|
|
||||||||


* Department of Immunology, Roswell Park Cancer Institute, Buffalo, NY 14263; and
Department of Biochemistry, State University of New York, Buffalo, NY 14241
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
85 aa winged-helix-turn-helix DNA-binding motif (Ets domain) (1). Ets-1 is expressed in multiple hemopoietic tissues, including the thymus, suggesting that this protein may play an important role in the development or function of lymphoid cells (2, 3, 4). In support of this idea, the numbers of thymocytes and lymph node (LN)3 resident T cells is markedly decreased in the absence of Ets-1, and Ets-1-deficient T cells undergo apoptosis more readily than wild-type counterparts (5, 6). More recently, Ets-1 has been shown to be important for optimal transition through early pre-TCR-dependent stages of thymocyte development and allelic exclusion at the TCR
locus (7). In the B cell compartment, Ets-1 deficiency results in impaired B cell development, an elevated frequency of IgM+ plasma cells in vivo and enhanced in vitro differentiation responses to CpG-containing oligonucleotide (a TLR9 ligand) (5, 6, 8, 9). Ets-1-deficient mice produce both IgM and IgG autoantibodies leading to immune complex deposition in the kidney (5, 8, 9). The numbers of splenic NK cells is also substantially reduced in Ets-1-deficient mice (10). Collectively, these studies demonstrate that Ets-1 plays an important role in both early stages of lymphocyte development and lymphocyte homeostasis in the periphery. Despite expression at all stages of thymocyte development, a potential role for Ets-1 in regulating thymocyte selection and lineage commitment has not been explored.
Thymocyte development is characterized by multiple phenotypic changes and maturational checkpoints that ultimately contribute to the generation of a self-tolerant peripheral T cell repertoire (11). The most immature thymocytes are CD4CD8 double-negative (DN) and comprise only a small fraction of the thymocytes in an adult mouse (<5%). The DN compartment can be subdivided further based on the expression of CD44 and CD25, with the most recent arrivals from the bone marrow being CD44+CD25 (DN1). As development continues, DN thymocytes express both CD44 and CD25 (DN2) and rearrangement at the TCR
locus is initiated. As thymocytes down-regulate CD44 (DN3), the rearranged TCR
product is expressed with a nonpolymorphic "surrogate" TCR
chain (pre-T
) (12, 13). Signaling via the pre-TCR complex drives expansion and maturation to a CD44CD25 phenotype (DN4), a process originally defined as "
-selection" (14). From here, developing thymocytes express low levels of CD8 and begin rearrangement at the TCR
locus. As maturation progresses, CD4 and CD8 expression increases, giving rise to a CD4+CD8+ double-positive (DP) phenotype. The majority of DP thymocytes express low levels of surface TCR, which increases following positive selection and concomitant with further maturation. DP thymocytes that survive the selection process down-regulate either CD4 or CD8 (lineage commitment), giving rise to MHC-restricted single-positive (SP) thymocytes that are ultimately exported to the periphery.
The mechanisms underlying thymic selection and lineage commitment at the DP stage have been the focus of intense investigation. Signal strength and the nature of subsequent MAPK activation are key mediators of selection, with strong TCR-dependent signals giving rise to a transient but robust activation of ERK MAPKs and deletion (15, 16). Positively selecting signals are characterized by lower affinity TCR interactions that promote a low but sustained level of ERK phosphorylation. Still, it is not clear whether the mechanisms governing lineage commitment and down-regulation of CD4 or CD8 are distinct from those governing the selection process. Although evidence for a stochastic model of lineage commitment has been provided (17, 18, 19, 20), it has become more generally accepted that lineage commitment is dictated by the quality of signal emanating from the TCR/coreceptor complex that is productively engaged (21, 22, 23, 24, 25, 26, 27). Most recently, a "kinetic signaling" model of lineage commitment has been put forth suggesting that the CD4 coreceptor does not transduce unique "instructional" signals per se, but that sustained signals from the TCR/CD4 coreceptor complex appear required for commitment to the CD4 lineage (28).
In addition to the marked advancements in our understanding of the molecular pathways governing thymic selection and lineage commitment, a number of transcription factors that regulate these later stages of T cell development have also been identified (29). In this study, we show that mice carrying a hypomorphic allele of Ets-1 manifest defects in the positive selection of DP thymocytes, with a particularly striking impairment in CD8 development. This defect is intrinsic to Ets-1 mutant thymocytes, as the phenotype is clearly maintained in chimeric mice generated using mixed bone marrow. These data provide the first evidence that normal Ets-1 function promotes later stages of thymic selection and differentiation of CD8+ thymocytes, and provide a new candidate for defining the molecular and genetic events that regulate thymic selection and lineage commitment.
| Materials and Methods |
|---|
|
|
|---|
The Ets-1 mutant strain of mice used in this study has been previously described (6), and are of a mixed genetic background (C57BL/6 x 129Sv). H-Y TCR-transgenic mice were obtained from Taconic Farms. Congenic C57BL/6 (CD45.1+) mice were obtained from The Jackson Laboratory. All mice were maintained and used in accordance with the policies and guidelines set forth by the State University of New York (SUNY; Buffalo, NY) institutional animal care and use committee.
Abs and reagents
Fluorochrome-conjugated Abs specific for CD3 (2C11), CD4 (GK1.5), CD5 (537.3), CD8 (53-6.7), Thy1.2 (53-2.1), CD24 (M1/69), CD45.1 (A20), CD44 (IM7), CD62L (MEL-14), CD86 (GL1), HY TCR (T3.70), and H-2Kb were each purchased from BD Biosciences, Biolegend, or eBioscience and individually titered to establish an optimal staining dilution.
Isolation of lymphoid tissues and flow cytometry
Mice of the appropriate genotype were euthanized followed by isolation of thymus, spleen, and/or LN. Single-cell suspensions were prepared from each tissue and RBC were removed by hypotonic lysis. For analysis of MHC class I expression on thymic stromal cells, the thymus was finely minced and digested in medium containing 0.1% DNase (Sigma-Aldrich) and 1.6 mg/ml collagenase D (Roche) at 37°C for 30 min before staining. Cell preparations were first incubated with purified Abs specific for CD16/32 to block FcRs (clone 93; Biolegend) and then stained with the indicated fluorochrome-conjugated Abs and analyzed using a FACScan or FACSCalibur flow cytometer (BD Biosciences). Collected data (10,000100,000 events) was analyzed using WinMDI software (version 2.8).
Generation of chimeric mice
To generate chimeric mice, 6- to 8-wk-old wild-type C57BL/6 x 129Sv hybrid host mice (CD45.2+) were lethally irradiated using a cesium source (
1000 rad) and immediately injected via the retro-orbital sinus with bone marrow cell suspensions isolated from Ets-1+/+, Ets-1+/p, or Ets-1p/p mice (all CD45.2+) alone or mixed 1:1 with bone marrow isolated from a wild-type C57BL/6 congenic mouse (CD45.1+). Chimeric mice were sacrificed
68 wk later for analysis of thymocyte development.
Analysis of gene expression in DP thymocytes
Thymocyte suspensions were prepared from wild-type (C57BL/6) mice and stained with fluorescent Abs specific for CD4 and CD8. CD4+CD8+ DP thymocytes were sort-purified using a BD Biosciences FACSAria cell sorter to >95% purity and immediately lysed in TRIzol reagent (Invitrogen Life Technologies). Total RNA was prepared according to the manufacturers suggested protocol. Single-strand cDNA was reverse transcribed from 100 ng of total RNA using the SuperScript II Reverse Transcriptase kit (Invitrogen Life Technologies). One microliter of cDNA (of the total 20-µl reaction) was used as template in each subsequent PCR. PCR was performed with Roche FastStart Taq DNA polymerase using conditions suggested by the manufacturer. Thirty cycles of PCR were performed with the following conditions: 1 min denaturation at 94°C, 1 min annealing at 58°C, and 1 min extension at 72°C, using the following primers: hypoxanthine phosphoribosyltransferase (HPRT) (249-bp product): sense CACAGGACTAGAACACCTGC, antisense GCTGGTGAAAAGGACCTCT; Thymus HMG Box (TOX) (429-bp product): sense CTGCCTCTGATATGGGGAAA, antisense TCATTCCTGGTTGTTGGTGA; HeLa E-box-binding protein (HEB) (514-bp product): sense AACCATGCAGTTGGACCTTC, antisense GCTCTCTGGCATTGTTAGCC. Th-inducing POZ/Kruppel-like factor (Th-POK) (763-bp product): sense AGGGGTTGAGGTAGCCTTGT, antisense GCCACAAGGAGAGAGAGTGG; Run+-related transcription factor 1 (RUNX1) (687-bp product): sense GAGTCCTCAGCTGTGGGAAG, antisense TAGCAACTGGCCGCTTAGT; RUNX3 (995-bp product): sense AGGGAAGAGTTTCACGCTCA, antisense GGATGCACAGCTAGAGAGG; GATA3 (449-bp product): sense CTTATCAAGCCCAAGCGAAG, antisense AGGGCTCTGCCTCTCTAACC. PCR products were resolved on a 1% agarose gel and photographed.
Statistical analysis
When indicated, data were analyzed for statistical significance using an unpaired Students t test.
| Results |
|---|
|
|
|---|
To assess a potential contribution of Ets-1 to the processes of thymic selection and lineage commitment, these later stages of thymocyte development were monitored in Ets-1-deficient mice. Originally described as a null allele, the mutant Ets-1 allele lacking exon 3 and a portion of exon 4 (denoted herein as Ets-1p) is actually hypomorphic and gives rise to low levels (
15% of endogenous Ets-1) of a mutant Ets-1 protein lacking the Pointed domain (9). Chimeric mice generated from RAG-2-deficient blastocysts and embryonic stem (ES) cells homozygous for the mutant Ets-1p allele (Ets-1p/p) manifest multiple defects in thymocyte development, including reduced thymic cellularity, an elevated frequency of immature DN thymocytes, and increased susceptibility of T cells to apoptosis (6). Furthermore, chimeric mice generated with ES cells homozygous for an independently generated Ets-1 mutant allele in which the exons encoding the DNA-binding domain were deleted (referred to hereafter as the Ets-1d allele) display additional thymocyte maturation defects including impaired
-selection, inefficient allelic exclusion at the TCR
locus, and reduced expression of CD5 on peripheral T cells (5, 7). Thymic cellularity was also reduced in Ets-1p/p mice (Fig. 1A), although thymocyte yield from some Ets-1p/p mice approached that obtained from control animals. Both the DP and CD4 SP thymocyte subsets isolated from Ets-1p/p mice expressed low levels of CD5 compared with control animals (Fig. 1B), consistent with earlier reports describing reduced CD5 expression in the thymus and peripheral T cells of chimeric mice generated with mutant (Ets-1d/d) ES cells (5, 7).
|
We next analyzed expression of CD24 (heat stable Ag (HSA)) in conjunction with CD3, CD4, and CD8 to better distinguish later stages of thymocyte maturation in the Ets-1p/p background (Fig. 2). This approach revealed multiple differences between control (Ets-1+/+ or Ets-1+/p) and Ets-1p/p mice. First, an increase in the percentage of thymocytes with an immature phenotype (CD3lowCD24high) was evident in the Ets-1p/p samples when compared with controls (Fig. 2A). This population consists mainly of DP thymocytes (>90%) in control and Ets-1p/p mice (Fig. 2B). It has been demonstrated previously that TCR signaling capacity is impaired in Ets-1-deficient mature T cells (6). Suboptimal TCR signaling is predicted to impair TCR-mediated positive selection in the Ets-1p/p thymus, perhaps resulting in a higher percentage of CD3lowCD24high immature thymocytes. Still, the relative percentage of CD3highCD24high thymocytes was quite comparable between the Ets-1p/p mutants and controls, suggesting that the early transition from a CD3lowCD24high thymocyte to a CD3highCD24high phenotype proceeds relatively normally in the absence of Ets-1 (Fig. 2A). Second, there is an obvious reduction in the frequency of CD3highCD24low thymocytes in the Ets-1p/p mice (Fig. 2A). The low percentage of thymocytes with a mature phenotype (CD3highCD24low) in Ets-1p/p mice may reflect the pronounced defect in the generation of the mature CD8 SP compartment described in Fig. 1. Indeed, an obvious reduction in the frequency of CD8 SP thymocytes was observed in the CD3highCD24high thymocyte subset in Ets-1p/p mice (Fig. 2C), and to a lesser extent, in the more mature thymocyte subset (Fig. 2D), while generation of CD4 SP thymocytes was comparable between control and Ets-1p/p mice in each of the subsets analyzed. Finally, the CD3highCD24low mature thymocyte compartment contained a visible population of DP thymocytes in the Ets-1p/p mice, while virtually no DP thymocytes are observed in the CD3highCD24low subset in control animals (Fig. 2D). Both the CD3highCD24high and CD3highCD24low thymocyte subsets isolated from Ets-1p/p mice also contained increased percentages of cells with a DN phenotype (Fig. 2, C and D). These DN mature thymocytes are likely not comprised of NK T cells, as no difference in NK1.1 staining was observed when comparing control and Ets-1p/p thymocyte subsets (data not shown). These data suggest that, in the Ets-1p/p background, MHC class I-restricted thymocytes may either be retained in the abnormal DP thymocyte compartment with a mature phenotype, or "diverted" into an alternate differentiation pathway characterized by acquisition of a DN phenotype.
|
Despite the dramatic reduction in the CD8 SP thymocyte compartment, CD8+ T cells were detectable in peripheral LN or splenic cell suspensions prepared from Ets-1p/p mice (Fig. 3A and data not shown). Consistent with a previous study using chimeric mice (6), we found reduced overall numbers of both CD4+ and CD8+ T lymphocytes (CD3+) in the LNs harvested from Ets-1p/p mice when compared with control mice (data not shown). In contrast, the yield of CD4 or CD8 T cells from Ets-1p/p spleens was only slightly reduced (data not shown). Although a slight skewing of the CD4:CD8 ratio was observed in the peripheral lymphoid tissues of Ets-1p/p mice, this did not prove to be statistically significant (data not shown). The presence of peripheral CD8+ T cells in the Ets-1p/p background suggests the possibility that the small numbers of CD8 SP thymocytes generated in the Ets-1p/p background are capable of seeding the peripheral lymphoid compartment, where they may undergo homeostatic expansion. In support of this idea, both the CD4+ and CD8+ compartments contain elevated proportions of cells expressing CD44 (Fig. 3B), a phenotype consistent with T cells that have undergone homeostatic expansion (30, 31). Alternatively, T cells may be activated in the periphery in concert with the heightened activation state of B cells and prevalence of an autoimmune phenotype in Ets-1p/p mice. This possibility is supported by the observation that peripheral T cells isolated from Ets-1p/p mice routinely expressed higher levels of CD86 (B7-2) when compared with wild-type or Ets-1+/p controls (Fig. 3C), a phenotype similar to that reported for human and murine memory T cells (32, 33). In contrast, no substantial difference in CD80 (B7-1) expression was observed when comparing Ets-1+/+ and Ets-1p/p T cell subsets (data not shown). We also noticed a marked reduction of Thy1 (Thy1.2) expression on peripheral T cells isolated from Ets-1p/p mice (Fig. 3D), consistent with the initial report describing Ets-1d/d chimeric mice (5). However, Thy1 was detected at relatively normal levels on DP and CD4 SP thymocytes isolated from the Ets-1p/p mice, indicating that Ets-1 is not strictly required for Thy1 expression at these stages of development (Fig. 3E). The contribution of low Thy1 expression, if any, to the poor proliferative capacity and increased sensitivity to programmed cell death observed in Ets-1p/p T cells remains to be determined.
|
To monitor directly the efficiency of MHC class I-restricted selection of CD8+ thymocytes in Ets-1p/p mice, we intercrossed this strain with transgenic mice expressing the male Ag-specific H-2Kb-restricted HY TCR (34). Similar to non-TCR-transgenic mice, thymocyte yield from Ets-1p/p HY TCR+ mice was
3040% of that obtained from control (Ets-1+/p) HY TCR+ mice (data not shown). As expected, the percentage of CD8 SP thymocytes in female HY mice was markedly reduced in the Ets-1p/p background (Fig. 4A), consistent with impaired selection and/or lineage commitment along the CD8 pathway. Ets-1p/p HY+ mice also contained an increased percentage of DN thymocytes, which may reflect compounded effects of the Ets-1 mutation and abnormally high levels of HY TCR expression on immature thymocytes in the HY TCR-transgenic background. Importantly, expression of the HY TCR (as determined by staining with Abs specific for V
8.1/8.2 or the clonotypic HY TCR) was virtually identical when comparing DN thymocytes harvested from HY+ Ets-1+/+ or Ets-1p/p mice (Fig. 4B and data not shown), indicating that defective selection of DP thymocytes is not due to differences in HY TCR expression at prior stages of development. In female mice, expression of the HY TCR decreases as thymocytes acquire a DP phenotype. This was observed in both Ets-1+/p and Ets-1p/p backgrounds, although a subset of DP thymocytes expressed the HY TCR at high levels in the Ets-1p/p background (Fig. 4B). HY TCR expression was detected at high levels on the small percentage of CD8 SP thymocytes generated in the Ets-1p/p HY+ background, indicating that selection of CD8 SP thymocytes does occur, albeit suboptimally, in the Ets-1p/p background (data not shown). Expression of the HY TCR on CD4 SP thymocytes was not reproducibly detected in Ets-1p/p HY+ mice, indicating that lineage commitment of MHC class I-restricted thymocytes had not been redirected along the CD4 pathway (data not shown).
|
To assess in more detail thymocyte maturation in the HY TCR background, individual subsets were first identified based on CD3 and CD24 expression, and then analyzed individually for CD4 and CD8 expression (Fig. 4, DG). Unlike normal thymocytes, the HY TCR is expressed at high levels on immature DN thymocytes. Thus, the DN thymocytes are found predominantly in the CD3highCD24high population in both the Ets-1+/p and Ets-1p/p backgrounds when the HY transgene is expressed (Fig. 4F), while the CD3lowCD24high population contains predominantly DP thymocytes in both backgrounds (Fig. 4E). Within the CD3highCD24high populations the majority of Ets-1p/p DP thymocytes expressed higher levels of CD4 and CD8 than the corresponding subset isolated from Ets-1+/p HY TCR mice (Fig. 4F). In addition, CD3highCD24high thymocytes isolated from Ets-1p/p HY TCR+ female mice contained relatively few CD4 or CD8 SP thymocytes when compared with Ets-1+/p HY TCR+ controls (Fig. 4F). These data are consistent with impaired positive selection and subsequent transition from a CD4highCD8high to a CD4lowCD8low DP phenotype in the Ets-1p/p background. In addition, an increased proportion of thymocytes with a DP or DN phenotype was observed in the more mature CD3highCD24low subset in the Ets-1p/p HY+ mice (Fig. 4G), consistent with observations made in nontransgenic Ets-1p/p mice (Fig. 2D). These results support further the idea that Ets-1 is required for optimal positive selection and subsequent maturation of MHC class I-restricted thymocytes, and that in the absence of Ets-1, thymocytes normally destined to become a CD8 SP thymocyte adopt an alternate fate and/or phenotype.
The defect in CD8+ thymocyte development in Ets-1p/p mice is thymocyte intrinsic
We reasoned that impaired positive selection of MHC class I-restricted thymocytes and the low frequency of CD8 SP thymocytes present in the Ets-1p/p mice could arise as a consequence of reduced or aberrant expression of MHC class I in the thymic microenvironment. However, MHC class I expression was detected at normal levels in all Ets-1p/p cell subsets analyzed, including thymocytes, peripheral lymphocytes, and CDR-1+ cortical epithelial cells (data not shown), indicating that a loss of class I expression is not responsible for defective selection and generation of CD8 SP thymocytes in the Ets-1p/p background.
To determine whether the defect in generation of CD8 SP thymocytes in Ets-1p/p mice is indeed intrinsic to developing thymocytes and not a consequence of an Ets-1p/p thymic microenvironment, we first generated chimeric mice by reconstituting lethally irradiated C57BL/6 x 129Sv mice with bone marrow isolated from wild-type, Ets-1+/p, or Ets-1p/p mice. Under these conditions, defective generation of mature (CD3high) CD8 SP thymocytes in the Ets-1p/p mutant donor cell compartment was still observed (Fig. 5A). To examine CD8 SP generation in the context of a wild-type hemopoietic compartment, we next generated chimeric mice by injecting lethally irradiated host mice (CD45.2+) with bone marrow harvested from congenic (CD45.1+) wild-type mice mixed 1:1 with bone marrow isolated from wild-type, Ets-1+/p, or Ets-1p/p mutant mice (all CD45.2+). In each case where thymocytes derived from wild-type or Ets-1+/p origin were analyzed, the CD4:CD8 distribution within the CD3high subset was comparable to that observed in wild-type, nonirradiated mice (Fig. 5, BD). In marked contrast, even under conditions where the majority of the thymocytes and thymic stroma were of wild-type origin, we still observed an obvious defect in the generation of mature CD8+ thymocytes in the Ets-1p/p (CD45.2+) donor compartment (Fig. 5D, last panel). These data clearly indicate that the defect in generation of CD8 SP thymocytes observed in Ets-1p/p mice is cell-intrinsic, and substantiate further the important and previously unappreciated role for the Ets-1 transcription factor in directing thymic selection and lineage commitment of MHC class I-restricted thymocytes.
|
Given the potential for Ets-1 to regulate the expression of additional genes that could potentially effect the outcome of thymic selection and/or lineage commitment, we used RT-PCR to determine the expression of Runx1, Runx3, GATA-3, TOX, Th-POK, and HEB in sort-purified DP thymocytes isolated from Ets-1+/+, Ets-1+/p, or Ets-1p/p mice (Fig. 6). Each of these transcription factors is known to regulate thymic selection and/or lineage commitment (35, 36, 37, 38, 39, 40), and Runx3 was of particular interest given a recent report describing impaired generation of CD8 SP thymocytes in mice deficient for this factor (41). The expression of Runx1 or Runx3 was not appreciably altered in the Ets-1p/p background, indicating that Ets-1 is not required for the expression of these factors and that altered expression of Runx3 is not likely to contribute to the thymic phenotype observed in the Ets-1p/p mice. In addition, no obvious differences in the expression of GATA-3, TOX, Th-POK, or HEB were detected between control and Ets-1p/p DP thymocytes (Fig. 6). These data indicate that Ets-1 deficiency has no major impact on the global expression of multiple transcription factors that are known to direct thymocyte maturation and fate.
|
| Discussion |
|---|
|
|
|---|
Besides MHC class I (
2M)-deficient mice (20, 42), two other mutant strains of mice have been described which manifest impaired development in the mature CD8+ thymocyte compartment that is remarkably similar to that observed in the Ets-1p/p mice. First, mice deficient for the IFN regulatory factor 1 (IRF-1) display a profound absence of CD8 SP thymocytes (43). In contrast to the Ets-1p/p mice, IRF-1 mutant mice have reduced levels of MHC class I on virtually all thymocyte subsets and thymic stromal elements examined, including CDR-1+ cortical epithelial cells. The relatively normal level of MHC class I expression in the Ets-1p/p thymus and the thymocyte intrinsic nature of the observed defect suggests that defective IRF-1 expression or function is not likely to be the reason for the impaired selection and generation of CD8+ thymocytes in the Ets-1p/p background. Second, mice deficient for the Runx3 transcription factor (also called AML-2, Cbfa3, or Pebp2
C) manifest a severe reduction in the CD8 SP thymocyte compartment, despite intact DP and CD4 SP subsets (41). Two regulatory sites, both of which are capable of binding Runx1 or Runx3, are present in the CD4 silencer region and function to repress CD4 expression at several stages of thymocyte development (40, 44, 45, 46). In the peripheral lymphoid tissues of adult Runx3-deficient mice or chimeric mice generated using Runx3-deficient fetal liver cells and irradiated RAG-2-deficient mice as hosts, there is a marked reduction in the percentage of CD8+ T cells and an increased proportion of T cells expressing both CD4 and CD8 (40, 41), providing strong evidence that Runx3 functions to silence CD4 expression in T cells that have committed to the CD8 lineage. Introducing the Runx3 mutant strain into a Runx1+/ background further enhances the phenotype, indicating that both Runx1 and Runx3 can function to promote silencing of the CD4 gene during thymocyte development and lineage commitment (41). Curiously, defective generation of CD8 SP thymocytes in the context of Runx3 deficiency is not readily apparent in chimeric mice generated using Runx3-deficient fetal liver cells and Rag-2 deficient hosts, despite the peripheral phenotype described above (40). Although the precise reason for this is not currently known, this may be analogous to the differences observed between chimeric mice generated using Ets-1p/p mutant ES cells and our analyses using nonchimeric Ets-1p/p mice.
Ets transcription factors have been shown to cooperate with Runx1 in regulating gene transcription (47, 48, 49, 50, 51), suggesting that perhaps the Ets-1p/p phenotype arises as a consequence of dysregulated Runx activity in the thymus. Indeed, a computer algorithm (MatInspector) predicts a single Ets-1-binding site located between the Runx-binding sites in the CD4 silencer region (data not shown), advancing the possibility that Ets-1 and Runx3 may function in concert to silence the CD4 gene during thymic lineage commitment. Transcripts encoding Runx1 or Runx3 were detected at normal levels in sort-purified DP thymocytes isolated from Ets-1p/p mice, indicating that Ets-1 is not required for normal Runx1 or Runx3 expression (Fig. 6). Thus, the failure to generate substantial numbers of CD8 SP thymocytes in the Ets-1p/p background may be due in part to failed silencing of the CD4 gene, perhaps as a consequence of suboptimal Runx3 function. It will now be of significant interest to measure the activity of the CD4 silencer in Ets-1p/p thymocytes and explore potential occupancy of the CD4 silencer by wild-type Ets-1.
At present, it is not clear whether the elevated percentage of T cells with a memory phenotype (CD44+) observed in Ets-1p/p mutant mice is directly related to altered thymic selection or homeostic expansion, and to what extent the activated T cell phenotype contributes to the onset of autoimmunity observed in these mice. Aberrant B cell differentiation and activation in the Ets-1p/p mutant background has been attributed to both B cell intrinsic and extrinsic factors (9), the latter which may include a heightened activation state of peripheral T cells. Similarly, it is not clear whether Ets-1 is required for sustaining expression of Thy1 or whether the selective loss of Thy1 expression in peripheral T cells arises as a consequence of the environment, although a study comparing Thy1 expression in the mouse and rat suggests that thymic expression of Thy1 may not be Ets-1 dependent (52). Thy1 is a GPI-linked glycoprotein that can initiate activating signals and synergize with the TCR to promote T cell activation (53). A direct contribution of aberrant Thy-1 expression to the reduced proliferative capacity observed in Ets-1p/p peripheral T cells remains to be addressed.
One possible confounding issue that must be considered when interpreting the results presented here is the effect of Ets-1 deficiency on pre-TCR-mediated selection and allelic exclusion. Although impaired pre-TCR signaling and
-selection has only been shown in chimeric mice generated using Ets-1d/d ES cells (7), it remains possible that the effect on CD8 SP thymocyte generation observed in the Ets-1p/p background may be an indirect consequence of impaired
-selection. We suspect that this is not the case, as other mutant strains of mice that exhibit impaired
-selection (e.g., pre-T
-deficient mice) do not manifest similar specific effects on selection of CD8 SP thymocytes. In addition, it is difficult to envision why the selection and generation of CD8 SP thymocytes would be specifically affected by defects in
-selection or impaired TCR signaling at later stages of development. The current paradigm for thymic selection and lineage commitment indicates that the generation of CD4 SP thymocytes requires a more sustained and/or robust signal via the TCR. Although the "quality" of TCR signaling in Ets-1p/p-deficient thymocytes remains to be addressed, T cells isolated from Ets-1p/p spleen or LN proliferate poorly in response to TCR ligation (6). Thus, if TCR signaling is globally compromised in Ets-1p/p mice, one might expect a selective defect in the generation of CD4 SP thymocytes. Finally, the phenotype and thymic selection defects reported here could arise if the mutant Ets-1p/p protein (lacking the Pointed domain) expressed at low levels in thymocytes retains some limited functional capacity. Any contribution of this mutant protein would have to be independent of the Pointed domain, which contains a phosphorylation and docking site for Erk2, a known molecular contributor to the outcome of selection and lineage commitment (54, 55). The development of mice harboring modified alleles of 1) Ets-1 that can be deleted in an inducible fashion or 2) the CD4 silencer region containing a mutated Ets-1-binding site will no doubt facilitate identification of the precise contribution of Ets-1 to CD8 lineage commitment at later stages of thymic selection and development.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by an Arthritis Foundation Investigator Award (to J.L.C.), National Institutes of Health (NIH) Grant AI54666 (to J.L.C.), an Interdisciplinary and Creative Research Fund Grant (to L.A.G.-S.), and a NIH Cancer Center Support Grant to Roswell Park Cancer Institute (CA16056). ![]()
2 Address correspondence and reprint requests to Dr. James L. Clements, Department of Immunology, Roswell Park Cancer Institute, Elm and Carlton Streets, Buffalo, NY 14263. E-mail address: james.clements{at}roswellpark.org ![]()
3 Abbreviations used in this paper: LN, lymph node; DN, double negative; DP, double positive; SP, single positive; HPRT, hypoxanthine phosphoribosyltransferase; TOX, Thymus HMG Box; HEB, HeLa E-box-binding protein; Th-POK, Th-inducing POZ/Kruppel-like factor; Runx1, Run+-related transcription factor 1; ES, embryonic stem; HSA, heat stable Ag; IRF, IFN regulatory factor. ![]()
Received for publication October 25, 2005. Accepted for publication April 17, 2006.
| References |
|---|
|
|
|---|
locus. Proc. Natl. Acad. Sci. USA 101: 15712-15717.
couples T-cell receptor signalling to ERK activation and thymocyte positive selection. Nature 406: 426-430. [Medline]
2-microglobulin deficient mice lack CD48+ cytolytic T cells. Nature 344: 742-746. [Medline]
2. Mol. Cell. Biol. 20: 81-90.
(CBF
) and Ets-1, modulate DNA binding by CBF
2 (AML1). Mol. Cell. Biol. 20: 91-103. Related articles in The JI:
This article has been cited by other articles:
![]() |
S. A. John, J. L. Clements, L. M. Russell, and L. A. Garrett-Sinha Ets-1 Regulates Plasma Cell Differentiation by Interfering with the Activity of the Transcription Factor Blimp-1 J. Biol. Chem., January 11, 2008; 283(2): 951 - 962. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Moisan, R. Grenningloh, E. Bettelli, M. Oukka, and I-C. Ho Ets-1 is a negative regulator of Th17 differentiation J. Exp. Med., November 26, 2007; 204(12): 2825 - 2835. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Higuchi, F. O. Bartel, M. Masuya, T. Deguchi, K. W. Henderson, R. Li, R. C. Muise-Helmericks, M. J. Kern, D. K. Watson, and D. D. Spyropoulos Thymomegaly, Microsplenia, and Defective Homeostatic Proliferation of Peripheral Lymphocytes in p51-Ets1 Isoform-Specific Null Mice Mol. Cell. Biol., May 1, 2007; 27(9): 3353 - 3366. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |