The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ireland, J.
Right arrow Articles by Unanue, E. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ireland, J.
Right arrow Articles by Unanue, E. R.
The Journal of Immunology, 2006, 177: 1421-1425.
Copyright © 2006 by The American Association of Immunologists

CUTTING EDGE

Cutting Edge: Unique T Cells That Recognize Citrullinated Peptides Are a Feature of Protein Immunization1

Jamie Ireland, Jeremy Herzog and Emil R. Unanue2

Department of Pathology and Immunology, Washington University School of Medicine, St. Louis, MO 63110


   Abstract
Top
 Abstract
Introduction
 Methods and Materials
 Results
 Discussion
 Disclosures
 References
 
Abs against citrullinated proteins are present in patients with rheumatoid arthritis. In this study, we describe a unique cohort of T cells that selectively responded to citrullinated variants of two epitopes of hen egg-white lysozyme, a major and a minor one, bound to the MHC molecule, I-Ak. In addition, we show that when given an intact, unmodified lysozyme protein, dendritic cells and peritoneal macrophages presented citrullinated peptides and stimulated modification-specific T cells. Thus, presentation of citrullinated-peptide-MHC complex is a feature of immune responses to protein Ags.


   Introduction
Top
 Abstract
 Introduction
Methods and Materials
 Results
 Discussion
 Disclosures
 References
 
Antibodies to a variety of citrullinated proteins are found in a very high number of patients with rheumatoid arthritis (RA)3 and can be used as a highly specific clinical index of the disease. Citrullination of arginines is a posttranslational change resulting from the action of peptidylarginine deiminases (PAD), a family of enzymes found in different cells including neutrophils, monocytes, and macrophages (1, 2, 3, 4, 5, 6). The immunological consequences of deimination of arginines are therefore of great interest, particularly with respect to their possible pathogenetic significance in RA. The issue of whether citrullinated proteins may be autoantigenic has been raised, not only in RA but also in cases of inflammatory disease of the nervous system where citrullination occurs in myelin basic protein (7, 8). Citrullinated proteins have been found to be antigenic (9, 10).

Posttranslational changes have been reported in MHC-bound peptides (11, 12). We recently called attention to nitration of tyrosine residues (13) and oxidation of tryptophans on peptides from the protein, hen egg-white lysozyme (HEL), bound to the class II histocompatibility molecule I-Ak (14). These changes took place when APCs were activated during immunological reactions including infections. T cells highly specific to the changes were generated in vivo, and some escaped negative selection in HEL transgenic mice.

With the findings of citrullinated proteins in RA, we searched for such a modification in MHC-bound peptides using approaches akin to those mentioned above. Again, using HEL as a model Ag, we show in this study that T cells specifically reactive to citrullinated epitopes were among the responding repertoire to immunization with an unmodified HEL protein. We also found that APC presented modified peptides when provided an intact, unmodified HEL ex vivo. Finding T cells specific to citrullinated peptides adds another dimension to the reports of Abs in RA.


   Methods and Materials
Top
 Abstract
 Introduction
 Methods and Materials
Results
 Discussion
 Disclosures
 References
 
Cell culture

CD4 T cell hybridomas were made by fusing cells obtained from popliteal lymph nodes 7 days postimmunization with 10 nmol of HEL in CFA. First, lymphocytes were cultured for 1 wk in the presence of 1 µM peptide. The cells were then stimulated with fresh peptide and irradiated splenocytes as APC. Three days later, the cells were fused to BW5147{alpha}-beta-thymoma cells line, as described previously (15).

C3.F6 B lymphoma cells were used as APC for examining the response to the various peptides. Peritoneal macrophages were obtained by i.p. injection with 100 µg of Con A. After 4 days, peritoneal exudate cells (PEC) were harvested. Dendritic cells (DC) were derived from bone marrow cultured for 6 days in GM-CSF containing medium as described previously (16). Hybridoma activation was measured by IL-2 secretion as assayed by CTLL proliferation. ELISPOT assays were conducted according to the BD Biosciences protocol.

For limiting dilution cloning, mice were immunized with 10 nmol of HEL in CFA in the hind footpads. Seven days later, popliteal lymph nodes were harvested. Lymphocytes were plated in round-bottom plates with 5 x 105 irradiated (2000 rad) splenocytes with 50 U/ml rIL-2 and 5 µM 48–62cit61 peptide. Clonal growth-positive wells were maintained in these culture conditions.

Mice and reagents

B10.BR mice, usually 6- to 12-wk-old, of both sexes were obtained from The Jackson Laboratory and maintained in facilities at Washington University. B10.BR-Tg(KLK4mHEL)6Ccg mice expressing membrane HEL under the class II E{alpha} promoter were generated and maintained by our laboratory (15). HEL was obtained from Sigma Chemical and purified to eliminate contaminant proteins and LPS. Peptides were synthesized using Fmoc techniques. LPS (Sigma-Aldrich) was used at a final concentration of 1 µg/ml.

RT-PCR

RNA was isolated using the RNeasy kit (Qiagen) according to the manufacturer’s instructions. The RNA was treated with DNA-free (Ambion), then reverse-transcribed using Superscript First-Strand Synthesis (Invitrogen Life Technologies), and amplified using the following primer sequences: PAD2, TACAGATTCCCGTACACGTTGCGT and AACTGGCCAGAGAATTGAGGACCA with an expected amplicon of 245 bp; and PAD4, CCAAGAAAGCCAAGTGCAAGCTGA and TTCCCGATGAGAATTCTGCCCAGT with an expected amplicon of 316 bp.

Relative binding affinity

Peptide-binding affinity for I-Ak was measured as described previously (17), using baculovirus-purified I-Ak molecules. Results indicate the concentration of unlabeled peptide that inhibited by half the binding of an 125I-labeled peptide standard.


   Results
Top
 Abstract
 Introduction
 Methods and Materials
 Results
Discussion
 Disclosures
 References
 
Immunization with HEL gives rise to T cells that are specific to citrullinated epitopes

Mice were immunized with HEL in CFA, and 1 wk later the draining lymph node cells were isolated and screened for CD4 T cells to citrullinated HEL epitopes. After a 7-day culture in the presence of citrulline (either HEL 48–62cit61 or HEL 114–129cit125) (Table I), followed by a 3-day stimulation with irradiated splenocytes, the cells were fused to create T cell hybridomas. In a different approach, the lymph node cells of the mice immunized with HEL were placed in an ELISPOT assay against the modified peptides, or were cloned by limiting dilution.


View this table:
[in this window]
[in a new window]
  		Table I. Peptide binding results

 
Peptide 48–62 represents the major chemically dominant segment of HEL selected from its processing (18). This family of peptides centers on the nine-residue core from 52 to 60. Arginine, underlined, is the tenth residue on this peptide: DYGILQINSRW. The crystal structure of the 48–62 peptide bound to I-Ak showed that the P10 arginine and the P11 tryptophan were solvent exposed (19). As expected, changing the arginine 61 to citrulline did not change the binding of the 48–62 peptide to purified I-Ak molecule (Table I).

Several hybridomas were found that responded to 48–62 with a citrullinated P10, and not to the wild-type arginine residue. Three representative T cells are shown in Fig. 1A, labeled Pepe, Granny, and Marvin, and each responded with varying degrees of sensitivity to 48–62 but only with a citrulline in place of the arginine at P10. These hybridomas did not secrete IL-2 in response to stimulation with wild-type peptide. All of the citrulline-specific hybridomas showed an absolute dependence on the presence of the tryptophan at P11, that is, responded to 48–62cit61 but not 48–61cit61. This finding is not surprising as the screening process selected for a population of T cells whose receptors recognized C-terminal residues. About half of the T cells that responded to the 48–62 segment of HEL also required the presence of Trp62 (20, 21).


Figure 1
View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 1. T cell hybridomas are reactive to the 48–62cit61 peptide. A, Hybridomas were cocultured with C3.F6 as APC and tested with 1.5 log dilutions of 48–62 unmodified or with citrulline or glutamine replacements at P10 or whole HEL. B, The response of the hybridomas to 48–62 cit61 with alanine substitutions at TCR contact positions.

 
It is known that most of the T cells that interact with the 52–60 core segment interact with three TCR contact residues, Tyr53, Leu56, and Asn59 (19, 21, 22). Such was the case for the T cells that recognized cit61 (Fig. 1B). None recognized the alanine substitutions for Tyr53 or Asn59. Additionally, the response was severely hindered when leucine at the P5 position, a centrally positioned TCR contact, was replaced by an alanine. Whether the TCR directly interacted with the cit61 and Trp62, or the latter imparted a conformational change of the three TCR contact residues of the core segments is not known.

To further define the specificity of the hybridomas reactive with 48–62cit61, we assessed the effects of several amino acid substitutions at the Arg61 residue (Table II). Replacement of the Arg61 with alanine or glycine resulted in a markedly diminished response. The substitution of glutamine, an amino acid with structural similarities to citrulline, induced a similar or smaller response among the various T cell hybridomas. (Fig. 1A and Table II). In contrast, substitution at P10 with lysine completely abrogated the response in data not shown. T cell hybridomas that recognize unmodified 48–62 were tested for reactivity to the modified peptides: we found no difference in the responses to stimulation with the various substitutions.


View this table:
[in this window]
[in a new window]
  		Table II. Effects of amino acid substitutions

 
ELISPOT analysis of spleen cells from mice immunized with HEL indicated that frequency of T cells reactive with 48–62cit61 is ~1:36,000. The ELISPOT, however, did not distinguish those T cells that exclusively reacted with the citrullinated peptides. The frequency of T cells responding to 48–62 was ~1:25,000. We therefore conducted cloning of primary T cells from HEL-immunized mice by limiting dilution. Each clone was tested against 48–62 and 48–62cit61. Analysis of 23 primary T cell clones showed that 8, or 35%, reacted only to 48–62cit61, whereas the other 15 responded to both 48–62cit61 and 48–62.

Peptide 114–129 binds weakly to I-Ak molecules, although it induces a relatively strong T cell response (23). The binding core in 114–129 is from residues 119–127: DVQAWIRGC. Arginine is at P7 in the peptide and is known to be a negative or hindering residue. Peptide 114–129cit125 bound with an IC50 of 1 µM, whereas the unmodified peptide bound at 3.8 µM (Table I). These findings are in agreement with a recent report on the binding of a citrullinated peptide to HLA DRB1*0401 (24).

Immunization with HEL and selection for T cells that recognized a citrulline for the Arg125 resulted in T cells that specifically recognized the modification. Two representative T cells specific for the 114–129 peptide with citrulline at residue 125, C68 and Everardo, are shown in Fig. 2. Unlike the hybridomas that recognize 48–62cit61, these did not react with peptides in which the arginine at 125 was replaced with glutamine. Similarly, hybridomas that recognized the 114–129 epitope did not recognize the citrullinated peptide (Table II). Two ELISPOT assays were done. The number of 114–129-reactive T cells after HEL immunizations were 1:24,539 and 1:36,000. The numbers of 114–129cit125-reactive T cells were much less: 1:70,000 and 1:142,857. Collectively, these data indicated that citrullinated peptides were presented in vivo, from HEL processing, and elicited specific T cell responses.


Figure 2
View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 2. C68 and Everardo are reactive to citrullinated 114–129. Hybridomas were cocultured with C3.F6 as APC. HEL or peptide was added to the cultures in 1.5 log dilutions, and IL-2 secretion was assayed by proliferation of CTLL cells.

 
Primary APC present modified peptides when given whole HEL

We tested the abilities of different APC to present the modified peptides when cultured with HEL. To this end, we examined bone marrow-derived DCs (BMDC), adherent PECs, or the C3.F6 B lymphoma line (Fig. 1A), as APC. C3.F6 pulsed with whole HEL did not stimulate the hybridomas that were specific to 48–62 cit61. The hybridomas specific for 48–62cit61 responded to whole HEL when presented by BMDC (Fig. 3A) or PEC (Fig. 3B). The response was increased after addition of LPS to the cultures: with Marvin the response was only detected after LPS stimulation. In addition, DC (CD11b–, CD11c+) and macrophages (CD11b+, CD11c–) isolated from B10.BR spleens pulsed with HEL presented 48–62cit61.


Figure 3
View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 3. APC present modified peptides from HEL. BMDC (A) or PEC (B) were cultured overnight with dilutions of HEL. The cells were washed and cocultured with the hybridomas, and IL-2 secretion was assayed. C, Expression of PAD 2 and PAD 4 in APC used in this study. Total RNA was isolated from cells, reverse-transcribed, and amplified using internal primers to semiquantitatively detect mRNA levels.

 
In data not shown, less sensitive hybridomas responded weakly or not at all, suggesting that the levels of 48–62cit61 may be limiting. In support of this idea, the 114–129cit125-specific hybridomas, C68 and Everardo, did not respond to HEL presented by BMDC or PEC. Both of these hybridomas are much less sensitive. The levels of the 114–129 epitope of HEL presented on I-Ak are low relative to the levels presented by the 48–62 family. Lastly, in data not shown we found that BMDC and PEC from lysozyme transgenic mice stimulated the 48–62cit61 hybridomas. The B lymphoma line C3.F6 did not present to either set of T hybridomas (Figs. 1 and 2). The conversion of arginine to citrulline requires the activity of PAD enzymes, which are cytosolic or nuclear and are active only at high calcium concentrations, ~10–5 M (4). There have been several reports indicating that monocytes express PAD enzymes (25, 26, 27, 28), and in this study we indicate that both BMDC and peritoneal macrophages expressed PAD2 and PAD4 by RT-PCR. C3.F6 expressed PAD2 but not PAD4 (Fig. 3C).


   Discussion
Top
 Abstract
 Introduction
 Methods and Materials
 Results
 Discussion
Disclosures
 References
 
The surprising observation made in this study is the presence of T cells to citrullinated peptides upon immunization with the highly immunogenic HEL protein. HEL was given in CFA, which induces a strong inflammatory response. In a previous study, we found that, in the draining lymph node, ~1% of macrophages and DC contained the HEL following similar conditions of immunization as used here (29). Actually, by ELISPOT, the number of T cells reactive with the citrullinated peptides was relatively high. We conclude that strong immunization measures can drive the process in APC that leads to citrullination of protein segments that are processed into peptide-MHC complexes. Now that we recognize that such T cells exist, we are actively searching for them in different specific tissue autoimmunities and inflammatory conditions as well as outlining the mechanisms of citrullination of Ag during presentation by APC.

The steps involved in citrullination of Ag require analysis, taking into consideration the properties of the PAD enzymes. The mechanism by which presentation of the modified epitopes occurs is puzzling considering the high level of calcium required and the localization of the enzymes in the cell. A high calcium level could take place during apoptosis, although we have not discerned an obvious apoptotic response in our cultures. The lack of presentation by C3.F6 suggests that PAD4 may be the critical enzyme, but this conclusion needs to be substantiated in experiments where this enzyme is removed from DC or macrophages. Such experiments are in progress.

Having identified specific T cells to citrullinated proteins as part of the response to immunization now begs the question of their immunopathologic role. What is their meaning in the context of the findings in RA? Because citrullination of proteins in the joint is such a striking feature, will T cells to the modified epitopes be enriched there? If such T cells develop in inflamed joints against protein components, will they be pathogenic? The issue of whether these responses are involved in disease pathogenesis or a byproduct of a more general immunological reaction must be clarified before steps to target deimination as a treatment are taken.


   Acknowledgments
 
We thank Shirley Petzold for technical help with the MHC-binding assays.


   Disclosures
Top
 Abstract
 Introduction
 Methods and Materials
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by grants from the National Institutes of Health. Back

2 Address correspondence and reprint requests to Dr. Emil R. Unanue, Department of Pathology and Immunology, Washington University School of Medicine, 660 South Euclid Avenue, Box 8118, St. Louis, MO 63110. E-mail address: Unanue{at}pathbox.wustl.edu Back

3 Abbreviations used in this paper: RA, rheumatoid arthritis; PAD, peptidylarginine deiminase; HEL, hen egg-white lysozyme; PEC, peritoneal exudate cell; DC, dendritic cell; BMDC, bone marrow-derived DC. Back

Received for publication April 18, 2006. Accepted for publication June 6, 2006.


   References
Top
 Abstract
 Introduction
 Methods and Materials
 Results
 Discussion
 Disclosures
 References
 

  1. Migliorini, P., F. Pratesi, C. Tommasi, C. Anzilotti. 2005. The immune response to citrullinated antigens in autoimmune diseases. Autoimmun. Rev. 4: 561-564. [Medline]
  2. Nijenhuis, S., A. J. Zendman, E. R. Vossenaar, G. J. Pruijn, W. J. vanVenrooij. 2004. Autoantibodies to citrullinated proteins in rheumatoid arthritis: clinical performance and biochemical aspects of an RA-specific marker. Clin. Chim. Acta 350: 17-34. [Medline]
  3. van Venrooij, W. J., G. J. Pruijn. 2000. Citrullination: a small change for a protein with great consequences for rheumatoid arthritis. Arthritis Res. 2: 249-251. [Medline]
  4. Vossenaar, E. R., A. J. Zendman, W. J. van Venrooij, G. J. Pruijn. 2003. PAD, a growing family of citrullinating enzymes: genes, features and involvement in disease. BioEssays 25: 1106-1118. [Medline]
  5. Wysocka, J., C. D. Allis, S. Coonrod. 2006. Histone arginine methylation and its dynamic regulation. Front. Biosci. 11: 344-355. [Medline]
  6. Yamada, R.. 2005. Peptidylarginine deiminase type 4, anticitrullinated peptide antibodies, and rheumatoid arthritis. Autoimmun. Rev. 4: 201-206. [Medline]
  7. Martin, R., J. N. Whitaker, L. Rhame, R. R. Goodin, H. F. McFarland. 1994. Citrulline-containing myelin basic protein is recognized by T-cell lines derived from multiple sclerosis patients and healthy individuals. Neurology 44: 123-129. [Abstract/Free Full Text]
  8. Nicholas, A. P., T. Sambandam, J. D. Echols, W. W. Tourtellotte. 2004. Increased citrullinated glial fibrillary acidic protein in secondary progressive multiple sclerosis. J. Comp. Neurol. 473: 128-136. [Medline]
  9. Lundberg, K., S. Nijenhuis, E. R. Vossenaar, K. Palmblad, W. J. van Venrooij, L. Klareskog, A. J. Zendman, H. E. Harris. 2005. Citrullinated proteins have increased immunogenicity and arthritogenicity and their presence in arthritic joints correlates with disease severity. Arthritis Res. Ther. 7: R458-R467. [Medline]
  10. Hida, S., N. N. Miura, Y. Adachi, N. Ohno. 2004. Influence of arginine deimination on antigenicity of fibrinogen. J. Autoimmun. 23: 141-150. [Medline]
  11. Suri, A., S. B. Lovitch, E. R. Unanue. 2006. The wide diversity and complexity of peptides bound to class II MHC molecules. Curr. Opin. Immunol. 18: 70-77. [Medline]
  12. Anderton, S. M.. 2004. Post-translational modifications of self antigens: implications for autoimmunity. Curr. Opin. Immunol. 16: 753-758. [Medline]
  13. Birnboim, H. C., A. M. Lemay, D. K. Lam, R. Goldstein, J. R. Webb. 2003. Cutting edge: MHC class II-restricted peptides containing the inflammation-associated marker 3-nitrotyrosine evade central tolerance and elicit a robust cell-mediated immune response. J. Immunol. 171: 528-532. [Abstract/Free Full Text]
  14. Herzog, J., Y. Maekawa, T. P. Cirrito, B. S. Illian, E. R. Unanue. 2005. Activated antigen-presenting cells select and present chemically modified peptides recognized by unique CD4 T cells. Proc. Natl. Acad. Sci. USA 102: 7928-7933. [Abstract/Free Full Text]
  15. Peterson, D. A., R. J. DiPaolo, O. Kanagawa, E. R. Unanue. 1999. Quantitative analysis of the T cell repertoire that escapes negative selection. Immunity 11: 453-462. [Medline]
  16. Veeraswamy, R. K., M. Cella, M. Colonna, E. R. Unanue. 2003. Dendritic cells process and present antigens across a range of maturation states. J. Immunol. 170: 5367-5372. [Abstract/Free Full Text]
  17. Lovitch, S. B., S. J. Petzold, E. R. Unanue. 2003. Cutting edge: H-2DM is responsible for the large differences in presentation among peptides selected by I-Ak during antigen processing. J. Immunol. 171: 2183-2186. [Abstract/Free Full Text]
  18. Nelson, C. A., R. W. Roof, D. W. McCourt, E. R. Unanue. 1992. Identification of the naturally processed form of hen egg white lysozyme bound to the murine major histocompatibility complex class II molecule I-Ak. Proc. Natl. Acad. Sci. USA 89: 7380-7383. [Abstract/Free Full Text]
  19. Fremont, D. H., D. Monnaie, C. A. Nelson, W. A. Hendrickson, E. R. Unanue. 1998. Crystal structure of I-Ak in complex with a dominant epitope of lysozyme. Immunity 8: 305-317. [Medline]
  20. Carson, R. T., K. M. Vignali, D. L. Woodland, D. A. Vignali. 1997. T cell receptor recognition of MHC class II-bound peptide flanking residues enhances immunogenicity and results in altered TCR V region usage. Immunity 7: 387-399. [Medline]
  21. Pu, Z., J. A. Carrero, E. R. Unanue. 2002. Distinct recognition by two subsets of T cells of an MHC class II-peptide complex. Proc. Natl. Acad. Sci. USA 99: 8844-8849. [Abstract/Free Full Text]
  22. Allen, P. M., G. R. Matsueda, R. J. Evans, J. B. Dunbar, Jr, G. R. Marshall, E. R. Unanue. 1987. Identification of the T-cell and Ia contact residues of a T-cell antigenic epitope. Nature 327: 713-715. [Medline]
  23. DiPaolo, R. J., E. R. Unanue. 2002. Cutting edge: chemical dominance does not relate to immunodominance: studies of the CD4+ T cell response to a model antigen. J. Immunol. 169: 1-4. [Abstract/Free Full Text]
  24. Hill, J. A., S. Southwood, A. Sette, A. M. Jevnikar, D. A. Bell, E. Cairns. 2003. Cutting edge: the conversion of arginine to citrulline allows for a high-affinity peptide interaction with the rheumatoid arthritis-associated HLA-DRB1*0401 MHC class II molecule. J. Immunol. 171: 538-541. [Abstract/Free Full Text]
  25. Asaga, H., K. Nakashima, T. Senshu, A. Ishigami, M. Yamada. 2001. Immunocytochemical localization of peptidylarginine deiminase in human eosinophils and neutrophils. J. Leukocyte Biol. 70: 46-51. [Abstract/Free Full Text]
  26. Asaga, H., M. Yamada, T. Senshu. 1998. Selective deimination of vimentin in calcium ionophore-induced apoptosis of mouse peritoneal macrophages. Biochem. Biophys. Res. Commun. 243: 641-646. [Medline]
  27. Nagata, S., T. Senshu. 1990. Peptidylarginine deiminase in rat and mouse hemopoietic cells. Experientia 46: 72-74. [Medline]
  28. Vossenaar, E. R., T. R. Radstake, A. van der Heijden, M. A. van Mansum, C. Dieteren, D. J. de Rooij, P. Barrera, A. J. Zendman, W. J. van Venrooij. 2004. Expression and activity of citrullinating peptidylarginine deiminase enzymes in monocytes and macrophages. Ann. Rheum. Dis. 63: 373-381. [Abstract/Free Full Text]
  29. Byersdorfer, C. A., R. J. Dipaolo, S. J. Petzold, E. R. Unanue. 2004. Following immunization antigen becomes concentrated in a limited number of APCs including B cells. J. Immunol. 173: 6627-6634. [Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ireland, J.
Right arrow Articles by Unanue, E. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ireland, J.
Right arrow Articles by Unanue, E. R.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS