|
|
||||||||
: Negative Regulation of Dendritic Cell Migration and T Cell Priming1


,||
* Laboratory of Molecular Cell Biology, Institute of Biochemistry and Cell Biology, Shanghai Institute of Biological Sciences, Chinese Academy of Sciences (CAS), Shanghai, China;
Fudan University School of Medicine, Shanghai, China;
Health Science Institute, Shanghai Institute of Biological Sciences, Shanghai, China;
Department of Immunology, M. D. Anderson Cancer Center, Houston, TX 77030;
¶ Laboratory of Molecular Virology, Institute Pasteur of Shanghai, CAS, Shanghai, China; and
|| Immunology Division, E-Institutes of Shanghai Universities, Shanghai, China
| Abstract |
|---|
|
|
|---|
is considered to be a Th1 cytokine with immunomodulatory effects on a variety of immune cells. In this study, we determined whether dendritic cell (DC) function was aberrant in IFN-
knockout (GKO) mice. The results demonstrated that IFN-
deficiency did not interfere with bone marrow-derived DC development and maturation in vitro. However, functional analysis showed that bone marrow-derived DC from GKO mice had altered cytokine secretion, allostimulatory and Ag presentation capacity, chemokine receptor expression, and in vitro chemotaxis. LPS induced the recruitment of DC from different organs into the spleen; epicutaneously sensitized DC with hapten (FITC) accumulated in the draining lymph nodes and CD11c+ DC levels in the draining lymph nodes from autoantigen (interphotoreceptor retinoid-binding protein) immunized mice were enhanced in GKO mice as compared with wild-type mice. After treatment of GKO mice with i.p. IFN-
injection restored IFN-
levels in vivo, DC migration decreased in response to LPS or FITC. IFN-
altered the adaptive immune responses in vivo, since T cell priming and IL-2 production were increased in interphotoreceptor retinoid-binding protein-immunized GKO mice. Furthermore, in IFN-
-treated GKO mice, experimental autoimmune uveitis score enhancement and T cell activation were eliminated. Taken together, IFN-
appears to play a negative regulatory role on in vivo DC function, resulting in suppression of Ag-specific T cell priming. | Introduction |
|---|
|
|
|---|
, a cytokine with multiple immunoregulatory effects, mediates host defense against infection and is a potent activator of mononuclear phagocytes (1). IFN-
, released during early and late stages of the immune response by NK cells and activated T cells, respectively, regulates several aspects of the immune response (2). IFN-
also acts upon uncommitted myeloid immature dendritic cells (DC)4 to polarize them into Th1 cell-promoting effector cells that produce high levels of IL-12 upon stimulation (3). Recent data suggest that APCs, including DC and macrophages, also produce a large amount of IFN-
(4). One study suggests that IFN-
plays a previously unidentified role in the homeostatic control of T cells (5). This regulatory role of IFN-
may be relevant to immune responses to microbial Ags (6, 7). It also could play a role in mediating responses to Ags other than microbial ones. For example, normal mice treated with anti-IFN-
Ab or IFN-
knockout (GKO) mice show paradoxically more severe disease after immunization with autoantigen proteins using autoimmune disease animal model protocols (8, 9, 10, 11, 12). Additionally, reports from Tarrant et al. (13) and Gran et al. (14) that IL-12 treatment could induce high IFN-
in vivo and then suppress experimental autoimmune uveitis (EAU) or experimental autoimmune encephalomyelitis through an apoptosis mechanism also support a regulatory role for IFN-
. Despite these studies suggesting an integral role for IFN-
in T cell homeostasis, the underlying cellular mechanisms by which this cytokine regulates T cell homeostasis and activation are not fully known. DC are the most potent APCs for priming naive T cells (15). Upon contact with bacterial components or proinflammatory mediators, immature DC that have captured Ag in the periphery migrate to the T cell zone of lymphoid organs where they present Ag in the context of MHC molecules. During migration from the periphery to the lymph nodes (LN), DC undergo a maturation process that results in morphological and functional changes. Chemokines have emerged as important regulators of DC migration (16). DC are both the target and the source of chemokines. DC express receptors that respond to a set of chemoattractants, that overlap with, but are distinct from, those active on other leukocytes (16). DC functional maturation is associated with loss of responsiveness to chemokines present at sites of inflammation and with acquisition of a receptor repertoire that renders these cells responsive to signals that guide their localization in lymphoid organs (16).
IFN-
exerts a multitude of cellular biological effects. It is the main activator of macrophages, and also regulates Ag-specific immune response deriving from its effects upon APCs and upon B, NK cells, and T lymphocytes. Given that multiple defects of immune cell (macrophage, NK cell) function occur in mice with disrupted IFN-
genes (17), in this study, we focused upon aberrant DC development and function in GKO mice in response to immune stimulation in vitro and in vivo. IFN-
-deficient bone marrow-derived (BM) DC showed an enhanced IL-12 production, allostimulatory and Ag presentation capacity, along with altered chemokine receptors expression and in vitro chemotaxis. Perturbation of IFN-
activity in vivo enhanced the splenic DC population in response to i.p. administration of LPS. After contact sensitization of GKO mice, substantially more DC accumulated in the draining LN. At an early stage of EAU induction, enhancement of DC number and CD40 expression on the cell surface of draining LN was evident in immunized GKO mice. GKO mice treated with i.p. IFN-
injection showed the reduced in vivo DC migration in response to LPS or the hapten, FITC. Finally, the interphotoreceptor retinoid-binding protein (IRBP)-specific T cell proliferation, IL-2 production, and EAU score were eliminated in recombinant IFN-
-treated GKO mice. The novel role of IFN-
in DC migration and T cell priming thus provides a new clue in the assessment of Ag-specific T cell priming in vivo in GKO mice.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6 (B6) mice to be used as wild-type (WT) mice and GKO mice on a B6 background were purchased from The Jackson Laboratory. Animals were kept in a specific pathogen-free facility at the Chinese Academy of Sciences (Shanghai, China). Animal care and use were in compliance with institutional guidelines.
Medium and reagents
RPMI 1640 (Invitrogen Life Technologies) supplemented with 10% heat-inactivated FCS, 100 U/ml penicillin, 100 µg/ml streptomycin, 1 mM sodium pyruvate, 2 mM L-glutamine, and 5 x 105 M 2-ME was used for DC culture. Mouse rGM-CSF, BSA, keyhole limpet hemocyanin (KLH), pertussis toxin, and CFA were purchased from Sigma-Aldrich. IRBP was isolated from bovine retinas and was purified chromatographically as previously described (18). Mycobacterium tuberculosis strain H37RA and LPS (Escherichia coli 0111:B4) were from Difco. Immunostimulatory CpG-containing oligodeoxynucleotide 1826 (TCCATGACGTTCCTGACGTT) (19) was synthesized with a nuclease-resistant phosphorothioate backbone by Operon Technologies. Mouse rIFN-
was purchased from PeproTech.
Generation of BM DC
BM cells harvested from femurs and tibias of WT or GKO mice were cultured in 24-well plates (Corning Costar) (2 x 106/well) in 1 ml of culture medium supplemented with 20 ng/ml murine rGM-CSF. Thus, predominantly immature DC were obtained on day 8. The selection procedures were similar to those reported initially by Inaba et al. (20) with minor modifications as described (21). To assess the effect of IFN-
on DC, 2 µg/ml neutralizing anti-IFN-
Ab was added into WT DC culture medium to neutralize autosecreting IFN-
, or 1 ng/ml rIFN-
was added into GKO DC to restore IFN-
during DC differentiation. On day 8, DC were harvested, washed twice, and used in subsequent experiments. For DC phenotype and Ag uptake analysis, 100 ng/ml LPS or 5 µg/ml CpG were added to DC cultures for the final 24 h of incubation. For the RNase protection assay and in vitro chemotaxis analysis, on day 7, DC were collected and then incubated with culture medium for 4 h. For CCR5 expression, DC were collected on days 1, 3, 5, and 7, and CCR5 was detected using flow cytometry.
Flow cytometry
DC were incubated with the following primary mAbs: FITC-labeled anti-mouse MHC class II (IA/IE) (clone M5/114.15.2; eBioscience), PE-labeled anti-mouse CD11c (clone HL3), FITC-labeled anti-mouse CD86 (clone GL1), FITC-labeled anti-mouse CD40 (clone 5C3), and PE-labeled anti-mouse CCR5 (clone C34-3448) (all from BD Pharmingen). Where possible, cells were incubated with anti-CD16/CD32 (2.4G2) to reduce nonspecific binding of mAbs. Appropriate fluorochrome-conjugated, isotype-matched, irrelevant mAbs were used as negative controls. All staining reactions were performed on ice. After each step, cells were washed two times with 1% FCS and 0.1% sodium azide in PBS. After the final incubation, cells were fixed with paraformaldehyde (1%). Cells were analyzed on a FACSCalibur cytometer using CellQuest software (BD Biosciences).
Endocytic activity assay
BM DC were incubated with 0.5 mg/ml FITC-dextran (Mr 40,500; Sigma-Aldrich) for 30 min at 37°C or at 4°C as a negative control. Cells were washed four times with 1% FCS and 0.1% sodium azide in PBS and analyzed using flow cytometry.
Intracellular staining and ELISA
For analysis of intracellular IL-12 and IL-10 production, on day 7, DC were incubated in the presence or absence of 100 ng/ml LPS for 6 h. Brefeldin A (10 µg/ml) was added for the last 4 h. Cells were stained as described above with PE-labeled anti-mouse IL-12p40/p70 (clone C15.6; BD Pharmingen) and FITC-labeled anti-mouse IL-10 (clone JES5-16E3; BD Pharmingen). Appropriate fluorochrome-conjugated, isotype-matched, irrelevant mAbs were used as negative controls.
For analysis of cytokines by ELISA, cultures were set up as described above. The supernatants from DC cultures in the presence or absence of LPS for 24 h were collected for determination of IL-12p70 and IL-10 production (R&D Systems).
RT-PCR analysis of cytokine mRNA expression
Total RNA from BM DC was isolated using TRIzol reagent obtained from Invitrogen Life Technologies. cDNA was synthesized from 2 µg of total RNA using M-MLV Reverse Transcriptase from Invitrogen Life Technologies. Primers used for cytokine and CCR7 were as follows: 5'-CTCATGGCTGTTTCTGGCTGTTA-3' and 5'-GACGCTTATGTTGTTGCTGATGG-3' for IFN-
; 5'-CTGCTTGCAAAGGATCCGCCAAGG-3' and 5'-CTCAGTCAGAGTTGCTGCTCCGTG-3' for IL-23 p19; 5'-TGTTGTAGAGGTGGACTGG-3' and 5'-TGGCAGGACACTGAATACTT-3' for p40; 5'-ACAAGCCTGTAGCCCACG-3' and 5'-TCCAAAGTAGACCTGCCC-3' for TNF-
; 5'-CCAGGAAAAACGTGCTGGTG-3' and 5'-GGCCAGGTTGAGCAGGTAGG-3' for CCR7; 5'-ACGACCCCTTCATTGACC-3' and 5'-AGACACCAGTAGACTCCACG-3' for GAPDH. PCR conditions: denaturation for 45 s at 94°C; anneal at 60°C for hypoxanthine phosphoribosyltransferase (HPRT), p40, TNF-
and 57°C for IFN-
, IL-23 p19 and CCR7, all for 45 s; and extension for 45 s at 72°C. cDNA samples were amplified at 26 cycles for HPRT, at 32 cycles for IFN-
, p40, IL-23 p19, and CCR7, at 33 cycles for TNF-
. PCR products were resolved on a 1.5% agarose gel containing ethidium bromide and analyzed using FURI SmartView 2000 (Shanghai).
MLR and Ag presentation assay
For MLR, WT DC or GKO DC were exposed to 15 Gy of x-ray irradiation, and 1 x 104 cells/well were added to round-bottom 96-well microtiter plates. Allogeneic responder T cells from BALB/c mice were purified as described (21) with a resulting purity of >98%, and added at a final concentration of 2 x 105 cells/well. To test Ag-presenting capacities, WT mice were immunized with 50 µg of KLH in a 0.1-ml emulsion (1:1 v/v) with CFA (containing 2.5 mg/ml M. tuberculosis). Seven days after KLH immunization, draining LN cells were collected and CD4+ T cells were purified as responder cells. WT or GKO BM DC were pulsed with 50 µg/ml KLH for 36 h and washed three times. Then 4 x 104 cells/well irradiated BM DC and 2 x 105 cells/well responder CD4+ T cells were cocultured in 96-well microtiter plates. The cultures were then incubated for 96 h, followed by an 18-h pulse with 0.5 µCi [3H]thymidine/well. Results are expressed as mean cpm ± SD for triplicate wells. The supernatants were collected after 96 h, and IL-2, IFN-
, and IL-4 secretion was measured by ELISA (R&D Systems).
RNase protection assay
Total RNA was isolated using TRIzol reagent obtained from Invitrogen Life Technologies. The assay was performed using the RiboQuant Multiprobe RNase Protection Assay kit (BD Pharmingen). Briefly, the purity of RNA was determined from the A260/280 absorbance ratio. Probes were synthesized by T7 RNA polymerase with incorporation of [
-32P]UTP (spec. act.: 3000 Ci/mM; Amersham). Eight micrograms of total RNA were treated overnight with synthesized probes (3 x 105 cpm/µl) at 56°C in a total of 10 µl of hybridization buffer, followed by treatment with RNase A (80 µg/ml) and T1 (250 U/ml) for 45 min at 30°C. The murine L32 and GAPDH riboprobes were used as controls. Protected fragments were submitted for electrophoresis through a 7.0 M urea/5% polyacrylamide gel, and then exposed to Kodak X-omat film for 24 h.
Chemotaxis assay
The chemotaxis analysis in vitro was performed as described previously (21) with minor modifications. Recombinant RANTES (100 ng/ml; R&D Systems) was diluted in medium without FCS and 500 µl was added to 24-well tissue culture plates (Corning Costar). Transwell culture inserts (Corning Costar) (5.0-µm pore size) were placed in each well, and 80 µl of DC suspension (4.0 x 105 cells/well) were added to the top chamber. After incubation at 37°C in 5% CO2 for 3 h, the cells that had migrated to the bottom chamber were recovered and counted by light microscopy.
Mice treated with LPS
Mice were treated (i.p.) for 6 h with LPS (5 mg/kg body weight). Subsequently, mice were killed and spleen was harvested.
Assay for hapten-induced Langerhans cell (LC) migration
Groups of three to five mice were painted on the abdomen with 100 µl of 1% FITC (isomer I; Sigma-Aldrich) dissolved in acetone-dibutylphthalate, 1:1. Twenty-four hours after FITC painting, the draining LNs were collected. The LN cells were immunolabeled with PE-labeled anti-mouse CD11c. Two-color immunofluorescence was analyzed by flow cytometry to detect FITC-bearing DC (LC) in the draining LN.
Immunization and IFN-
treatment
In EAU induction, mice were immunized s.c. with 100 µg of IRBP in a 0.2-ml emulsion (1:1 v/v) with CFA (containing 2.5 mg/ml M. tuberculosis) and were given pertussis toxin (0.5 µg/0.1 ml) i.p. as an additional adjuvant. Forty-eight hours later, the draining LN were collected from the mice that had been immunized with IRBP. Single-cell suspensions of the draining LN cells were prepared and were stained with anti-CD11c and CD40 mAbs. CD11c+ and CD40+ positive cells were detected by flow cytometry. For IFN-
treatment in the EAU model, GKO mice were treated with rIFN-
(5 µg/mouse/per day in 0.1 ml) by i.p. injection from days 1 to 5 following immunization. In LC migration and LPS-induced DC recruitment experiments, GKO mice were treated with rIFN-
(5 µg/mouse/day in 0.1 ml) by i.p injection from days 5 to day 1 before immunization.
Assay for IRBP-specific immune response in vivo
Cell suspensions were prepared from the draining LN of mice that had been immunized with IRBP 7 days previously. The cells (2 x 106 cells/ml) were cultured with or without IRBP (1 or 10 µg/ml) in 96-well plates (Corning Costar) in complete RPMI 1640 medium containing 0.5% syngeneic normal mouse serum (21). The cultures were incubated for 96 h followed by an 18-h pulse with 0.5 µCi [3H]thymidine/well. Results are expressed as mean cpm ± SD for triplicate wells. The supernatants were collected after 48 h and IRBP-specific IL-2, IFN-
, and IL-4 secretion were measured by ELISA (R&D Systems).
Reproducibility and data presentation
Experiments were repeated usually three or more times. Figures show data compiled from a representative experiment, or from several independent experiments, as specified. Results represent the mean values ± SD where applicable. Statistical significance of differences was analyzed using the independent Student t test. Probability values of
0.05 were considered significant. The results of statistical analysis are given in the figure legends.
| Results |
|---|
|
|
|---|
-deficient BM DC
Because it was suspected that DC function may be aberrant in GKO mice, we initially investigated whether IFN-
deficiency interferes with BM DC development and maturation in vitro. Mononuclear cells isolated from total bone marrow from WT and GKO mice were cultured for 8 days, in the presence of GM-CSF to induce DC differentiation. On day 7, LPS or CpG was added to the culture medium as a maturing agent. Routinely, the bone marrow cultures from WT and GKO mice yielded equal amounts of CD11c+ DC (data not shown). To investigate whether IFN-
deficiency might interfere with DC development and maturation, BM DC derived from WT and GKO mice were harvested after overnight stimulation with LPS or CpG to maturation. Then several DC surface markers and costimulatory molecules were determined by FACS analysis. Overlays of DC derived from GKO mice (GKO DC) and DC derived from WT mice (WT DC) FACS histograms are shown in Fig. 1A. The cell surface levels of the DC marker CD11c, MHC class II molecules, and the costimulatory molecules CD86 and CD40 were similar in GKO and WT DC. One of the surface markers, MHC class II molecules, was increased slightly on the GKO DC stimulated with CpG. To address whether the capacity of uptake Ag of DC is normal, FITC-dextran-uptake capacity in vitro was performed in WT and GKO DC. It was interesting to observe that the internalized FITC-dextran was also similar in WT and GKO DC (Fig. 1B). Taken together, these data suggest that IFN-
deficiency does not appear to interfere with BM DC development and maturation in vitro.
|
-deficient BM DC
IL-12 and IL-10 are the most important cytokines secreted by DC, and they play a crucial role in T cell differentiation and proliferation (22). To investigate whether IFN-
deficiency might interfere with cytokine secretion of BM DC, mature BM DC derived from WT and GKO mice were harvested after stimulation with LPS. IFN-
-deficient BM DC were found to secrete more IL-12 than WT DC after LPS stimulation as assayed using two-color FACS analysis and ELISA (Fig. 2, A and B). In contrast, IL-10 expression was relatively higher in WT DC when tested in ELISA. To determine whether IFN-
deficiency might interfere with other cytokine expression, the DC were incubated for 4 h with culture medium supplemented with GM-CSF, and expression of IL-12 (IL-23) p40, TNF-
, CCR7, and IL-23 p19 in WT DC or GKO DC was examined using RT-PCR (Fig. 2C). As expected, IFN-
was undetectable in GKO DC. Interestingly, all tested cytokines were found at increased levels in GKO DC as compared with WT DC. Our study and the studies of others showed that DC produce significant amounts of IFN-
upon stimulation (4), indicating that the changes of cytokine expression in GKO DC may be related to its functional modification.
|
-deficient BM DC
Based upon the observations that cytokine secretion of DC was regulated by IFN-
, we hypothesized that IFN-
-deficient BM DC may significantly modify T cell functions. To address this question, DC-induced primary MLR- and KLH-specific T cell activation were tested in this study. In the first experiment, WT DC or GKO DC were cocultured with naive T cells from BALB/c mice in a standard 96-h primary MLR. The cultured supernatants (DC-T cell ratio of 1:20) were collected, and cytokines (IL-2, IFN-
, and IL-4) were measured by ELISA. In the presence or absence of LPS stimulation, GKO DC had a greater ability to stimulate T cell proliferation and promote IL-2 and IFN-
secretion as compared with WT DC in MLR (Fig. 3, AC). IL-4 was undetectable by ELISA (data not shown). To further confirm whether IFN-
is involved in this regulation directly, anti-IFN-
-neutralizing Ab (2 µg/ml) was added into WT DC culture medium to delete autocrine IFN-
, or rIFN-
(1 ng/ml) was added into GKO DC to restore IFN-
during DC differentiation. After an additional 24-h stimulation with LPS, these DC as stimulating cells were cocultured with naive CD4+ T cells from BALB/c mice. The results showed that WT DC treated with IFN-
-neutralizing Ab could enhance MLR and, conversely, that the IFN-
treatment in GKO DC dramatically decreased this reaction.
|
, and IL-4) were measured using ELISA. The data showed that the KLH-specific T cell proliferation was increased when T cells were primed with GKO DC as compared with WT DC (Fig. 3D). KLH-specific IL-2 and IFN-
production were also enhanced in GKO DC-stimulated T cells (Fig. 3, E and F). IL-4 was undetectable in cell culture supernatants in both groups (data not shown). Similarly, IFN-
neutralization could enhance WT DC Ag presentation capacity and the treatment of GKO DC with IFN-
decreased this function. These results revealed that in our experimental conditions, IFN-
-deficient BM DC exhibited an enhancement in production of cytokines and in activation of T cells as compared with WT DC, suggesting that IFN-
plays some regulatory role in DC function.
Chemokine receptor expression and in vitro chemotaxis analysis of IFN-
-deficient BM DC
DC function is associated with loss of responsiveness to chemokines present at sites of inflammation and with acquisition of a receptor repertoire that renders these cells responsive to signals that guide their localization in lymphoid organs (16). Therefore, we monitored the mRNA expression profile of a panel of chemokine receptors related to DC migration. Where possible, the synthesized proteins of chemokine receptors and their functions were confirmed. To determine the expression of chemokine receptors on DC, DC propagated from BM, as mentioned in Materials and Methods, were collected and then incubated with culture medium supplemented with GM-CSF for 4 h. The mRNA expression of chemokine receptors in DC was measured by RNase protection assays. The data showed that CCR1 was constitutively expressed in WT and GKO DC. The CCR2 and CCR5 expression in GKO DC were relatively higher than those in WT mice (Fig. 4, A and B). In contrast, the expression of CCR3 and CCR4 was not detected in our preparations of DC. The data showed that there were alterations in the mRNA expression profile of chemokine receptors from IFN-
-deficient BM DC. To further confirm CCR5 expression at the protein level, a kinetic analysis (from days 0 to 7) was assessed by FACS analysis during BM DC development. The data showed that CCR5 protein expression in GKO DC was enhanced in the culture on day 7 as compared with WT DC (Fig. 4C). To directly assess whether IFN-
regulates CCR5 expression on the surface of DC, we added a different dose of rIFN-
into GKO DC culture to restore IFN-
during DC differentiation. After 7 days of culture, DC CCR5 expression was measured by FACS. As shown in Fig. 4D, IFN-
inhibited CCR5 expression. It was noted that anti-IFN-
-neutralizing Ab could prevent this inhibition (Fig. 4D). CCR5 is a functional receptor for the CC chemokines MIP-1
, MIP-1
, and RANTES. To characterize the participation of CCR5 in triggering DC migration, a transmigration assay for chemotaxis of BM DC was used. RANTES is a high-affinity ligand responding to the CCR5 chemokine receptor. Under conditions mentioned above, the assay of chemoattractants showed that GKO DC had a relatively enhanced ability to transmigrate across the membrane in response to RANTES as compared with that of WT DC, whereas IFN-
treatment dramatically inhibited its transmigration (Fig. 4E). These data demonstrated that the DC migration in vitro is enhanced in GKO mice as compared with that in WT mice.
|
-deficient DC
Because the IFN-
-deficient BM DC altered chemokine receptor expression and in vitro migration, it is reasonable to assume that in vivo DC migration in response to microbial infection and/or from immunization sites to the draining LN might be affected. In this study, we used three different experimental systems to address the question.
We first examined the outcome of IFN-
deletion on DC homeostasis. It is well-documented that the treatment of mice with LPS provokes the recruitment of DC from different organs into the spleen (23). LPS administration in WT mice recruited 7% DC into the spleen, whereas 13% DC were recovered in GKO mice (n = 4) (Fig. 5A). The results showed that the in vivo DC migration in response to LPS was enhanced in GKO mice as compared with that in WT mice.
|
Finally, we investigated the DC status of GKO mice using the EAU model to determine their migration from immunization sites to the draining LN in vivo. To induce EAU, GKO and WT mice were immunized with IRBP in CFA. Under those conditions, GKO mice developed more serious EAU disease as compared with WT mice on day 21 after immunization. In this study (under the same conditions), 48 hours after immunization, the draining LN were collected, and cell suspensions were prepared. LN cells were immunolabeled with anti-mouse CD11c Ab and anti-mouse CD40 Ab, and then submitted to FACS analysis. As shown in Fig. 5C, the frequency of CD11c-positive cells in the draining LN was significantly higher in GKO mice than in WT mice. Similarly, CD40-positive cells are relatively more numerous in the draining LN from GKO mice (n = 5). Taken together, these data demonstrated that the in vivo DC migration in response to Ag stimulation is enhanced in GKO mice as compared with that in WT mice.
Analysis of migratory ability of DC in IFN-
knockout mice treated with rIFN-
To address whether exogenous IFN-
injection could modulate in vivo DC migration in GKO mice in response to microbial infection or Ags, two experiments were performed in GKO mice, in which GKO mice were pretreated with an i.p. injection of IFN-
(5 µg/mouse/day) for 5 days to restore IFN-
level. In the first experiments, after IFN-
treatment the mice were treated with LPS. Twenty-four hours after LPS injection, DC number was determined in the spleen of GKO mice by FACS analysis. The results showed that after IFN-
treatment, the enhanced DC number was decreased in GKO mice as compared with WT control (Fig. 6A). The results showed that the in vivo DC migration in GKO mice in response to LPS was down-regulated by exogenous IFN-
. Similarly, in the second experiment of contact hypersensitivity, under the same conditions, IFN-
treatment resulted in a decreased frequency of CD11c+, FITC-bearing cells in the draining LNs of GKO mice (Fig. 6B). The data showed that DC numbers were significantly lower in GKO mice treated with IFN-
injection (1.20%) than in GKO mice without IFN-
treatment (2.24%) (n = 5). The results demonstrated that after treatment with rIFN-
, the enhanced DC migration in GKO mice was decreased, a finding consistent with our hypothesis that DC migration was negatively regulated by IFN-
.
|
suppressed T cell activation and eliminated EAU induction
Because the disruption of the IFN-
gene results in enhancement of DC migration and T cell priming, we suspected that in the EAU model of IRBP-specific T cell activation and disease development would be promoted in GKO mice. In contrast, if the mice were treated with recombinant murine IFN-
at an early stage of EAU induction in GKO mice, the T cell activation and disease score were eliminated. To address this question, the GKO mice were given systemic treatment with recombinant murine IFN-
(5 µg/mouse/day) for 5 days (days 05) following immunization. IRBP-specific T cell proliferation and cytokine production were measured in the draining LN on days 7 and 21 following immunization. As expected, Ag-specific T cell proliferation and IL-2 production were enhanced in GKO mice on both days 7 and 21 as compared with WT mice (Fig. 7, AD). After the treatment with recombinant murine IFN-
, IRBP-specific T cell activation and IL-2 production were significantly suppressed. Similarly, the EAU score was reduced in IFN-
-treated GKO mice (Fig. 7E). This result is consistent with the observation by Caspi et al. (12) that treatment of WT mice with IFN-
attenuates EAU.
|
in GKO mice is associated with enhancement of DC migration and T cell activation. After treatment with IFN-
, the enhancement was partially reversed in GKO mice, confirming that in normal mice IFN-
is a negative regulator of DC migration and T cell activation. | Discussion |
|---|
|
|
|---|
by NK cells plays an important role in bringing about acute inflammation, mainly because of the activating effects of IFN-
on adhesive properties of endothelial cells and on mediator production by macrophages (25). In the subsequent Ag-specific phase of the immune response, IFN-
acts as a regulator of Ag presentation and as a promoter of lymphocyte proliferation and differentiation. The regulatory role of IFN-
in this phase derives from its effects upon APCs and upon B cells and T lymphocytes. Immunosuppressive as well as immunostimulatory effects may result from these actions (26). Our studies show the impact of IFN-
on DC migration and T cell priming, demonstrating for the first time another mechanism by which IFN-
may determine the overall outcome of the immune response.
Chiang et al. (27) showed that DC deficient in IFN-
from mice with BALB/c background stimulate significantly higher proliferative responses in allogeneic T cells compared with DC derived from normal controls. In addition, allogeneic T cells stimulated by DC deficient in IFN-
expression from mice with BALB/c background consistently generate higher specific cytotoxic activity than those stimulated by DC from WT animals. These data suggested that IFN-
produced by DC may be a negative regulator of DC function.
Our data show that DC deficient in IFN-
with C57BL/6 background, compared with DC derived from normal controls, produce higher IL-12 levels and enhanced Ag presentation capacity under LPS stimulation. GKO DC show higher capacity in activation of allogeneic and syngeneic T cells. In addition, our findings demonstrate that IFN-
alters the migratory capacity of DC. We detected alterations in a number of molecules (such as chemokine receptors) and functional change (CCR5 response to RANTES) in GKO DC. The data suggested that GKO DC had higher CCR5 expression and that exogenous IFN-
could inhibit CCR5 expression during DC differentiation. The functional experiment confirmed that accelerating migration of GKO DC was higher than that of WT DC in vitro in response to RANTES. Other chemokine receptors, such as CCR2 and CCR7 mRNA expression, were also highly expressed in GKO DC as compared with WT DC. The results suggest that an alteration of chemokine receptor expression (such as CCR2, CCR5, and CCR7) on DC in GKO mice may coordinately regulate DC migration in the absence of IFN-
.
Tarrant et al. (13) demonstrated that the protective effect of IFN-
in EAU is in part due to elimination of newly primed effector T cells by NO-dependent apoptosis. Here, we show that the protective role of IFN-
in this EAU model could be attributed in part to its regulatory effect on DC cytokine secretion and migration, in turn influencing T cell priming and activation.
IFN-
release during the Ag-nonspecific and Ag-specific phase of the immune response could counterbalance inflammatory stimuli by delaying the arrival of mature DC to LN, thereby impairing the initiation of immune responses and leading to a functional state of tolerance. This mechanism may explain that local IFN-
activity in the thyroid is sufficient for limiting experimental autoimmune thyroiditis partly by inhibition of DC migration resulting in suppression of lymphocyte activation in cervical LN (28). Recent data showed that IFN-
appears to suppress trafficking in a variety of immune cells. Flaishon et al. (29) reported that autocrine secretion of IFN-
negatively regulates homing of immature B cells to the LN. Low dose IFN-
appears to exert global suppressive effects on T cell trafficking and may have clinical application as an anti-inflammatory agent (30). These results are in line with our observations that DC from GKO mice may have a higher capacity to migrate into spleen and draining LN in response to LPS and Ag immunization as compared with WT DC. In addition, exogenous IFN-
treatment is capable of reversing this capacity, indicating that IFN-
plays a negative regulatory role in DC migration.
One study proposed that in the DC precursors or immature DC-resident microenvironment, a balance between pro- and anti-inflammatory cytokines, chemokines, and cell-contact signals may control DC migration (31). In the normal state, surrounding cells do not produce significant amounts of cytokines and chemokines that are essential to maintain DC homeostatic migration. Some stimuli, such as contact allergens and microbial infections, are capable of inducing significant amounts of proinflammatory cytokines and chemokines, thus promoting DC migration. At a later stage of immune response, some regulating cells, such as DC and T cells, may also produce anti-inflammatory cytokines and chemokines to inhibit DC migration, and terminate the immune response, restoring it to a basal level. Based upon this notion, we hypothesized that IFN-
may have dual functions, either as a strong proinflammatory cytokine to initiate immune response and serve as a Th1 response inducer, or as a negative regulator to control DC migration. The other potential explanation is that an impairment of NK cellular function in GKO mice may cause NK cells not to be capable of lysing DC, and result in enhancing DC migration (25).
That DC migrate from immunization sites to the draining LN and ultimately accumulate in the T cell zone likely represents an important parameter that impacts upon T cell priming. A large number of DC increases the probability of a DC-T cell encounter, delivering a sustained stimulation through monogamous or successive interactions between DC and T cells (32, 33). In contrast, low numbers of poorly stimulatory DC induce abortive T cell proliferation and tolerance (34, 35, 36). Mature DC reaching lymph nodes induce a rapid and sustained congestion of lymphocyte traffic and DC number determines the magnitude of T cell proliferation and effector response. In accordance with these observations, our data show that the enhancement of DC migration in GKO mice results in in vivo activation of IRBP-specific T cell priming, in the form of highly increased proliferation and high amounts of IL-2 production in the draining LN. That the EAU score was enhanced in GKO mice and that this effect was partly reversed in IFN-
-treated GKO mice further confirm our conclusion that IFN-
plays a crucial role in dampening immune responses.
We must emphasize that IFN-
has multiple functions; besides interfering with DC migration, IFN-
may also modulate the function of APCs in priming T cells. We have observed that GKO DC have a relatively greater ability to prime T cells with KLH Ag stimulation. During DC development, when exogenous IFN-
was used to treat GKO DC, this enhanced ability was reversed. Hence, IFN-
regulation of T cell priming through DC-T cell interaction may prove to be an additional mechanism. In in vivo studies, we could not exclude the possibility that IFN-
may also directly regulate T cell activation by another mechanism.
In conclusion, our results reveal the important role of IFN-
in DC migration and this new finding may serve to explain, in part, why mice with disrupted IFN-
genes show enhanced Ag-specific T cell priming in vivo. Our observations suggest a new mechanism by which IFN-
may control the outcome of the immune response.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by grants from the Technology Commission of Shanghai Municipality (04DZ14902 and 04DZ19108), the National Key Basic Research Program of China (2001CB510006), the National Natural Science Foundations of China (30421005 and 30530700), the Outstanding Young Scientist Fund of the National Natural Science Foundation of China (30228016 and 30325018), and a grant from the E-institutes of Shanghai Universities Immunology Division. ![]()
2 X.W. and W.H. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Bing Sun, Laboratory of Molecular Immunology, Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, 320 Yueyang Road, Shanghai 200031, China. E-mail address: bsun{at}sibs.ac.cn ![]()
4 Abbreviations used in this paper: DC, dendritic cell; GKO, IFN-
knockout; EAU, experimental autoimmune uveitis; LN, lymph node; WT, wild type; IRBP, interphotoreceptor retinoid-binding protein; KLH, keyhole limpet hemocyanin; BM, bone marrow derived; HPRT, hypoxanthine phosphoribosyltransferase; LC, Langerhans cell. ![]()
Received for publication June 20, 2005. Accepted for publication April 20, 2006.
| References |
|---|
|
|
|---|
: mechanism of action and therapeutic potential. Biochem. Pharmacol. 40: 1433-1439. [Medline]
. Annu. Rev. Immunol. 15: 749-795. [Medline]
production by antigen-presenting cells: mechanisms emerge. Trends Immunol. 22: 556-560. [Medline]
is required for activation-induced death of T lymphocytes. J. Exp. Med. 196: 999-1005.
eliminates responding CD4+ T cells during mycobacterial infection by inducing apoptosis of activated CD4 T cells. J. Exp. Med. 192: 117-122.
. Science 290: 1354-1358.
confers resistance to experimental allergic encephalomyelitis. Eur. J. Immunol. 26: 1641-1646. [Medline]
gene are susceptible to the induction of experimental autoimmune encephalomyelitis (EAE). J. Immunol. 156: 5-7. [Abstract]
-deficient mice leads to exacerbation of experimental autoimmune encephalomyelitis. J. Exp. Med. 192: 123-128.
-deficient mice develop experimental autoimmune uveitis in the context of a deviant effector response. J. Immunol. 158: 5997-6005. [Abstract]
has a protective role against ocular autoimmunity in mice. J. Immunol. 152: 890-899. [Abstract]
, nitric oxide, and apoptosis. J. Exp. Med. 189: 219-230.
. J. Neuroimmunol. 156: 123-131. [Medline]
genes. Science 259: 1739-1742.
: an update. Ann. NY Acad. Sci. 856: 22-32. [Medline]
limits experimental autoimmune thyroiditis by suppressing lymphocyte activation in cervical lymph nodes. J. Immunol. 170: 5523-5529.
negatively regulates homing of immature B cells. J. Exp. Med. 192: 1381-1388.
. J. Immunol. 168: 3707-3711. This article has been cited by other articles:
![]() |
Y. Ren, L. Lu, T. B. Guo, J. Qiu, Y. Yang, A. Liu, and J. Z. Zhang Novel Immunomodulatory Properties of Berbamine through Selective Down-Regulation of STAT4 and Action of IFN-{gamma} in Experimental Autoimmune Encephalomyelitis J. Immunol., July 15, 2008; 181(2): 1491 - 1498. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hu, X. Hu, L. Boumsell, and L. B. Ivashkiv IFN-{gamma} and STAT1 Arrest Monocyte Migration and Modulate RAC/CDC42 Pathways J. Immunol., June 15, 2008; 180(12): 8057 - 8065. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bouguermouh, V. Q. Van, J. Martel, P. Gautier, M. Rubio, and M. Sarfati CD47 Expression on T Cell Is a Self-Control Negative Regulator of Type 1 Immune Response J. Immunol., June 15, 2008; 180(12): 8073 - 8082. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Frasca, M. Nasso, F. Spensieri, G. Fedele, R. Palazzo, F. Malavasi, and C. M. Ausiello IFN-{gamma} Arms Human Dendritic Cells to Perform Multiple Effector Functions J. Immunol., February 1, 2008; 180(3): 1471 - 1481. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. Zimmermann, A. Casati, C. Schiering, S. Caserta, R. Hess Michelini, V. Basso, and A. Mondino Tumors Hamper the Immunogenic Competence of CD4+ T Cell-Directed Dendritic Cell Vaccination J. Immunol., September 1, 2007; 179(5): 2899 - 2909. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-J. Ko, Y.-J. Kim, Y.-S. Kim, W.-S. Chang, S.-Y. Ko, S.-Y. Chang, S. Sakaguchi, and C.-Y. Kang A Combination of Chemoimmunotherapies Can Efficiently Break Self-Tolerance and Induce Antitumor Immunity in a Tolerogenic Murine Tumor Model Cancer Res., August 1, 2007; 67(15): 7477 - 7486. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Barber, T. Zhang, B. A. Gagne, and C. L. Sentman NK Cells Negatively Regulate Antigen Presentation and Tumor-Specific CTLs in a Syngeneic Lymphoma Model J. Immunol., May 15, 2007; 178(10): 6140 - 6147. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |