a distinct physiologic role for TCR-FcR signaling in mature T cells has not been described in vivo (14, 20, 21, 22, 23). Although originally described as the -chain within the IgE receptor complex, FcR is the signaling molecule for several other receptors including FcRIII (CD16) and the and TCRs (24).

Unlike mature alloreactive T cells, allogeneic FC transplantation is associated with the absence of GVHD and the induction of donor-specific tolerance, suggesting that TCR signaling differs between mature T cells and the FC (3, 4). Although mature T cells preferentially express and use the CD3 homodimer, differences in CD3 or FcR gene expression are noted during various stages of thymocyte development and presumably result in the use of alternative signaling pathways with specific downstream effects (12, 25, 26, 27, 28). These differences suggest that although both CD3 and FcR are capable of functioning in TCR-chain signaling, there is selective association with TCR during cell development. Given the loss of function in FC derived from TCR^–/– and CD3^–/– donors, we hypothesized that FC function uses a TCR-associated signaling pathway that is distinct from conventional alloreactive T cells responsible for GVHD.

The current study firmly establishes the molecular and biochemical expression of TCR and CD3 within the FC population at the time of transplantation and investigates the mechanism of FC function in allogeneic reconstitution by assessing the expression and in vivo function of the TCR-signaling molecules, CD3 and FcR within the FC population. These findings further characterize the FC population and the unique TCR-FCp33 complex. Notably, this is the first evidence for a physiologic and potentially clinically relevant role for a TCR-FcR complex in allogeneic hemopoietic SC reconstitution in vivo.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Animals

Six- to 8-wk-old female C57BL/6J (B6), B10.BRSgSnJ (B10.BR) CD3^–/– (B6.129S4-CD3^tm1Lov), CD16^–/– (B6.129-FcR3^tm1Sjv), and TCR^–/– (B6.129P2-TCR^tm1Mom/J) mice were purchased from The Jackson Laboratory. FcR^–/– (B6.129P2-Fcer1g^tm1Rav/J) mice were purchased from Taconic Farms. All animals were housed in a specific pathogen-free facility at the Dana-Farber Cancer Institutes under the guidelines of the National Institutes of Health for care and use of laboratory animals.

Monoclonal Abs and flow cytometry

The following mAbs were used to sort CD8⁺TCR^– FC or CD8⁺CD3⁺ TCR^–: anti-CD8 (53-6.7) PE, anti-TCR (H57-597) FITC, anti-TCR chain (GL3) FITC, and anti-CD3 biotin (145-2C11) with secondary streptavidin (SA) PE-Cy5. To sort ScaI⁺c-kit^dim/int SC: Ly6A/E (Sca-1) PE, c-kit biotin with secondary SA PE-Cy5, and a mixture of FITC-conjugated anti-lineage (Lin^–) mAbs: B220, CD8, GR-1, CD11b, TCR, and TCR were used. To sort B220⁺CD11b^–CD11c^dim/int p-preDC: anti-B220 allophycocyanin, anti-CD11b FITC, and anti-CD11c biotin, with SA PE-Cy5 were used. All sort mAb and the hamster IgG isotype control for CD3 were from BD Biosciences. Anti-FcR Ab and rabbit IgG isotype control were purchased from Upstate Biotechnology, anti-CD3 (3F67) from U.S. Biological, and murine anti-PDCA-1 Ab was purchased from Miltenyi Biotec.

BM cell preparation

BM preparation was performed as previously described (3, 4). Briefly, BM was isolated from the long bones of mice by flushing with cold HBSS (Invitrogen Life Technologies). After washing with HBSS, BM cells were resuspended in sterile cell sort medium (CSM; Invitrogen Life Technologies) (CSM:HBSS without phenol red, 2% FCS, 2 µg/ml HEPES buffer and 30 µg/ml gentamicin).

Purified SC and FC sorting

SC and FC from donor BM were sorted as previously described (3, 4). Briefly, BM cells were incubated for 30 min at 4°C with mAbs listed previously, to isolate murine SC as ScaI⁺ c-kit^dim/int Lin^–. After incubation with primary Abs, the cells were washed twice with CSM and incubated with SA PE-Cy5 for 30 min. BM-derived FC were similarly isolated as CD8⁺TCR^– or as CD8⁺CD3⁺TCR^–. Spleen T cells were isolated as CD8⁺TCR⁺ and p-preDC were purified as B220⁺CD11b^–CD11c^dim/int phenotype. Cells were washed and resuspended to a final concentration of 2 x 10⁸ cells/ml in CSM before multiparameter sterile live cell sorting within the conventional lymphoid gate on a MoFlo flow cytometric cell sorter (Cytomation). Postsort purity was determined with respect to forward and side scatter parameters and the designated cell surface markers. Postsort purity for all experimental samples was 90%.

BM transplantation (BMT)

For allogeneic BMT, B10.BR recipients were lethally irradiated (950cGy) followed by transplantation with 50,000 FC from donor BM of normal B6, CD3^–/–, FcR^–/–, TCR^–/–, or CD16^–/– mice and 10,000 purified donor SC obtained from normal B6 mice or control B10.BR mice received 10,000 donor SC alone. The syngeneic controls (B6 mice) received 2,000 purified donor SC obtained from B6 mice. To maintain homogeneity within a given experiment, recipients were of the same age, from same shipment of mice and underwent transplantation with donor populations. Allogeneic SC engraftment in the recipients was confirmed by flow cytometric PBL typing of donor MHC Ag expression 28 days posttransplant.

Surface protein biotinylation

Sulfo-N-hydroxy succinimidester-LC-biotin (Pierce) was used for surface protein biotinylation, as described previously (6). Sorted FC were washed in cold PBS (pH 8) and resuspended in 200 µl of 0.5 mg/ml sulfo-N-hydroxy succinimidester LC-biotin in PBS. Cells were rotated end-over-end for 30 min at room temperature. After the incubation, cell suspensions were diluted to 1 ml with cold PBS and centrifuged at 2000 x g for 10 min, followed by solubilization in lysis buffer (20 mM Tris-HCl (pH 7.6), 150 mM NaCl, and 1% digitonin with proteinase inhibitors PMSF, iodoacetamide, aprotinin, and leupeptin) for subsequent immunoprecipitation.

Immunoprecipitation and Western blotting

Surface biotinylated or nonbiotinylated cell pellets were solubilized in lysis buffer and immunoprecipitations were performed by preincubating anti-CD3, anti-FcR, or anti-TCR Ab with protein G-Sepharose beads (Amersham Biosciences). Equal numbers of cells were compared in each experiment. Reduced SDS-PAGE was conducted as described previously (29) using reducing SDS sample buffer (4% SDS, 20% glycerol, 125 mM Tris-HCl (pH 6.8), 0.025% bromphenol blue, and 10% 2-ME). Protein Sepharose pellets of coprecipitates in sample buffer were separated by either 11.5 or 12.5% PAGE. The proteins were transferred to ECL-polyvinylidene difluoride membrane (Amersham Biosciences) in Tris-glycine transfer buffer (pH 8.3) (25 mM Tris, 192 mM glycine, and 20% methanol) and blocked with 5% milk in PBS-T (PBS (pH 7.4) with 0.05% Tween 20). The membranes were blotted with primary Ab (anti-CD3 or anti-FcR) followed by blotting with HRP-conjugated secondary Abs. Biotinylated samples were blotted with SA-HRP. All blots were visualized using the Supersignal West Pico detection system (Pierce).

Intracellular staining

BM cells were harvested as previously described and resuspended in PBS. The cells were first stained extracellularly with surface Abs for CD8 (CD8-PE) and TCR and TCR (TCR-FITC) for 30 min at 4°C. The cells were washed with PBS-BSA buffer (PBS with 0.05% BSA) then fixed with 2% paraformaldehyde in PBS for 7 min at room temperature, followed by incubation with 300 µg/ml mouse IgG in PBS-BSA for 15 min. The cells were permeabilize with 0.05% Triton X-100 in PBS-BSA for 10 min at room temperature. Primary Abs for intracellular staining (anti-FcR or isotype control rabbit IgG) were incubated for 45 min at 4°C. Goat anti-rabbit-Cy5 was used as the secondary Ab for intracellular FcR staining (Jackson Immunological) and was incubated for 40 min at 4°C. Cells were washed twice in PBS-BSA and resuspended in 2% paraformaldehyde in PBS.

RNA isolation and conventional RT-PCR

Total RNA was isolated from FC, p-preDC, and Spleen T cells using the RNeasy System (Qiagen) and converted to cDNA (Ambion), as recommended by the manufacturers. Primer sequences for FcR, CD3, CD3, CD3, CD3, -actin, and TCR were selected from published sequences for conventional PCR amplification (7, 15, 30). -actin, FcR, CD3, and CD3 cDNAs were amplified for 35 cycles using cycling conditions 1 min each at 94°C, 57°C, and 72°C. TCR cDNA was amplified for 40 cycles with cycling conditions 1 min at 94°C, 2 min at 60°C, and 3 min at 72°C with a final extension of 10 min at 72°C. PCR products were visualized on a 1.5% agarose gel stained with ethidium bromide (EtBr).

Real-time quantitative RT-PCR

Real-time PCR was performed using 1–3 µl of FC cDNA mixed with diethyl pyrocarbonate-treated water, SYBR green PCR master mix (Applied Biosystems) and the primer pair for CD3 (sense, CAATCCTGTGCCAGCGTCTT and antisense, TGGCCATGGACTCCACAGA) or FcR (sense, CAAGAT CCAGGTCCGAAAGG and antisense, GCATCTGCTTTCTCACGGCT) in a 20-µl reaction. The specific primer pairs used were designed with Primer Express software (Applied Biosystems). The specific cDNAs were amplified for 40 cycles using the Gene Amp 5700 Sequence Detection System (Applied Biosystems). Nontemplate controls and dissociation curves were used to detect nonspecific amplification and the formation of primer-dimers. All experiments were run in duplicate and gene expression was normalized to the expression of the housekeeping gene, GAPDH.

Southern blotting

TCR transcript was amplified by conventional PCR using cDNA from FC, T cells (positive control), or p-preDC (negative control). The PCR products were electrophoresed for 1 h at 100 V on a 1.5% agarose gel. Gels were stained with EtBr at 1 µg/ml, rinsed and photographed under UV light. Capillary transfer was performed to transfer the DNA to the membrane (31).

Prehybridization

All membranes were briefly rinsed in 3x standard saline citrate phosphate/EDTA, air-dried for 15 min and cross-linked for 2 h at 80–90°C. Prehybridization was performed using 1x Perfect-Hyb Plus hybridization buffer (Sigma-Aldrich) for 1 h at 40°C.

Hybridization

Five micrograms of biotin-conjugated DNA oligonucleotide probe, complementary to an internal region of the mature TCR transcript, was added to the solution and all membranes were incubated overnight at 40°C. Membranes were rinsed and washed with 1x PBST for 10 min then blocked with 0.5% nonfat milk in PBST for 30 min followed by 1-h incubation in SA-HRP solution. The membranes were washed for 1.5 h in PBS-T. Chemiluminescence was detected using the Super Signal West Pico detection system.

	Results

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
CD3 transcription and protein expression by the FC at the time of transplantation

Although initially characterized as CD8⁺CD3⁺TCR^– and TCR^– (TCR^–), significant controversy remains as to the identity and characteristic phenotype of the FC. The CD8⁺TCR^– FC population contains both CD3 low and negative subsets as demonstrated by flow cytometric analysis of protein expression (6, 7). However, given the low level of CD3 expression detected on the FC some investigators have questioned whether CD3 is intrinsic to the FC at the time of transplantation.

In the setting of this controversy, we have characterized the gene transcription and protein expression of CD3 within the CD8⁺CD3⁺TCR^– FC population to establish that CD3 surface expression was not merely the result of increased background staining. As shown in Fig. 1A, CD3 protein expression as established vs an isotype control within the CD8⁺TCR^– FC population is characterized by a CD3⁺ population (7.2 ± 0.27%) and a large CD3^– population. The CD3⁺ FC subset, purified from C57BL/6 (B6) BM using high-speed flow cytometric cell sorting within the lymphoid gate, was analyzed for gene expression of CD3 and the other components of the CD3 core, CD3, and using RT-PCR. As demonstrated in Fig. 1B, the CD3 core transcripts CD3, CD3, and CD3 are expressed within the CD3⁺ FC population. These results establish that CD3 gene and protein expression are present within a subset of the FC population at the time of transplantation and corroborates the requirement for CD3 previously identified in the in vivo knockout studies (7). Given recent reports that demonstrated the FC population contains a p-preDC subset (5) and p-preDC have not been shown to express surface CD3, we hypothesized that p-preDC reside in the CD3^– FC subset. Using flow cytometric analysis, 99.8 ± 0.1% of all FC cells positive for the p-preDC marker (PDCA-1) are contained within the CD3^– FC subset. These findings support previous reports demonstrating the absence of surface CD3 on p-preDC.

View larger version (21K): [in this window] [in a new window]   FIGURE 1. CD8+TCR– FC express CD3. A, BM cells were stained with anti-CD8-PE, anti-TCR-FITC, and anti-TCR-FITC. Lymphoid cells were gated on forward and side scatter and FC were gated for CD8+TCR–. The CD8+TCR– FC population was further analyzed for CD3+ expression vs an isotype control (shaded histogram). B, The CD8+CD3+TCR– subset was isolated and RT-PCR was used to analyze the gene expression for CD3, CD3, and CD3 transcripts. PCR products were visualized by EtBr staining. Product sizes are CD3 (503 bp), CD3(458 bp), and CD3 (360 bp). Similar results were obtained in three independent experiments.

Characterization of TCR expression by the FC

Similar to FC isolated from CD3^–/– donors, the failure of RAG^–/– or TCR^–/– FC donors to facilitate allogeneic SC engraftment across complete MHC barriers suggested that TCR rearrangement and expression must occur within the FC population. Unfortunately, an Ab capable of Western blotting the murine TCR protein has not been identified and therefore coprecipitation studies have been used as evidence that TCR protein is present within the FC (6). We hypothesize that the presence of TCR transcription in normal FC would suggest that the loss of facilitating function by RAG^–/– and TCR^–/– FC donors was due to the need for TCR expression on the FC at the time of transplantation. In contrast, the absence of TCR transcript in normal FC would suggest that RAG^–/– and TCR^–/– FC do not facilitate secondary to a failure in FC development. To determine whether the TCR transcript is present within the FC at the time of cotransplantation with allogeneic SC, total RNA was isolated from 20,000 FC, T cells (positive control) and B220⁺CD11b^–CD11c^dim/int p-preDC (negative control) and analyzed for the presence of mature TCR transcript. RT-PCR was performed and the PCR products were analyzed by Southern blotting using an internal probe complementary to the mature TCR transcript. As evident in Fig. 2, the TCR transcript was detected in both the T cell and FC populations. However, as expected the p-preDC population does not express the TCR transcript, corroborating previous reports demonstrating the absence of the TCR transcript in murine p-preDC. Importantly, the presence of TCR transcript in the FC and the failure of TCR^–/– FC to facilitate SC reconstitution demonstrate that the requirement for TCR is characteristic of an FC subset separate from p-preDC yet critical to FC-mediated SC reconstitution.

View larger version (33K): [in this window] [in a new window]   FIGURE 2. TCR transcript is present in FC. Total RNA from 20,000 cells of FC, p-preDC (negative control), and T cells (positive control) was reverse transcribed to cDNA. TCR cDNA was amplified using sequence-specific primers. Samples without cDNA were the negative controls for quality of the PCR reagents. PCR products were analyzed by Southern blot hybridization using an internal probe complementary to an internal region of the mature TCR transcript. TCR transcript was detected in both the T cells and FC populations but not in p-preDC. The present data is representative of three independent experiments.

FcR expression is critical for reconstitution of allogeneic hemopoietic SC in vivo.

The TCR has the ability to associate with and use immunotyrosine receptors CD3 or FcR. We asked whether CD3 or FcR is critical for FC-mediated reconstitution of allogeneic SC in vivo and further characterized the nature of FC function using CD3^–/– and FcR^–/– mice. Lethally irradiated (950 cGy) B10.BR mice were reconstituted with 10,000 donor SC isolated from normal B6 mice coadministered with 50,000 donor FC obtained from normal B6, CD3^–/–, or FcR^–/– mice (Fig. 3). Control B10.BR mice received 10,000 allogeneic SC alone and syngeneic B6 mice served as controls for SC reconstitution and received 2,000 SC alone (Table I). FC were isolated by flow cytometric cell sorting for the standard CD8⁺TCR^– FC phenotype to compare our results with the previously established SC + FC model. Previous studies have shown that donor FC alone do not engraft nor induce tolerance. Furthermore, lethally irradiated B10.BR recipients of SC alone failed to survive longer than 25 days, as allogeneic SC alone do not reconstitute (Table I). As expected, the transplantation of SC plus FC from normal B6 donors into lethally irradiated B10.BR recipients resulted in 100% survival (Fig. 3). Surprisingly, B10.BR recipients reconstituted with SC from B6 donors and FC derived from CD3^–/– donors also survived and engrafted, demonstrating that CD3 is not critical for FC function in allogeneic SC reconstitution (Fig. 3). The reconstituted recipients demonstrated >90% donor B6 chimerism. In contrast, all recipients reconstituted with B6 SC and FC from FcR^–/– donors failed to engraft resulting in a 35-day mortality of 100% (Fig. 3). Moreover, the failure of engraftment is not due to loss of p-preDC because FcR^–/– and normal B6 mice have similar numbers of p-preDC as determined by B220⁺CD11b^–CD11c^dim/int flow cytometric analysis (4.5 ± 1.2% and 3.6 ± 0.9%, respectively). These findings suggest that FC-mediated SC reconstitution may be critically dependent on the expression of FcR within a different FC subset.

View larger version (15K): [in this window] [in a new window]   FIGURE 3. FcR, but not CD3, expression is critical for FC facilitation of allogeneic SC reconstitution in vivo. FC were isolated by flow cytometric cell sorting for CD8+TCR– FC phenotype from BM of the three strains of mice used as FC donors, B6, CD3–/–, and FcR–/– to compare with the previously established SC + FC model. Lethally irradiated (950 cGy) B10.BR mice were reconstituted with 10,000 hemopoietic SC isolated from normal B6 mice coadministered with 50,000 FC obtained from normal B6, CD3–/–, or FcR–/– mice. Recipient survival after allogeneic SC transplantation, reveals that recipients reconstituted with SC from B6 donors and FC from control B6 (n = 4, ) or CD3 –/– (n = 9, ) donors reliably reconstitute across complete MHC barriers. The reconstituted recipients demonstrated >90% donor B6 chimerism. In contrast, the cotransplantation of B6 SC with FC from FcR–/– donors (n = 9, ), fail to reconstitute in lethally irradiated B10.BR recipients and thus succumb to radiation-induced aplasia.

View this table: [in this window] [in a new window]   Table I. FC from TCR–/– or FcR donors fail to facilitation allogeneic SC reconstitution

The FC expresses high levels of the FcR transcript

The current in vivo studies have now shown that FcR and TCR expression is required for FC function. We next characterized FcR expression within the FC at the molecular level. FC were analyzed for gene expression of CD3 and FcR. Studies of early thymic cell development have demonstrated that FcR gene expression is greater than CD3 expression within the precursor cells of early maturing thymocytes (12, 27). Therefore, it is likely that differential gene expression could be directly associated with the selective use of one of these proteins within FC, likely FcR. To assess differential gene expression within FC, real-time quantitative PCR was performed using equal concentrations of cDNA from FC. Gene expression of CD3 and FcR in FC was normalized to GAPDH gene expression and is shown as percent of GAPDH. FcR gene expression within the FC population is significantly greater than CD3 expression (Fig. 4A). Moreover, the difference in gene expression was further confirmed by analysis of PCR products on an EtBr-stained agarose gel (Fig. 4B).

View larger version (26K): [in this window] [in a new window]   FIGURE 4. FcR gene expression is greater than CD3 expression within the FC population. Gene expression of CD3 and FcR were analyzed in FC using real-time and conventional PCR. A, Real-time quantitative PCR analysis of CD3 and FcR gene expression within the FC population is shown. CD3 and FcR cDNA was amplified and expressed as relative percent of gene expression for the housekeeping gene, GAPDH. B, Conventional PCR analysis of CD3 (313 bp) and FcR (530 bp) PCR products by EtBr staining is shown. Both PCR methods demonstrated greater FcR gene expression within FC. The real-time data represents the average values of duplicate samples ± SE of six independent experiments. The conventional PCR data is representative of three independent experiments.

FcR-expressing cells are predominant within the FC population

We subsequently investigated whether the higher FcR gene expression in the FC population results in predominant expression of the FcR protein by Western blotting and FACS analysis. Equal numbers of FC and T cells were solubilized and sequentially immunoprecipitated with anti-FcR followed by anti-CD3 Abs. Subsequent analysis of protein expression by Western blotting revealed that within the FC population FcR protein expression is greater than CD3, which was extremely low or undetectable (Fig. 5A). As expected, CD3 was abundant in lysates from T cells. Similar results were seen when CD3 immunoprecipitations were performed first. To assess the degree of FcR expression in terms of the percentage of FcR⁺ cells, intracellular staining of FcR within the FC was performed and revealed that 84.13 ± 9% of the FC population expresses FcR (Fig. 5B).

View larger version (32K): [in this window] [in a new window]   FIGURE 5. FcR protein is predominant in the FC population. A, Lysates from FC or T cells were sequentially immunoprecipitated first with anti-FcR followed with anti-CD3-specific Abs and subsequently Western blotted with the respective FcR- or CD3-specific Abs. Equal numbers of FC and T cells (range of 1–2.7 x 106) were used in each experiment with these figures being representative of Western blots for FcR and CD3 protein present on 2.7 x 106 FC and T cells. Identical results were obtained regardless of whether the FcR or CD3 immunoprecipitation was performed first. B, BM cells stained with anti-CD8-PE, anti-TCR-FITC, and anti-TCR-FITC followed by intracellular staining with anti-FcR. Lymphoid cells were gated on forward and side scatter and FC were gated for CD8+TCR–. The FC population was analyzed for FcR+ cells with 84.13 ± 9% of the FC population expressing FcR. The data presented in A and B are representative of three independent experiments.

FcR is associated with the TCR complex on FC

Given the abundance of FcR expression on FC and the dependence of FC-mediated SC reconstitution on FcR and TCR expression, we next examined whether FcR associates with the TCR complex on the FC in vitro, as part of the TCR-FCp33 receptor complex critical for FC-mediated SC reconstitution. Such an association would offer rationale to explain the absence of FC function in TCR and FcR-deficient donors. To confirm this hypothesis, immunoprecipitation of FC lysates were performed using anti-TCR Ab. TCR immunoprecipitation of surface biotinylated FC lysates demonstrates the presence of the TCR-FCp33 receptor on the FC (Fig. 6A). Subsequent Western blotting with anti-FcR Ab of nonbiotinylated FC lysates following TCR immunoprecipitation revealed the 12-kDa FcR protein within the TCR immunoprecipitated complex on the FC (Fig. 6B). These results provide evidence that FcR is associated with the unique TCR-FCp33 receptor complex expressed on an FC subset and previously shown to be critical for FC-mediated SC reconstitution.

View larger version (19K): [in this window] [in a new window]   FIGURE 6. FcR is associated with the TCR complex on the FC. A, Surface biotinylated cell lysates from CD8+TCR– FC (3 x 105) using biotin sulfo-N-hydroxy succinimidester-LC-biotin were immunoprecipitated with anti-TCR mAb. The immunoprecipitated proteins were separated on a reduced 11.5% SDS-PAGE gel and analyzed by blotting with SA-HRP. Chemiluminescence detection was used to identify the 45-kDa protein (TCR) and the TCR-associated FCp33 protein present on the FC (n = 3). B, Western blot analysis of TCR immunoprecipitated proteins from lysate of 30 x 106 FC. Immunoprecipitated proteins were separated by SDS-PAGE electrophoresis on a 12.5% polyacrylamide gel and subsequently blotted with anti-FcR Ab. Chemiluminescence detection was used to identify the 12-kDa FcR protein.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

In the current study, we provide further molecular and in vivo functional characterization of the FC population and the TCR-FCp33 complex. Given that in vivo facilitation is dependent on TCR expression (6), evidence for the presence of a TCR-associated signaling molecule in FC would provide insight into the mechanisms associated with FC-mediated SC reconstitution. We now show for the first time that the FC function is dependent on the expression of the TCR-associated signaling molecule FcR, as demonstrated by the failure of FC derived from FcR^–/– donors to facilitate allogeneic SC reconstitution (Fig. 3). In contrast, facilitation of alloreconstitution is undeterred when FC from CD3^–/– or CD16^–/– donors are used (Fig. 3 and Table I).

Fugier-Vivier et al. (5) showed that the majority of the CD8⁺TCR^– FC population consists of a B220⁺CD11c⁺ phenotype that resembles plasmacytoid precursor dendritic cells (p-preDC), a DC subset that does not express CD3 and TCR on the cell surface. It is important to note that the FC population in these studies was isolated as CD8⁺TCR^– and thus included a CD3^– subset in which p-preDC should reside. Fig. 1 demonstrates that CD8⁺TCR^– FC population contains both a CD3⁺ and CD3^– subset. Fig. 2 confirms that cells other than p-preDC are also contained in the FC population as the TCR transcript is not present within the p-preDC population, but is clearly identified in the CD8⁺TCR^– FC population. Because facilitation has been shown to be dependent on CD3 and TCR expression, and p-preDC express neither, it is not unexpected that p-preDC do not facilitate SC reconstitution as effectively as the entire CD8⁺TCR^– FC population or the CD3⁺ FC subset (3, 4, 5). Together with the present data, this evidence supports the hypothesis that TCR, CD3and FcR expression is intrinsic to the FC at the time of transplantation and are required for FC-mediated SC reconstitution. We now show that all three required components are incorporated within the TCR-FCp33 receptor complex present within the FC population.

The FC requirement for TCR and FcR but not CD3 expression for facilitation is similar to studies of early thymic cell development in which FcR gene expression is greater than CD3 expression within thymic precursor cells. Such differential expression suggests that CD3 and FcR are not merely interchangeable, but in fact demonstrate specificity requirements during the development of self tolerance in thymocytes (12, 15, 25, 27). Similarly, we now demonstrate that FcR gene expression is dominant within the FC population (Fig. 4), at a time when the FC is involved in the establishment of SC reconstitution and the induction of transplantation tolerance. We have also demonstrated that the dominance in FcR gene expression directly correlates with the predominant expression of FcR protein (Fig. 5). Interestingly, the extent of FcR expression (84 ± 9%) suggests that at least some p-preDC within the FC population are FcR positive. Therefore, it is possible that p-preDC development is inhibited in FcR^–/– donors resulting in the loss of FC-mediated SC reconstitution. We have excluded this hypothesis by demonstrating that the percent of BM p-preDC in FcR^–/– and normal B6 donors is similar at 4.5 ± 1.2% and 3.6 ± 0.9%, respectively. Thus, the loss of facilitation when using FcR^–/– donor is not due to the absence of p-preDC and therefore suggests a difference in the signaling requirement for FC and p-preDC function in facilitation. This is consistent with the absence of CD3 and TCR expression on the p-preDC as demonstrated in this study and the less efficient facilitation of SC reconstitution exhibited by p-preDC as demonstrated by Fugier-Vivier et al. (5).

Given the requirement for TCR expression and the predominance of FcR-expressing cells within the FC population, we hypothesized that FcR associates with the TCR-FCp33 complex present on a subset of the FC. This hypothesis was supported by TCR-FcR coprecipitation studies and subsequently supports the hypothesis that the signaling requirement for the less efficient p-preDC population differs from the FC subset that contains the TCR-FCp33-FcR (Fig. 6).

Although the functional importance of TCR signaling via FcR in hemopoietic SC reconstitution in vivo has not previously been identified, the concept that FcR plays an important role in hemopoietic SC reconstitution and induction of tolerance has gained support through investigations with NK cells. The CD16 receptor on NK cells plays a pivotal role in fetal thymocyte and NK/NKT development via an FcR-signaling pathway, and cross-linking of the CD16 receptor expressed on pre-T cells has been shown to alter development and induces a higher ratio of to T cells (32). Demonstration that immature thymocytes that express FcR and CD16 contain precursors for both NK cells and T cells, suggests that CD16-FcR signaling is essential to early precursor development and thus may also play a role in FC development. The dual dependence of allogeneic SC reconstitution on TCR and FcR expression suggests that FC use either a common TCR-FcR complex, as demonstrated in early thymocytes in vitro, or independent TCR and FcR-signaling pathways, as in NKT cells which use both TCR-CD3 and CD16-FcR-signaling pathways. This latter possibility was effectively excluded by demonstrating that FC derived from CD3^–/– or CD16^–/– donors remain functional and result in reconstitution of allogeneic SC across complete MHC barriers (Table I). Therefore, the demonstration that the FC function requires FcR, but not CD3 or CD16 expression, suggests the presence of an alternative FcR-associated receptor complex. This association was demonstrated by the coprecipitation of TCR, FCp33, and FcR from the FC population and provides the first evidence that a TCR-FcR complex is associated with FC-mediated allogeneic SC reconstitution (Fig. 6).

In summary, these studies establish the expression of TCR and CD3 within the FC population at the time of transplantation. Furthermore, the FC population is distinct from conventional T cells and contains a CD3⁺ subset separate from the less efficient facilitating p-preDC cells that do not express CD3 or TCR proteins. In contrast to CD3, a protein that does not affect allogeneic SC reconstitution, we have demonstrated that FcR expression is critically important for FC-mediated facilitation of allogeneic SC reconstitution in vivo. The coprecipitation studies revealed that FcR associates with the TCR-FCp33 receptor, known to be required for facilitation of allogeneic SC reconstitution in vivo. Further characterization of the TCR-FCp33-FcR complex and FcR-dependent signaling will be critical to understanding the mechanism by which the FC facilitates allogeneic SC reconstitution and for the identification of potential therapeutic targets for the clinical induction of tolerance in the future.

	Acknowledgments

 
We sincerely thank the staff at the Redstone Animal Facility/Dana-Farber Cancer Institute (DFCI) for outstanding animal care. We also thank Renee Wright, Rahilya Napoli, and Evan Cohick for technical assistance, and Peter Schow at the DFCI Flow Cytometry Core Facility for cell sorting and technical assistance.

	Disclosures

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The authors have no financial conflict of interest.

	Footnotes

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ This work was supported by Grant R01 HL074150-01 from the National Institutes of Health.

² Address correspondence and reprint requests to Dr. Yolonda L. Colson, Division of Thoracic Surgery, Department of Surgery, Brigham and Women’s Hospital, 75 Francis Street, Boston, MA 02115. E-mail address: ylcolson{at}bics.bwh.harvard.edu

³ Abbreviations used in this paper: SC, stem cell; GVHD, graft-vs-host disease; BM, bone marrow; FC, facilitating cell; p-preDC, plasmacytoid precursor dendritic cell; TCR, TCR -chain; CSM, cell sort medium; BMT, BM transplantation, SA, streptavidin; EtBr, ethidium bromide; int, intermediate.

Received for publication December 29, 2005. Accepted for publication April 28, 2006.

	References

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 

1. Champlin, R. E., M. M. Horowitz, D. W. van Bekkum, B. M. Camitta, G. E. Elfenbein, R. P. Gale, E. Gluckman, R. A. Good, A. A. Rimm, C. Rozman. 1989. Graft failure following bone marrow transplantation for severe aplastic anemia: risk factors and treatment results. Blood 73: 606-613. [Abstract/Free Full Text]
2. el Badri, N. S., R. A. Good. 1993. Lymphohemopoietic reconstitution using wheat germ agglutinin-positive hemopoietic stem cell transplantation within but not across the major histocompatibility antigen barriers. Proc. Natl. Acad. Sci. USA 90: 6681-6685. [Abstract/Free Full Text]
3. Kaufman, C., Y. Colson, S. Wren, S. Watkins, R. Simmons, S. Ildstad. 1994. Phenotypic characterization of a novel bone-marrow derived cell that facilitates engraftment of allogeneic bone marrow stem cells. Blood 84: 2436-2466. [Abstract/Free Full Text]
4. Colson, Y. L., K. Christopher, J. Glickman, K. N. Taylor, R. Wright, D. L. Perkins. 2004. Absence of clinical GVHD and the in vivo induction of regulatory T cells after transplantation of facilitating cells. Blood 104: 3829-3835. [Abstract/Free Full Text]
5. Fugier-Vivier, I. J., F. Rezzoug, Y. Huang, A. J. Graul-Layman, C. L. Schanie, H. Xu, P. M. Chilton, S. T. Ildstad. 2005. Plasmacytoid precursor dendritic cells facilitate allogeneic hematopoietic stem cell engraftment. J. Exp. Med. 201: 373-383. [Abstract/Free Full Text]
6. Schuchert, M. J., R. D. Wright, Y. L. Colson. 2000. Characterization of a newly discovered T-cell receptor -chain heterodimer expressed on a CD8⁺ bone marrow subpopulation that promotes allogeneic stem cell engraftment. Nat. Med. 6: 904-909. [Medline]
7. Grimes, H. L., C. L. Schanie, Y. Huang, D. Cramer, F. Rezzoug, I. Fugier-Vivier, S. T. Ildstad. 2004. Graft facilitating cells are derived from hematopoietic stem cells and functionally require CD3, but are distinct from T lymphocytes. Exp. Hematol. 32: 946-954. [Medline]
8. Koning, F., W. L. Maloy, J. E. Coligan. 1990. The implications of subunit interactions for the structure of the T cell receptor-CD3 complex. Eur. J. Immunol. 20: 299-305. [Medline]
9. Orloff, D. G., C. S. Ra, S. J. Frank, R. D. Klausner, J. P. Kinet. 1990. Family of disulphide-linked dimers containing the and chains of the T-cell receptor and the chain of Fc receptors. Nature 347: 189-191. [Medline]
10. Park, S. Y., H. Arase, K. Wakizaka, N. Hirayama, S. Masaki, S. Sato, J. V. Ravetch, T. Saito. 1995. Differential contribution of the FcR chain to the surface expression of the T cell receptor among T cells localized in epithelia: analysis of FcR -deficient mice. Eur. J. Immunol. 25: 2107-2110. [Medline]
11. Huppa, J. B., H. L. Ploegh. 1997. In vitro translation and assembly of a complete T cell receptor-CD3 complex. J. Exp. Med. 186: 393-403. [Abstract/Free Full Text]
12. Petersson, K., F. Ivars. 2001. Early TCR expression promotes maturation of T cells expressing FcRI containing TCR/CD3 complexes. J. Immunol. 166: 6616-6624. [Abstract/Free Full Text]
13. Ra, C., M. H. Jouvin, U. Blank, J. P. Kinet. 1989. A macrophage Fc receptor and the mast cell receptor for IgE share an identical subunit. Nature 341: 752-754. [Medline]
14. Rodewald, H. R., A. R. Arulanandam, S. Koyasu, E. L. Reinherz. 1991. The high affinity Fc epsilon receptor subunit (FcRI ) facilitates T cell receptor expression and antigen/major histocompatibility complex-driven signaling in the absence of CD3 and CD3. J. Biol. Chem. 266: 15974-15978. [Abstract/Free Full Text]
15. Koyasu, S.. 1994. CD3⁺CD16⁺NK1.1⁺B220⁺ large granular lymphocytes arise from both - TCR⁺CD4^–CD8^– and - TCR⁺CD4^–CD8^– cells. J. Exp. Med. 179: 1957-1972. [Abstract/Free Full Text]
16. Arase, H., S. Ono, N. Arase, S. Y. Park, K. Wakizaka, H. Watanabe, H. Ohno, T. Saito. 1995. Developmental arrest of NK1.1⁺ T cell antigen receptor (TCR)-/⁺ T cells and expansion of NK1.1⁺ TCR-/⁺ T cell development in CD3-deficient mice. J. Exp. Med. 182: 891-895. [Abstract/Free Full Text]
17. Curnow, S. J., C. Boyer, M. Buferne, A. M. Schmitt-Verhulst. 1995. TCR-associated -FcRI heterodimers on CD4^–CD8^– NK1.1⁺ T cells selected by specific class I MHC antigen. Immunity 3: 427-438. [Medline]
18. Simpson, S., G. Hollander, J. She, C. Levelt, M. Huang, C. Terhorst. 1995. Selection of peripheral and intestinal T lymphocytes lacking CD3. Int. Immunol. 7: 287-293. [Abstract/Free Full Text]
19. Grassi, F., E. Barbier, S. Porcellini, H. von Boehmer, P. A. Cazenave. 1999. Surface expression and functional competence of CD3-independent TCR -chains in immature thymocytes. J. Immunol. 162: 2589-2596. [Abstract/Free Full Text]
20. Liu, C.-P., R. Ueda, J. She, J. Sancho, B. Wang. 1993. Abnormal T cell development in CD3-^–/– mutant mice and identification of a novel T cell population in the intestine. EMBO J. 12: 4863-4875. [Medline]
21. Malissen, M., A. Gillet, B. Rocha, J. Trucy, E. Vivier, C. Boyer, F. Kontgen, N. Brun, G. Mazza, E. Spanopoulou, et al 1993. T cell development in mice lacking the CD3-/ gene. EMBO J. 12: 4347-4355. [Medline]
22. Alarcon, B., D. Gil, P. Delgado, W. W. Schamel. 2003. Initiation of TCR signaling: regulation within CD3 dimers. Immunol. Rev. 191: 38-46. [Medline]
23. Huang, Y., R. L. Wange. 2004. T cell receptor signaling: beyond complex complexes. J. Biol. Chem. 279: 28827-28830. [Free Full Text]
24. Ravetch, J. V., J. P. Kinet. 1991. Fc receptors. Annu. Rev. Immunol. 9: 457-492. [Medline]
25. Groettrup, M., K. Ungewiss, O. Azogui, R. Palacios, M. J. Owen, A. C. Hayday, H. von Boehmer. 1993. A novel disulfide-linked heterodimer on pre-T cells consists of the T cell receptor chain and a 33 kd glycoprotein. Cell 75: 283-294. [Medline]
26. Guy-Grand, D., B. Rocha, P. Mintz, M. Malassis-Seris, F. Selz, B. Malissen, P. Vassalli. 1994. Different use of T cell receptor transducing modules in two populations of gut intraepithelial lymphocytes are related to distinct pathways of T cell differentiation. J. Exp. Med. 180: 673-679. [Abstract/Free Full Text]
27. Flamand, V., E. W. Shores, T. Tran, K. Huang, E. Lee, A. Grinberg, J. P. Kinet, P. E. Love. 1996. Delayed maturation of CD4^–CD8^– Fc RII/III⁺ T and natural killer cell precursors in FcRI transgenic mice. J. Exp. Med. 184: 1725-1735. [Abstract/Free Full Text]
28. von Boehmer, H., I. Aifantis, F. Gounari, O. Azogui, L. Haughn, I. Apostolou, E. Jaeckel, F. Grassi, L. Klein. 2003. Thymic selection revisited: how essential is it?. Immunol. Rev. 191: 62-78. [Medline]
29. Laemmli, U. K.. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685. [Medline]
30. Barber, D. F., L. Passoni, L. Wen, L. Geng, A. C. Hayday. 1998. The expression in vivo of a second isoform of pT : implications for the mechanism of pT action. J. Immunol. 161: 11-16. [Abstract/Free Full Text]
31. Southern, E. M.. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98: 503-517. [Medline]
32. Sandor, M., J. Galon, L. Takacs, Y. Tatsumi, A. L. Mueller, C. Sautes, R. G. Lynch. 1994. An alternative Fc -receptor ligand: potential role in T-cell development. Proc. Natl. Acad. Sci. USA 91: 12857-12861. [Abstract/Free Full Text]

This article has been cited by other articles: