The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Clements, J. L.
Right arrow Articles by Garrett-Sinha, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Clements, J. L.
Right arrow Articles by Garrett-Sinha, L. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
The Journal of Immunology, 2006, 177: 905-912.
Copyright © 2006 by The American Association of Immunologists

Impaired Generation of CD8+ Thymocytes in Ets-1-Deficient Mice1

James L. Clements2,*, Shinu A. John{dagger} and Lee Ann Garrett-Sinha{dagger}

* Department of Immunology, Roswell Park Cancer Institute, Buffalo, NY 14263; and {dagger} Department of Biochemistry, State University of New York, Buffalo, NY 14241


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The Ets family of transcription factors function as key regulators of multiple aspects of immune cell development and function. To date, Ets-1 has been implicated in regulating early stages of thymic maturation and lymphocyte function and homeostasis. This report describes a novel role for Ets-1 in supporting later stages of thymic selection, in that positive selection of MHC class I-restricted CD4+CD8+ double-positive thymocytes is markedly inhibited in mice expressing a hypomorphic allele of Ets-1. This effect is thymocyte intrinsic, as Ets-1 mutant thymocytes fail to efficiently generate CD8+ single-positive thymocytes in mixed bone marrow chimeric backgrounds. Although peripheral CD8+ T cells are present in Ets-1 mutant mice, both CD4+ and CD8+ subsets contain an elevated proportion of cells with an effector memory (CD62LCD44+) phenotype. In addition, while thymic expression of Thy1 is relatively normal, peripheral T cells isolated from Ets-1 mutant mice display a striking loss of Thy1 expression. These data identify Ets-1 as a key transcription factor regulating thymocyte positive selection and lineage commitment of MHC class I-restricted thymocytes.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Members of the Ets family of transcription factors are important regulators of hemopoietic development and immune cell function, and typically bind to DNA as monomers via an ~85 aa winged-helix-turn-helix DNA-binding motif (Ets domain) (1). Ets-1 is expressed in multiple hemopoietic tissues, including the thymus, suggesting that this protein may play an important role in the development or function of lymphoid cells (2, 3, 4). In support of this idea, the numbers of thymocytes and lymph node (LN)3 resident T cells is markedly decreased in the absence of Ets-1, and Ets-1-deficient T cells undergo apoptosis more readily than wild-type counterparts (5, 6). More recently, Ets-1 has been shown to be important for optimal transition through early pre-TCR-dependent stages of thymocyte development and allelic exclusion at the TCRbeta locus (7). In the B cell compartment, Ets-1 deficiency results in impaired B cell development, an elevated frequency of IgM+ plasma cells in vivo and enhanced in vitro differentiation responses to CpG-containing oligonucleotide (a TLR9 ligand) (5, 6, 8, 9). Ets-1-deficient mice produce both IgM and IgG autoantibodies leading to immune complex deposition in the kidney (5, 8, 9). The numbers of splenic NK cells is also substantially reduced in Ets-1-deficient mice (10). Collectively, these studies demonstrate that Ets-1 plays an important role in both early stages of lymphocyte development and lymphocyte homeostasis in the periphery. Despite expression at all stages of thymocyte development, a potential role for Ets-1 in regulating thymocyte selection and lineage commitment has not been explored.

Thymocyte development is characterized by multiple phenotypic changes and maturational checkpoints that ultimately contribute to the generation of a self-tolerant peripheral T cell repertoire (11). The most immature thymocytes are CD4CD8 double-negative (DN) and comprise only a small fraction of the thymocytes in an adult mouse (<5%). The DN compartment can be subdivided further based on the expression of CD44 and CD25, with the most recent arrivals from the bone marrow being CD44+CD25 (DN1). As development continues, DN thymocytes express both CD44 and CD25 (DN2) and rearrangement at the TCRbeta locus is initiated. As thymocytes down-regulate CD44 (DN3), the rearranged TCRbeta product is expressed with a nonpolymorphic "surrogate" TCR{alpha} chain (pre-T{alpha}) (12, 13). Signaling via the pre-TCR complex drives expansion and maturation to a CD44CD25 phenotype (DN4), a process originally defined as "beta-selection" (14). From here, developing thymocytes express low levels of CD8 and begin rearrangement at the TCR{alpha} locus. As maturation progresses, CD4 and CD8 expression increases, giving rise to a CD4+CD8+ double-positive (DP) phenotype. The majority of DP thymocytes express low levels of surface TCR, which increases following positive selection and concomitant with further maturation. DP thymocytes that survive the selection process down-regulate either CD4 or CD8 (lineage commitment), giving rise to MHC-restricted single-positive (SP) thymocytes that are ultimately exported to the periphery.

The mechanisms underlying thymic selection and lineage commitment at the DP stage have been the focus of intense investigation. Signal strength and the nature of subsequent MAPK activation are key mediators of selection, with strong TCR-dependent signals giving rise to a transient but robust activation of ERK MAPKs and deletion (15, 16). Positively selecting signals are characterized by lower affinity TCR interactions that promote a low but sustained level of ERK phosphorylation. Still, it is not clear whether the mechanisms governing lineage commitment and down-regulation of CD4 or CD8 are distinct from those governing the selection process. Although evidence for a stochastic model of lineage commitment has been provided (17, 18, 19, 20), it has become more generally accepted that lineage commitment is dictated by the quality of signal emanating from the TCR/coreceptor complex that is productively engaged (21, 22, 23, 24, 25, 26, 27). Most recently, a "kinetic signaling" model of lineage commitment has been put forth suggesting that the CD4 coreceptor does not transduce unique "instructional" signals per se, but that sustained signals from the TCR/CD4 coreceptor complex appear required for commitment to the CD4 lineage (28).

In addition to the marked advancements in our understanding of the molecular pathways governing thymic selection and lineage commitment, a number of transcription factors that regulate these later stages of T cell development have also been identified (29). In this study, we show that mice carrying a hypomorphic allele of Ets-1 manifest defects in the positive selection of DP thymocytes, with a particularly striking impairment in CD8 development. This defect is intrinsic to Ets-1 mutant thymocytes, as the phenotype is clearly maintained in chimeric mice generated using mixed bone marrow. These data provide the first evidence that normal Ets-1 function promotes later stages of thymic selection and differentiation of CD8+ thymocytes, and provide a new candidate for defining the molecular and genetic events that regulate thymic selection and lineage commitment.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice

The Ets-1 mutant strain of mice used in this study has been previously described (6), and are of a mixed genetic background (C57BL/6 x 129Sv). H-Y TCR-transgenic mice were obtained from Taconic Farms. Congenic C57BL/6 (CD45.1+) mice were obtained from The Jackson Laboratory. All mice were maintained and used in accordance with the policies and guidelines set forth by the State University of New York (SUNY; Buffalo, NY) institutional animal care and use committee.

Abs and reagents

Fluorochrome-conjugated Abs specific for CD3 (2C11), CD4 (GK1.5), CD5 (53–7.3), CD8 (53-6.7), Thy1.2 (53-2.1), CD24 (M1/69), CD45.1 (A20), CD44 (IM7), CD62L (MEL-14), CD86 (GL1), HY TCR (T3.70), and H-2Kb were each purchased from BD Biosciences, Biolegend, or eBioscience and individually titered to establish an optimal staining dilution.

Isolation of lymphoid tissues and flow cytometry

Mice of the appropriate genotype were euthanized followed by isolation of thymus, spleen, and/or LN. Single-cell suspensions were prepared from each tissue and RBC were removed by hypotonic lysis. For analysis of MHC class I expression on thymic stromal cells, the thymus was finely minced and digested in medium containing 0.1% DNase (Sigma-Aldrich) and 1.6 mg/ml collagenase D (Roche) at 37°C for 30 min before staining. Cell preparations were first incubated with purified Abs specific for CD16/32 to block FcRs (clone 93; Biolegend) and then stained with the indicated fluorochrome-conjugated Abs and analyzed using a FACScan or FACSCalibur flow cytometer (BD Biosciences). Collected data (10,000–100,000 events) was analyzed using WinMDI software (version 2.8).

Generation of chimeric mice

To generate chimeric mice, 6- to 8-wk-old wild-type C57BL/6 x 129Sv hybrid host mice (CD45.2+) were lethally irradiated using a cesium source (~1000 rad) and immediately injected via the retro-orbital sinus with bone marrow cell suspensions isolated from Ets-1+/+, Ets-1+/p, or Ets-1p/p mice (all CD45.2+) alone or mixed 1:1 with bone marrow isolated from a wild-type C57BL/6 congenic mouse (CD45.1+). Chimeric mice were sacrificed ~6–8 wk later for analysis of thymocyte development.

Analysis of gene expression in DP thymocytes

Thymocyte suspensions were prepared from wild-type (C57BL/6) mice and stained with fluorescent Abs specific for CD4 and CD8. CD4+CD8+ DP thymocytes were sort-purified using a BD Biosciences FACSAria cell sorter to >95% purity and immediately lysed in TRIzol reagent (Invitrogen Life Technologies). Total RNA was prepared according to the manufacturer’s suggested protocol. Single-strand cDNA was reverse transcribed from 100 ng of total RNA using the SuperScript II Reverse Transcriptase kit (Invitrogen Life Technologies). One microliter of cDNA (of the total 20-µl reaction) was used as template in each subsequent PCR. PCR was performed with Roche FastStart Taq DNA polymerase using conditions suggested by the manufacturer. Thirty cycles of PCR were performed with the following conditions: 1 min denaturation at 94°C, 1 min annealing at 58°C, and 1 min extension at 72°C, using the following primers: hypoxanthine phosphoribosyltransferase (HPRT) (249-bp product): sense CACAGGACTAGAACACCTGC, antisense GCTGGTGAAAAGGACCTCT; Thymus HMG Box (TOX) (429-bp product): sense CTGCCTCTGATATGGGGAAA, antisense TCATTCCTGGTTGTTGGTGA; HeLa E-box-binding protein (HEB) (514-bp product): sense AACCATGCAGTTGGACCTTC, antisense GCTCTCTGGCATTGTTAGCC. Th-inducing POZ/Kruppel-like factor (Th-POK) (763-bp product): sense AGGGGTTGAGGTAGCCTTGT, antisense GCCACAAGGAGAGAGAGTGG; Run+-related transcription factor 1 (RUNX1) (687-bp product): sense GAGTCCTCAGCTGTGGGAAG, antisense TAGCAACTGGCCGCTTAGT; RUNX3 (995-bp product): sense AGGGAAGAGTTTCACGCTCA, antisense GGATGCACAGCTAGAGAGG; GATA3 (449-bp product): sense CTTATCAAGCCCAAGCGAAG, antisense AGGGCTCTGCCTCTCTAACC. PCR products were resolved on a 1% agarose gel and photographed.

Statistical analysis

When indicated, data were analyzed for statistical significance using an unpaired Students t test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The CD8 SP thymocyte compartment is markedly diminished in Ets-1-deficient mice

To assess a potential contribution of Ets-1 to the processes of thymic selection and lineage commitment, these later stages of thymocyte development were monitored in Ets-1-deficient mice. Originally described as a null allele, the mutant Ets-1 allele lacking exon 3 and a portion of exon 4 (denoted herein as Ets-1p) is actually hypomorphic and gives rise to low levels (~1–5% of endogenous Ets-1) of a mutant Ets-1 protein lacking the Pointed domain (9). Chimeric mice generated from RAG-2-deficient blastocysts and embryonic stem (ES) cells homozygous for the mutant Ets-1p allele (Ets-1p/p) manifest multiple defects in thymocyte development, including reduced thymic cellularity, an elevated frequency of immature DN thymocytes, and increased susceptibility of T cells to apoptosis (6). Furthermore, chimeric mice generated with ES cells homozygous for an independently generated Ets-1 mutant allele in which the exons encoding the DNA-binding domain were deleted (referred to hereafter as the Ets-1d allele) display additional thymocyte maturation defects including impaired beta-selection, inefficient allelic exclusion at the TCRbeta locus, and reduced expression of CD5 on peripheral T cells (5, 7). Thymic cellularity was also reduced in Ets-1p/p mice (Fig. 1A), although thymocyte yield from some Ets-1p/p mice approached that obtained from control animals. Both the DP and CD4 SP thymocyte subsets isolated from Ets-1p/p mice expressed low levels of CD5 compared with control animals (Fig. 1B), consistent with earlier reports describing reduced CD5 expression in the thymus and peripheral T cells of chimeric mice generated with mutant (Ets-1d/d) ES cells (5, 7).


Figure 1
View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 1. Thymocyte development is impaired in mice homozygous for a hypomorphic allele of Ets-1. A, Total thymocyte yields from control and Ets-1p/p mutant mice (8–14 wk old). The horizontal line indicates the average yield for each group (n = 8). B, CD5 expression on wild-type Ets-1+/+ (solid line), Ets-1+/p (dashed line), or Ets-1p/p mutant thymocytes (filled histograms). Top panel, CD5 expression on DP thymocytes; bottom panel, gated on the CD4 SP thymocyte subset. The mean fluorescence intensity (MFI) for each histogram is provided. Data are representative of four independent experiments. C, CD4 and CD8 expression on total thymocytes harvested from mice of the indicated genotype. The percentage of cells in a given quadrant is indicated. Note the visible reduction in CD8 SP thymocytes in the Ets-1p/p mutant mouse (arrowhead). D, Surface CD3 expression on total thymocytes isolated from control or Ets-1p/p mutant mice. The percentage of CD3high cells is indicated. E, CD4 and CD8 expression on gated CD3high thymocytes. The percentage of cells in each quadrant is indicated. F, Comparison of the CD4:CD8 thymocyte ratio calculated after gating on the CD3high thymocyte subset. The difference between the control (+/+, #+/p) and mutant (p/p) samples is significant (p < 0.1).

 
Upon further analysis of thymocyte development in adult (nonchimeric) Ets-1p/p mutant mice, a visible reduction in the frequency of CD8+ thymocytes was apparent (Fig. 1C, see arrowhead). To assess more stringently the ability of Ets-1p/p mutant mice to generate CD8 SP thymocytes, we first gated on the mature thymocyte subset (CD3high) and analyzed the resultant population for CD4 and CD8 expression (Fig. 1, D and E). This revealed an increased percentage of CD3high DN thymocytes, and a striking reduction in the CD8 SP thymocyte compartment in the Ets-1p/p background, resulting in a skewing of the CD4:CD8 SP thymocyte ratio in the thymus (Fig. 1F). Curiously, the generation of CD8 SP thymocytes appears to remain largely intact when either Ets-1p/p or Ets-1d/d ES cell clones are used to generate chimeric mice with RAG-2-deficient blastocysts (5, 6, 7). This might be explained, at least in part, by the observation that the reduction in CD8 SP thymocytes in the Ets-1p/p mice is most obvious when the more mature (CD3high) thymocyte population is analyzed in isolation, which was not done in the original reports.

We next analyzed expression of CD24 (heat stable Ag (HSA)) in conjunction with CD3, CD4, and CD8 to better distinguish later stages of thymocyte maturation in the Ets-1p/p background (Fig. 2). This approach revealed multiple differences between control (Ets-1+/+ or Ets-1+/p) and Ets-1p/p mice. First, an increase in the percentage of thymocytes with an immature phenotype (CD3lowCD24high) was evident in the Ets-1p/p samples when compared with controls (Fig. 2A). This population consists mainly of DP thymocytes (>90%) in control and Ets-1p/p mice (Fig. 2B). It has been demonstrated previously that TCR signaling capacity is impaired in Ets-1-deficient mature T cells (6). Suboptimal TCR signaling is predicted to impair TCR-mediated positive selection in the Ets-1p/p thymus, perhaps resulting in a higher percentage of CD3lowCD24high immature thymocytes. Still, the relative percentage of CD3highCD24high thymocytes was quite comparable between the Ets-1p/p mutants and controls, suggesting that the early transition from a CD3lowCD24high thymocyte to a CD3highCD24high phenotype proceeds relatively normally in the absence of Ets-1 (Fig. 2A). Second, there is an obvious reduction in the frequency of CD3highCD24low thymocytes in the Ets-1p/p mice (Fig. 2A). The low percentage of thymocytes with a mature phenotype (CD3highCD24low) in Ets-1p/p mice may reflect the pronounced defect in the generation of the mature CD8 SP compartment described in Fig. 1. Indeed, an obvious reduction in the frequency of CD8 SP thymocytes was observed in the CD3highCD24high thymocyte subset in Ets-1p/p mice (Fig. 2C), and to a lesser extent, in the more mature thymocyte subset (Fig. 2D), while generation of CD4 SP thymocytes was comparable between control and Ets-1p/p mice in each of the subsets analyzed. Finally, the CD3highCD24low mature thymocyte compartment contained a visible population of DP thymocytes in the Ets-1p/p mice, while virtually no DP thymocytes are observed in the CD3highCD24low subset in control animals (Fig. 2D). Both the CD3highCD24high and CD3highCD24low thymocyte subsets isolated from Ets-1p/p mice also contained increased percentages of cells with a DN phenotype (Fig. 2, C and D). These DN mature thymocytes are likely not comprised of NK T cells, as no difference in NK1.1 staining was observed when comparing control and Ets-1p/p thymocyte subsets (data not shown). These data suggest that, in the Ets-1p/p background, MHC class I-restricted thymocytes may either be retained in the abnormal DP thymocyte compartment with a mature phenotype, or "diverted" into an alternate differentiation pathway characterized by acquisition of a DN phenotype.


Figure 2
View larger version (62K):
[in this window]
[in a new window]
 
FIGURE 2. Positive selection and generation of mature CD8 SP thymocytes is impaired in Ets-1p/p mice. A, CD3 and CD24 (HSA) expression on total thymocytes isolated from control or Ets-1p/p mice. The percentage of cells in each quadrant is indicated, and the gates used for subsequent analysis of CD4 and CD8 expression on distinct maturational subsets are shown in the first dot plot only. B–D, CD4 and CD8 coreceptor expression was analyzed in the CD3lowCD24high (immature) subset (B), the CD3highCD24high subset (C), and CD3highCD24low (mature) subset (D). The percentage of cells in each quadrant is provided.

 
Peripheral CD8+ T cells are present in Ets-1p/p mice

Despite the dramatic reduction in the CD8 SP thymocyte compartment, CD8+ T cells were detectable in peripheral LN or splenic cell suspensions prepared from Ets-1p/p mice (Fig. 3A and data not shown). Consistent with a previous study using chimeric mice (6), we found reduced overall numbers of both CD4+ and CD8+ T lymphocytes (CD3+) in the LNs harvested from Ets-1p/p mice when compared with control mice (data not shown). In contrast, the yield of CD4 or CD8 T cells from Ets-1p/p spleens was only slightly reduced (data not shown). Although a slight skewing of the CD4:CD8 ratio was observed in the peripheral lymphoid tissues of Ets-1p/p mice, this did not prove to be statistically significant (data not shown). The presence of peripheral CD8+ T cells in the Ets-1p/p background suggests the possibility that the small numbers of CD8 SP thymocytes generated in the Ets-1p/p background are capable of seeding the peripheral lymphoid compartment, where they may undergo homeostatic expansion. In support of this idea, both the CD4+ and CD8+ compartments contain elevated proportions of cells expressing CD44 (Fig. 3B), a phenotype consistent with T cells that have undergone homeostatic expansion (30, 31). Alternatively, T cells may be activated in the periphery in concert with the heightened activation state of B cells and prevalence of an autoimmune phenotype in Ets-1p/p mice. This possibility is supported by the observation that peripheral T cells isolated from Ets-1p/p mice routinely expressed higher levels of CD86 (B7-2) when compared with wild-type or Ets-1+/p controls (Fig. 3C), a phenotype similar to that reported for human and murine memory T cells (32, 33). In contrast, no substantial difference in CD80 (B7-1) expression was observed when comparing Ets-1+/+ and Ets-1p/p T cell subsets (data not shown). We also noticed a marked reduction of Thy1 (Thy1.2) expression on peripheral T cells isolated from Ets-1p/p mice (Fig. 3D), consistent with the initial report describing Ets-1d/d chimeric mice (5). However, Thy1 was detected at relatively normal levels on DP and CD4 SP thymocytes isolated from the Ets-1p/p mice, indicating that Ets-1 is not strictly required for Thy1 expression at these stages of development (Fig. 3E). The contribution of low Thy1 expression, if any, to the poor proliferative capacity and increased sensitivity to programmed cell death observed in Ets-1p/p T cells remains to be determined.


Figure 3
View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 3. An elevated percentage of peripheral T cells isolated from Ets-1p/p mice express CD44 and CD86 but lack Thy1. A, CD4 and CD8 expression profiles obtained from LN cell suspensions. B, CD44 and CD62L expression on gated CD4+ (top panels) or CD8+ T cells (bottom panels) isolated from Ets-1+/+ or Ets-1p/p mutant mice. A and B, The percentage of cells in each quadrant is indicated. C, CD86 (B7-2) expression on total T cells (CD3+) isolated from Ets-1 wild-type (solid line), Ets-1+/p (dashed line), or Ets-1p/p mutant mice (filled histogram). MFIs for each histogram are indicated. D, Thy1.2 expression on wild-type (solid line) or Ets-1p/p mutant (filled histogram) CD4+ (top panel) or CD8+ (bottom panel) splenic T cells. The percentage of cells falling within the indicated region is provided. E, Thy1.2 expression on wild-type (solid line) or Ets-1p/p mutant (filled histogram) DP thymocytes (top panel) or CD4 SP thymocytes (bottom panel). The percentage of cells contained with the indicated gate is provided.

 
Defective selection of Ets-1p/p CD8+ thymocytes in TCR-transgenic mice

To monitor directly the efficiency of MHC class I-restricted selection of CD8+ thymocytes in Ets-1p/p mice, we intercrossed this strain with transgenic mice expressing the male Ag-specific H-2Kb-restricted HY TCR (34). Similar to non-TCR-transgenic mice, thymocyte yield from Ets-1p/p HY TCR+ mice was ~30–40% of that obtained from control (Ets-1+/p) HY TCR+ mice (data not shown). As expected, the percentage of CD8 SP thymocytes in female HY mice was markedly reduced in the Ets-1p/p background (Fig. 4A), consistent with impaired selection and/or lineage commitment along the CD8 pathway. Ets-1p/p HY+ mice also contained an increased percentage of DN thymocytes, which may reflect compounded effects of the Ets-1 mutation and abnormally high levels of HY TCR expression on immature thymocytes in the HY TCR-transgenic background. Importantly, expression of the HY TCR (as determined by staining with Abs specific for Vbeta8.1/8.2 or the clonotypic HY TCR) was virtually identical when comparing DN thymocytes harvested from HY+ Ets-1+/+ or Ets-1p/p mice (Fig. 4B and data not shown), indicating that defective selection of DP thymocytes is not due to differences in HY TCR expression at prior stages of development. In female mice, expression of the HY TCR decreases as thymocytes acquire a DP phenotype. This was observed in both Ets-1+/p and Ets-1p/p backgrounds, although a subset of DP thymocytes expressed the HY TCR at high levels in the Ets-1p/p background (Fig. 4B). HY TCR expression was detected at high levels on the small percentage of CD8 SP thymocytes generated in the Ets-1p/p HY+ background, indicating that selection of CD8 SP thymocytes does occur, albeit suboptimally, in the Ets-1p/p background (data not shown). Expression of the HY TCR on CD4 SP thymocytes was not reproducibly detected in Ets-1p/p HY+ mice, indicating that lineage commitment of MHC class I-restricted thymocytes had not been redirected along the CD4 pathway (data not shown).


Figure 4
View larger version (72K):
[in this window]
[in a new window]
 
FIGURE 4. Selection of HY TCR+ thymocytes is impaired in female Ets-1p/p mice. A, CD4 and CD8 expression on total thymocytes isolated from female HY TCR+ Ets-1+/p and Ets-1p/p mutant mice. B, HY TCR expression on gated DN (top panel) and DP (bottom panel) thymocyte subsets. The control (CTRL, dashed histogram) data were obtained from an Ets-1+/p HY TCR animal. Ets-1+/p HY TCR+, filled histogram; Ets-1p/p HY TCR+, open histogram. The percentage of cells in the indicated gate is provided. C, CD24 expression on DN, DP TCRlow, and DP TCRhigh thymocytes isolated from a female Ets-1p/p HY TCR+ mouse. Mean fluorescence intensities (MFI) for each population are indicated. D, CD3 and CD24 expression on total thymocytes isolated from mice of the indicated genotypes. E–G, CD4 and CD8 coreceptor expression on distinct thymocyte subsets gated based on CD3 and CD24 expression (E, CD3lowCD24high; F, CD3highCD24high; G, CD3highCD24low). The percentage of cells in each quadrant is indicated.

 
The presence of a subset of DP thymocytes expressing high levels of HY TCR in the Ets-1p/p background suggested several possible scenarios. First, these cells may represent thymocytes that have been selected on MHC class I, and have subsequently up-regulated TCR expression, but failed to down-regulate CD4 expression. This would be consistent with the observation that generation of CD8 SP thymocytes is impaired in Ets-1p/p mice (Fig. 1, E and F), and that thymocytes with a DP phenotype are present in the mature (CD3highCD24low) thymocyte subset isolated from Ets-1p/p mice (Fig. 2D). Alternatively, the HY TCRhigh DP subset may reflect immature thymocytes that have just recently acquired a DP phenotype and have not yet down-regulated HY TCR expression. As a means to distinguish between these possibilities, we next analyzed CD24 expression on DN, DP TCRlow, and DP TCRhigh thymocyte subsets isolated from Ets-1p/p HY-transgenic mice (Fig. 4C). Of these three subsets, the DP TCRhigh population expressed the lowest level of surface CD24, consistent with the notion that these cells are at a later stage of maturation. Still, the relatively small differences in CD24 expression observed between these subsets makes it difficult to conclude unequivocally that the DP TCRhigh thymocytes observed in the Ets-1p/p HY+ mice are indeed more mature than the DP TCRlow subset.

To assess in more detail thymocyte maturation in the HY TCR background, individual subsets were first identified based on CD3 and CD24 expression, and then analyzed individually for CD4 and CD8 expression (Fig. 4, D–G). Unlike normal thymocytes, the HY TCR is expressed at high levels on immature DN thymocytes. Thus, the DN thymocytes are found predominantly in the CD3highCD24high population in both the Ets-1+/p and Ets-1p/p backgrounds when the HY transgene is expressed (Fig. 4F), while the CD3lowCD24high population contains predominantly DP thymocytes in both backgrounds (Fig. 4E). Within the CD3highCD24high populations the majority of Ets-1p/p DP thymocytes expressed higher levels of CD4 and CD8 than the corresponding subset isolated from Ets-1+/p HY TCR mice (Fig. 4F). In addition, CD3highCD24high thymocytes isolated from Ets-1p/p HY TCR+ female mice contained relatively few CD4 or CD8 SP thymocytes when compared with Ets-1+/p HY TCR+ controls (Fig. 4F). These data are consistent with impaired positive selection and subsequent transition from a CD4highCD8high to a CD4lowCD8low DP phenotype in the Ets-1p/p background. In addition, an increased proportion of thymocytes with a DP or DN phenotype was observed in the more mature CD3highCD24low subset in the Ets-1p/p HY+ mice (Fig. 4G), consistent with observations made in nontransgenic Ets-1p/p mice (Fig. 2D). These results support further the idea that Ets-1 is required for optimal positive selection and subsequent maturation of MHC class I-restricted thymocytes, and that in the absence of Ets-1, thymocytes normally destined to become a CD8 SP thymocyte adopt an alternate fate and/or phenotype.

The defect in CD8+ thymocyte development in Ets-1p/p mice is thymocyte intrinsic

We reasoned that impaired positive selection of MHC class I-restricted thymocytes and the low frequency of CD8 SP thymocytes present in the Ets-1p/p mice could arise as a consequence of reduced or aberrant expression of MHC class I in the thymic microenvironment. However, MHC class I expression was detected at normal levels in all Ets-1p/p cell subsets analyzed, including thymocytes, peripheral lymphocytes, and CDR-1+ cortical epithelial cells (data not shown), indicating that a loss of class I expression is not responsible for defective selection and generation of CD8 SP thymocytes in the Ets-1p/p background.

To determine whether the defect in generation of CD8 SP thymocytes in Ets-1p/p mice is indeed intrinsic to developing thymocytes and not a consequence of an Ets-1p/p thymic microenvironment, we first generated chimeric mice by reconstituting lethally irradiated C57BL/6 x 129Sv mice with bone marrow isolated from wild-type, Ets-1+/p, or Ets-1p/p mice. Under these conditions, defective generation of mature (CD3high) CD8 SP thymocytes in the Ets-1p/p mutant donor cell compartment was still observed (Fig. 5A). To examine CD8 SP generation in the context of a wild-type hemopoietic compartment, we next generated chimeric mice by injecting lethally irradiated host mice (CD45.2+) with bone marrow harvested from congenic (CD45.1+) wild-type mice mixed 1:1 with bone marrow isolated from wild-type, Ets-1+/p, or Ets-1p/p mutant mice (all CD45.2+). In each case where thymocytes derived from wild-type or Ets-1+/p origin were analyzed, the CD4:CD8 distribution within the CD3high subset was comparable to that observed in wild-type, nonirradiated mice (Fig. 5, B–D). In marked contrast, even under conditions where the majority of the thymocytes and thymic stroma were of wild-type origin, we still observed an obvious defect in the generation of mature CD8+ thymocytes in the Ets-1p/p (CD45.2+) donor compartment (Fig. 5D, last panel). These data clearly indicate that the defect in generation of CD8 SP thymocytes observed in Ets-1p/p mice is cell-intrinsic, and substantiate further the important and previously unappreciated role for the Ets-1 transcription factor in directing thymic selection and lineage commitment of MHC class I-restricted thymocytes.


Figure 5
View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 5. Defective generation of CD8 SP thymocytes in Ets-1p/p mutant mice is thymocyte intrinsic. A, CD4 and CD8 expression profiles on CD3high thymocytes harvested from chimeric mice generated using lethally irradiated wild-type (C57BL/6) host mice and donor bone marrow isolated from Ets-1+/+, Ets-1+/p, or Ets-1p/p mutant mice. The percentage of cells in each quadrant is indicated. B–D, Chimeric mice were generated as in A except the donor bone marrow harvested from Ets-1+/+, Ets-1+/p, or Ets-1p/p mutant mice (CD45.2+) was mixed 1:1 with wild-type bone marrow (CD45.1+) before injection. B, CD45.1 expression on total thymocytes harvested from mixed bone marrow chimeric mice. C and D, CD4 and CD8 expression on gated TCRhigh thymocytes in the CD45.1+ (C) or CD45.1 (D) populations. Data are representative of two (A) or three (B–D) independently generated sets of chimeric mice.

 
The expression of multiple transcription factors that regulate thymocyte selection and/or lineage commitment is not effected by the absence of Ets-1

Given the potential for Ets-1 to regulate the expression of additional genes that could potentially effect the outcome of thymic selection and/or lineage commitment, we used RT-PCR to determine the expression of Runx1, Runx3, GATA-3, TOX, Th-POK, and HEB in sort-purified DP thymocytes isolated from Ets-1+/+, Ets-1+/p, or Ets-1p/p mice (Fig. 6). Each of these transcription factors is known to regulate thymic selection and/or lineage commitment (35, 36, 37, 38, 39, 40), and Runx3 was of particular interest given a recent report describing impaired generation of CD8 SP thymocytes in mice deficient for this factor (41). The expression of Runx1 or Runx3 was not appreciably altered in the Ets-1p/p background, indicating that Ets-1 is not required for the expression of these factors and that altered expression of Runx3 is not likely to contribute to the thymic phenotype observed in the Ets-1p/p mice. In addition, no obvious differences in the expression of GATA-3, TOX, Th-POK, or HEB were detected between control and Ets-1p/p DP thymocytes (Fig. 6). These data indicate that Ets-1 deficiency has no major impact on the global expression of multiple transcription factors that are known to direct thymocyte maturation and fate.


Figure 6
View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 6. Expression of multiple transcription factors implicated in thymic selection and/or lineage commitment is normal in Ets-1p/p DP thymocytes. Single-cell suspensions were prepared from thymi harvested from Ets-1+/+, Ets-1+/p, or Ets-1p/p mice and stained with fluorochrome-conjugated Abs specific for CD4 and CD8. Total thymocytes from wild-type mice (Total) or sort-purified (>95%) DP thymocytes isolated from wild-type, Ets-1+/p, or Ets-1p/p mice were used immediately for the preparation of total RNA. RT-PCR was performed using equal amounts of total RNA as a template for the preparation of cDNA and primers specific for the indicated transcription factors. Amplification of message specific for HPRT was used to control for sample integrity and gross differences in template levels. Data are representative of two separate experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Ets-1 is known to promote early stages of thymocyte development mediated by the pre-TCR complex that lead to further phenotypic maturation and allelic exclusion (7). In this study, we describe a previously unappreciated role for Ets-1 in promoting later stages of thymocyte development regulated by the TCR. In mice homozygous for an Ets-1 mutant allele lacking the Pointed domain (Ets-1p/p), a mutant Ets-1 protein is expressed in thymocytes albeit at greatly reduced levels. These mice manifest a number of developmental abnormalities in the thymus, including reduced thymic cellularity, impaired positive selection, and a striking reduction in the frequency of CD8 SP thymocytes. Thus, in addition to previously described roles in regulating pre-TCR-dependent maturation and allelic exclusion, normal Ets-1 function appears required for efficient positive selection and lineage-specific maturation of CD8 SP thymocytes.

Besides MHC class I (beta2M)-deficient mice (20, 42), two other mutant strains of mice have been described which manifest impaired development in the mature CD8+ thymocyte compartment that is remarkably similar to that observed in the Ets-1p/p mice. First, mice deficient for the IFN regulatory factor 1 (IRF-1) display a profound absence of CD8 SP thymocytes (43). In contrast to the Ets-1p/p mice, IRF-1 mutant mice have reduced levels of MHC class I on virtually all thymocyte subsets and thymic stromal elements examined, including CDR-1+ cortical epithelial cells. The relatively normal level of MHC class I expression in the Ets-1p/p thymus and the thymocyte intrinsic nature of the observed defect suggests that defective IRF-1 expression or function is not likely to be the reason for the impaired selection and generation of CD8+ thymocytes in the Ets-1p/p background. Second, mice deficient for the Runx3 transcription factor (also called AML-2, Cbfa3, or Pebp2{alpha}C) manifest a severe reduction in the CD8 SP thymocyte compartment, despite intact DP and CD4 SP subsets (41). Two regulatory sites, both of which are capable of binding Runx1 or Runx3, are present in the CD4 silencer region and function to repress CD4 expression at several stages of thymocyte development (40, 44, 45, 46). In the peripheral lymphoid tissues of adult Runx3-deficient mice or chimeric mice generated using Runx3-deficient fetal liver cells and irradiated RAG-2-deficient mice as hosts, there is a marked reduction in the percentage of CD8+ T cells and an increased proportion of T cells expressing both CD4 and CD8 (40, 41), providing strong evidence that Runx3 functions to silence CD4 expression in T cells that have committed to the CD8 lineage. Introducing the Runx3 mutant strain into a Runx1+/– background further enhances the phenotype, indicating that both Runx1 and Runx3 can function to promote silencing of the CD4 gene during thymocyte development and lineage commitment (41). Curiously, defective generation of CD8 SP thymocytes in the context of Runx3 deficiency is not readily apparent in chimeric mice generated using Runx3-deficient fetal liver cells and Rag-2 deficient hosts, despite the peripheral phenotype described above (40). Although the precise reason for this is not currently known, this may be analogous to the differences observed between chimeric mice generated using Ets-1p/p mutant ES cells and our analyses using nonchimeric Ets-1p/p mice.

Ets transcription factors have been shown to cooperate with Runx1 in regulating gene transcription (47, 48, 49, 50, 51), suggesting that perhaps the Ets-1p/p phenotype arises as a consequence of dysregulated Runx activity in the thymus. Indeed, a computer algorithm (MatInspector) predicts a single Ets-1-binding site located between the Runx-binding sites in the CD4 silencer region (data not shown), advancing the possibility that Ets-1 and Runx3 may function in concert to silence the CD4 gene during thymic lineage commitment. Transcripts encoding Runx1 or Runx3 were detected at normal levels in sort-purified DP thymocytes isolated from Ets-1p/p mice, indicating that Ets-1 is not required for normal Runx1 or Runx3 expression (Fig. 6). Thus, the failure to generate substantial numbers of CD8 SP thymocytes in the Ets-1p/p background may be due in part to failed silencing of the CD4 gene, perhaps as a consequence of suboptimal Runx3 function. It will now be of significant interest to measure the activity of the CD4 silencer in Ets-1p/p thymocytes and explore potential occupancy of the CD4 silencer by wild-type Ets-1.

At present, it is not clear whether the elevated percentage of T cells with a memory phenotype (CD44+) observed in Ets-1p/p mutant mice is directly related to altered thymic selection or homeostic expansion, and to what extent the activated T cell phenotype contributes to the onset of autoimmunity observed in these mice. Aberrant B cell differentiation and activation in the Ets-1p/p mutant background has been attributed to both B cell intrinsic and extrinsic factors (9), the latter which may include a heightened activation state of peripheral T cells. Similarly, it is not clear whether Ets-1 is required for sustaining expression of Thy1 or whether the selective loss of Thy1 expression in peripheral T cells arises as a consequence of the environment, although a study comparing Thy1 expression in the mouse and rat suggests that thymic expression of Thy1 may not be Ets-1 dependent (52). Thy1 is a GPI-linked glycoprotein that can initiate activating signals and synergize with the TCR to promote T cell activation (53). A direct contribution of aberrant Thy-1 expression to the reduced proliferative capacity observed in Ets-1p/p peripheral T cells remains to be addressed.

One possible confounding issue that must be considered when interpreting the results presented here is the effect of Ets-1 deficiency on pre-TCR-mediated selection and allelic exclusion. Although impaired pre-TCR signaling and beta-selection has only been shown in chimeric mice generated using Ets-1d/d ES cells (7), it remains possible that the effect on CD8 SP thymocyte generation observed in the Ets-1p/p background may be an indirect consequence of impaired beta-selection. We suspect that this is not the case, as other mutant strains of mice that exhibit impaired beta-selection (e.g., pre-T{alpha}-deficient mice) do not manifest similar specific effects on selection of CD8 SP thymocytes. In addition, it is difficult to envision why the selection and generation of CD8 SP thymocytes would be specifically affected by defects in beta-selection or impaired TCR signaling at later stages of development. The current paradigm for thymic selection and lineage commitment indicates that the generation of CD4 SP thymocytes requires a more sustained and/or robust signal via the TCR. Although the "quality" of TCR signaling in Ets-1p/p-deficient thymocytes remains to be addressed, T cells isolated from Ets-1p/p spleen or LN proliferate poorly in response to TCR ligation (6). Thus, if TCR signaling is globally compromised in Ets-1p/p mice, one might expect a selective defect in the generation of CD4 SP thymocytes. Finally, the phenotype and thymic selection defects reported here could arise if the mutant Ets-1p/p protein (lacking the Pointed domain) expressed at low levels in thymocytes retains some limited functional capacity. Any contribution of this mutant protein would have to be independent of the Pointed domain, which contains a phosphorylation and docking site for Erk2, a known molecular contributor to the outcome of selection and lineage commitment (54, 55). The development of mice harboring modified alleles of 1) Ets-1 that can be deleted in an inducible fashion or 2) the CD4 silencer region containing a mutated Ets-1-binding site will no doubt facilitate identification of the precise contribution of Ets-1 to CD8 lineage commitment at later stages of thymic selection and development.


    Acknowledgments
 
We thank Dr. Sarah Gaffen for critical evaluation of the manuscript, Irene Kulik and Vita Milisauskas for invaluable technical assistance, and Dr. Kristin Hogquist for valuable advice and providing the CDR-1 Ab.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by an Arthritis Foundation Investigator Award (to J.L.C.), National Institutes of Health (NIH) Grant AI54666 (to J.L.C.), an Interdisciplinary and Creative Research Fund Grant (to L.A.G.-S.), and a NIH Cancer Center Support Grant to Roswell Park Cancer Institute (CA16056). Back

2 Address correspondence and reprint requests to Dr. James L. Clements, Department of Immunology, Roswell Park Cancer Institute, Elm and Carlton Streets, Buffalo, NY 14263. E-mail address: james.clements{at}roswellpark.org Back

3 Abbreviations used in this paper: LN, lymph node; DN, double negative; DP, double positive; SP, single positive; HPRT, hypoxanthine phosphoribosyltransferase; TOX, Thymus HMG Box; HEB, HeLa E-box-binding protein; Th-POK, Th-inducing POZ/Kruppel-like factor; Runx1, Run+-related transcription factor 1; ES, embryonic stem; HSA, heat stable Ag; IRF, IFN regulatory factor. Back

Received for publication October 25, 2005. Accepted for publication April 17, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Oikawa, T., T. Yamada. 2003. Molecular biology of the Ets family of transcription factors. Gene 303: 11-34. [Medline]
  2. Anderson, M. K., G. Hernandez-Hoyos, R. A. Diamond, E. V. Rothenberg. 1999. Precise developmental regulation of Ets family transcription factors during specification and commitment to the T cell lineage. Development 126: 3131-3148. [Abstract]
  3. Bhat, N. K., K. L. Komschlies, S. Fujiwara, R. J. Fisher, B. J. Mathieson, T. A. Gregorio, H. A. Young, J. W. Kasik, K. Ozato, T. S. Papas. 1989. Expression of ets genes in mouse thymocyte subsets and T cells. J. Immunol. 142: 672-678. [Abstract]
  4. Sacchi, N., A. de Klein, S. D. Showalter, G. Bigi, T. S. Papas. 1988. High expression of ets-1 gene in human thymocytes and immature T leukemic cells. Leukemia 2: 12-18. [Medline]
  5. Bories, J. C., D. M. Willerford, D. Grevin, L. Davidson, A. Camus, P. Martin, D. Stehelin, F. W. Alt. 1995. Increased T-cell apoptosis and terminal B-cell differentiation induced by inactivation of the Ets-1 proto-oncogene. Nature 377: 635-638. [Medline]
  6. Muthusamy, N., K. Barton, J. M. Leiden. 1995. Defective activation and survival of T cells lacking the Ets-1 transcription factor. Nature 377: 639-642. [Medline]
  7. Eyquem, S., K. Chemin, M. Fasseu, J. C. Bories. 2004. The Ets-1 transcription factor is required for complete pre-T cell receptor function and allelic exclusion at the T cell receptor beta locus. Proc. Natl. Acad. Sci. USA 101: 15712-15717. [Abstract/Free Full Text]
  8. Eyquem, S., K. Chemin, M. Fasseu, M. Chopin, F. Sigaux, A. Cumano, J. C. Bories. 2004. The development of early and mature B cells is impaired in mice deficient for the Ets-1 transcription factor. Eur. J. Immunol. 34: 3187-3196. [Medline]
  9. Wang, D., S. A. John, J. L. Clements, D. H. Percy, K. P. Barton, L. A. Garrett-Sinha. 2005. Ets-1 deficiency leads to altered B cell differentiation, hyperresponsiveness to TLR9 and autoimmune disease. Int. Immunol. 17: 1179-1191. [Abstract/Free Full Text]
  10. Barton, K., N. Muthusamy, C. Fischer, C. N. Ting, T. L. Walunas, L. L. Lanier, J. M. Leiden. 1998. The Ets-1 transcription factor is required for the development of natural killer cells in mice. Immunity 9: 555-563. [Medline]
  11. Starr, T. K., S. C. Jameson, K. A. Hogquist. 2003. Positive and negative selection of T cells. Annu. Rev. Immunol. 21: 139-176. [Medline]
  12. Saint-Ruf, C., K. Ungewiss, M. Groettrup, L. Bruno, H. J. Fehling, H. von Boehmer. 1994. Analysis and expression of a cloned pre-T cell receptor gene. Science 266: 1208-1212. [Abstract/Free Full Text]
  13. von Boehmer, H., H. J. Fehling. 1997. Structure and function of the pre-T cell receptor. Annu. Rev. Immunol. 15: 433-452. [Medline]
  14. Godfrey, D. I., A. Zlotnik. 1993. Control points in early T-cell development. Immunol. Today 14: 547-553. [Medline]
  15. Delgado, P., E. Fernandez, V. Dave, D. Kappes, B. Alarcon. 2000. CD3{delta} couples T-cell receptor signalling to ERK activation and thymocyte positive selection. Nature 406: 426-430. [Medline]
  16. Mariathasan, S., A. Zakarian, D. Bouchard, A. M. Michie, J. C. Zuniga-Pflucker, P. S. Ohashi. 2001. Duration and strength of extracellular signal-regulated kinase signals are altered during positive versus negative thymocyte selection. J. Immunol. 167: 4966-4973. [Abstract/Free Full Text]
  17. Chan, S. H., C. Benoist, D. Mathis. 1993. A challenge to the instructive model of positive selection. Immunol. Rev. 135: 119-131. [Medline]
  18. Chan, S. H., C. Benoist, D. Mathis. 1994. In favor of the selective model of positive selection. Semin. Immunol. 6: 241-248. [Medline]
  19. Davis, C. B., N. Killeen, M. E. Crooks, D. Raulet, D. R. Littman. 1993. Evidence for a stochastic mechanism in the differentiation of mature subsets of T lymphocytes. Cell 73: 237-247. [Medline]
  20. van Meerwijk, J. P., R. N. Germain. 1993. Development of mature CD8+ thymocytes: selection rather than instruction?. Science 261: 911-915. [Abstract/Free Full Text]
  21. Basson, M. A., U. Bommhardt, M. S. Cole, J. Y. Tso, R. Zamoyska. 1998. CD3 ligation on immature thymocytes generates antagonist-like signals appropriate for CD8 lineage commitment, independently of T cell receptor specificity. J. Exp. Med. 187: 1249-1260. [Abstract/Free Full Text]
  22. Hernandez-Hoyos, G., S. J. Sohn, E. V. Rothenberg, J. Alberola-Ila. 2000. Lck activity controls CD4/CD8 T cell lineage commitment. Immunity 12: 313-322. [Medline]
  23. Itano, A., P. Salmon, D. Kioussis, M. Tolaini, P. Corbella, E. Robey. 1996. The cytoplasmic domain of CD4 promotes the development of CD4 lineage T cells. J. Exp. Med. 183: 731-741. [Abstract/Free Full Text]
  24. Legname, G., B. Seddon, M. Lovatt, P. Tomlinson, N. Sarner, M. Tolaini, K. Williams, T. Norton, D. Kioussis, R. Zamoyska. 2000. Inducible expression of a p56Lck transgene reveals a central role for Lck in the differentiation of CD4 SP thymocytes. Immunity 12: 537-546. [Medline]
  25. Sharp, L. L., D. A. Schwarz, C. M. Bott, C. J. Marshall, S. M. Hedrick. 1997. The influence of the MAPK pathway on T cell lineage commitment. Immunity 7: 609-618. [Medline]
  26. Watanabe, N., H. Arase, M. Onodera, P. S. Ohashi, T. Saito. 2000. The quantity of TCR signal determines positive selection and lineage commitment of T cells. J. Immunol. 165: 6252-6261. [Abstract/Free Full Text]
  27. Wilkinson, B., J. Kaye. 2001. Requirement for sustained MAPK signaling in both CD4 and CD8 lineage commitment: a threshold model. Cell. Immunol. 211: 86-95. [Medline]
  28. Kao, H., P. M. Allen. 2005. An antagonist peptide mediates positive selection and CD4 lineage commitment of MHC class II-restricted T cells in the absence of CD4. J. Exp. Med. 201: 149-158. [Abstract/Free Full Text]
  29. Rothenberg, E. V., T. Taghon. 2005. Molecular genetics of T cell development. Annu. Rev. Immunol. 23: 601-649. [Medline]
  30. Goldrath, A. W., L. Y. Bogatzki, M. J. Bevan. 2000. Naive T cells transiently acquire a memory-like phenotype during homeostasis-driven proliferation. J. Exp. Med. 192: 557-564. [Abstract/Free Full Text]
  31. Kieper, W. C., S. C. Jameson. 1999. Homeostatic expansion and phenotypic conversion of naive T cells in response to self peptide/MHC ligands. Proc. Natl. Acad. Sci. USA 96: 13306-13311. [Abstract/Free Full Text]
  32. Hakamada-Taguchi, R., T. Kato, H. Ushijima, M. Murakami, T. Uede, H. Nariuchi. 1998. Expression and co-stimulatory function of B7-2 on murine CD4+ T cells. Eur. J. Immunol. 28: 865-873. [Medline]
  33. Jeannin, P., N. Herbault, Y. Delneste, G. Magistrelli, S. Lecoanet-Henchoz, G. Caron, J. P. Aubry, J. Y. Bonnefoy. 1999. Human effector memory T cells express CD86: a functional role in naive T cell priming. J. Immunol. 162: 2044-2048. [Abstract/Free Full Text]
  34. Kisielow, P., H. Bluthmann, U. D. Staerz, M. Steinmetz, H. von Boehmer. 1988. Tolerance in T-cell-receptor transgenic mice involves deletion of nonmature CD4+8+ thymocytes. Nature 333: 742-746. [Medline]
  35. Anderson, M. K.. 2006. At the crossroads: diverse roles of early thymocyte transcriptional regulators. Immunol. Rev. 209: 191-211. [Medline]
  36. Barndt, R. J., M. Dai, Y. Zhuang. 2000. Functions of E2A-HEB heterodimers in T-cell development revealed by a dominant negative mutation of HEB. Mol. Cell. Biol. 20: 6677-6685. [Abstract/Free Full Text]
  37. He, X., X. He, V. P. Dave, Y. Zhang, X. Hua, E. Nicolas, W. Xu, B. A. Roe, D. J. Kappes. 2005. The zinc finger transcription factor Th-POK regulates CD4 versus CD8 T-cell lineage commitment. Nature 433: 826-833. [Medline]
  38. Pai, S. Y., M. L. Truitt, C. N. Ting, J. M. Leiden, L. H. Glimcher, I. C. Ho. 2003. Critical roles for transcription factor GATA-3 in thymocyte development. Immunity 19: 863-875. [Medline]
  39. Wilkinson, B., J. Y. Chen, P. Han, K. M. Rufner, O. D. Goularte, J. Kaye. 2002. TOX: an HMG box protein implicated in the regulation of thymocyte selection. Nat. Immunol. 3: 272-280. [Medline]
  40. Taniuchi, I., M. Osato, T. Egawa, M. J. Sunshine, S. C. Bae, T. Komori, Y. Ito, D. R. Littman. 2002. Differential requirements for Runx proteins in CD4 repression and epigenetic silencing during T lymphocyte development. Cell 111: 621-633. [Medline]
  41. Woolf, E., C. Xiao, O. Fainaru, J. Lotem, D. Rosen, V. Negreanu, Y. Bernstein, D. Goldenberg, O. Brenner, G. Berke, et al 2003. Runx3 and Runx1 are required for CD8 T cell development during thymopoiesis. Proc. Natl. Acad. Sci. USA 100: 7731-7736. [Abstract/Free Full Text]
  42. Zijlstra, M., M. Bix, N. E. Simister, J. M. Loring, D. H. Raulet, R. Jaenisch. 1990. beta2-microglobulin deficient mice lack CD48+ cytolytic T cells. Nature 344: 742-746. [Medline]
  43. Penninger, J. M., C. Sirard, H. W. Mittrucker, A. Chidgey, I. Kozieradzki, M. Nghiem, A. Hakem, T. Kimura, E. Timms, R. Boyd, et al 1997. The interferon regulatory transcription factor IRF-1 controls positive and negative selection of CD8+ thymocytes. Immunity 7: 243-254. [Medline]
  44. Ehlers, M., K. Laule-Kilian, M. Petter, C. J. Aldrian, B. Grueter, A. Wurch, N. Yoshida, T. Watanabe, M. Satake, V. Steimle. 2003. Morpholino antisense oligonucleotide-mediated gene knockdown during thymocyte development reveals role for Runx3 transcription factor in CD4 silencing during development of CD4/CD8+ thymocytes. J. Immunol. 171: 3594-3604. [Abstract/Free Full Text]
  45. Taniuchi, I., D. R. Littman. 2004. Epigenetic gene silencing by Runx proteins. Oncogene 23: 4341-4345. [Medline]
  46. Telfer, J. C., E. E. Hedblom, M. K. Anderson, M. N. Laurent, E. V. Rothenberg. 2004. Localization of the domains in Runx transcription factors required for the repression of CD4 in thymocytes. J. Immunol. 172: 4359-4370. [Abstract/Free Full Text]
  47. Garvie, C. W., M. A. Pufall, B. J. Graves, C. Wolberger. 2002. Structural analysis of the autoinhibition of Ets-1 and its role in protein partnerships. J. Biol. Chem. 277: 45529-45536. [Abstract/Free Full Text]
  48. Goetz, T. L., T. L. Gu, N. A. Speck, B. J. Graves. 2000. Auto-inhibition of Ets-1 is counteracted by DNA binding cooperativity with core-binding factor {alpha}2. Mol. Cell. Biol. 20: 81-90. [Abstract/Free Full Text]
  49. Gu, T. L., T. L. Goetz, B. J. Graves, N. A. Speck. 2000. Auto-inhibition and partner proteins, core-binding factor beta (CBFbeta) and Ets-1, modulate DNA binding by CBF{alpha}2 (AML1). Mol. Cell. Biol. 20: 91-103. [Abstract/Free Full Text]
  50. Kim, W. Y., M. Sieweke, E. Ogawa, H. J. Wee, U. Englmeier, T. Graf, Y. Ito. 1999. Mutual activation of Ets-1 and AML1 DNA binding by direct interaction of their autoinhibitory domains. EMBO J. 18: 1609-1620. [Medline]
  51. Wotton, D., J. Ghysdael, S. Wang, N. A. Speck, M. J. Owen. 1994. Cooperative binding of Ets-1 and core binding factor to DNA. Mol. Cell. Biol. 14: 840-850. [Abstract/Free Full Text]
  52. Tokugawa, Y., M. Koyama, J. Silver. 1997. A molecular basis for species differences in Thy-1 expression patterns. Mol. Immunol. 34: 1263-1272. [Medline]
  53. Malek, T. R., T. J. Fleming, E. K. Codias. 1994. Regulation of T lymphocyte function by glycosylphosphatidylinositol (GPI)-anchored proteins. Semin. Immunol. 6: 105-113. [Medline]
  54. Seidel, J. J., B. J. Graves. 2002. An ERK2 docking site in the Pointed domain distinguishes a subset of ETS transcription factors. Genes Dev. 16: 127-137. [Abstract/Free Full Text]
  55. Slupsky, C. M., L. N. Gentile, L. W. Donaldson, C. D. Mackereth, J. J. Seidel, B. J. Graves, L. P. McIntosh. 1998. Structure of the Ets-1 pointed domain and mitogen-activated protein kinase phosphorylation site. Proc. Natl. Acad. Sci. USA 95: 12129-12134. [Abstract/Free Full Text]

Related articles in The JI:

IN THIS ISSUE

The JI 2006 177: 767-768. [Full Text]  



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. A. John, J. L. Clements, L. M. Russell, and L. A. Garrett-Sinha
Ets-1 Regulates Plasma Cell Differentiation by Interfering with the Activity of the Transcription Factor Blimp-1
J. Biol. Chem., January 11, 2008; 283(2): 951 - 962.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. Moisan, R. Grenningloh, E. Bettelli, M. Oukka, and I-C. Ho
Ets-1 is a negative regulator of Th17 differentiation
J. Exp. Med., November 26, 2007; 204(12): 2825 - 2835.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. Higuchi, F. O. Bartel, M. Masuya, T. Deguchi, K. W. Henderson, R. Li, R. C. Muise-Helmericks, M. J. Kern, D. K. Watson, and D. D. Spyropoulos
Thymomegaly, Microsplenia, and Defective Homeostatic Proliferation of Peripheral Lymphocytes in p51-Ets1 Isoform-Specific Null Mice
Mol. Cell. Biol., May 1, 2007; 27(9): 3353 - 3366.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Clements, J. L.
Right arrow Articles by Garrett-Sinha, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Clements, J. L.
Right arrow Articles by Garrett-Sinha, L. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS