The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Renckens, R.
Right arrow Articles by van der Poll, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Renckens, R.
Right arrow Articles by van der Poll, T.
The Journal of Immunology, 2006, 177: 1189-1196.
Copyright © 2006 by The American Association of Immunologists

Endogenous Tissue-Type Plasminogen Activator Is Protective during Escherichia coli-Induced Abdominal Sepsis in Mice1

Rosemarijn Renckens2,*,{dagger}, Joris J. T. H. Roelofs{ddagger}, Sandrine Florquin{ddagger}, Alex F. de Vos*,{dagger}, Jennie M. Pater*,{dagger}, H. Roger Lijnen§, Peter Carmeliet, Cornelis van ’t Veer*,{dagger} and Tom van der Poll*,{dagger}

* Center of Infection and Immunity Amsterdam, {dagger} Laboratory of Experimental Internal Medicine, and {ddagger} Department of Pathology, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands; § Center for Molecular and Vascular Biology and Center for Transgene Technology and Gene Therapy, University of Leuven, Leuven, Belgium


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Sepsis is associated with enhanced production of tissue-type plasminogen activator (tPA). We investigated the function of endogenous tPA in the immune responses to Escherichia coli-induced abdominal sepsis using tPA gene-deficient (tPA–/–) and normal wild-type (WT) mice. tPA–/– mice demonstrated an impaired defense against E. coli peritonitis as indicated by higher bacterial loads at the primary site of the infection, enhanced dissemination, and reduced survival. The protective function of tPA was independent of plasmin since plasminogen gene-deficient (Plg–/–) mice were indistinguishable from WT mice. Relative to WT mice, tPA–/– mice demonstrated similar neutrophil counts in the peritoneal cavity despite much higher bacterial loads and higher local concentrations of neutrophil attracting chemokines, suggesting a reduced migratory response. In line, tPA–/– mice demonstrated a reduced thioglycolate-induced neutrophil influx into the peritoneal cavity and i.p. injection of WT mice with a replication-defective adenoviral vector expressing tPA caused an enhanced cell migration to the peritoneal cavity during E. coli peritonitis. These findings identify a novel protective function of tPA in abdominal sepsis caused by E. coli that seems independent of its role in the generation of plasmin.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Sepsis is the leading cause of death in critically ill patients in the developed world (1). Whereas the overall mortality rate of sepsis is 25–30%, mortality in patients with abdominal sepsis can be as high as 60% (1, 2). Although different bacteria have been identified as causative organisms in peritonitis, Escherichia coli remains one of the most common pathogens in i.p. infections (2, 3).

Sepsis results in the activation of various host mediator systems including the cytokine network and the coagulation and fibrinolytic systems. Tissue-type plasminogen activator (tPA)3 is a serine protease, the main function of which is to activate the fibrinolytic system by the conversion of plasminogen into the active protease plasmin (4). Evidence exists that systemic and abdominal infection are associated with increased production of tPA. Patients with sepsis demonstrated elevated tPA levels, increasing further during severe sepsis and septic shock (5). In patients with bacterial peritonitis, tPA levels in peritoneal fluid were found to increase 65-fold (6). Furthermore, plasma tPA levels strongly increased in healthy humans i.v. injected with E. coli LPS (7, 8). Some attempts have been made to treat patients with severe sepsis, in particular meningococcal purpura fulminans, with recombinant tPA, but the results have been variable and concern has been raised about hemorrhagic complications (9).

In the last decade, evidence has accumulated showing that mediators of the fibrinolytic system have more functions besides their fibrin-degrading properties. Plasmin plays an important role in degradation of extracellular matrix components, tissue remodeling, and cellular migration (10). Furthermore, recent studies using tPA–/– mice showed that tPA promotes the induction of matrix metalloproteinase-9 during focal cerebral ischemia (11, 12) and renal interstitial fibrosis (13) thereby affecting various inflammatory responses. Despite its enhanced production during bacterial peritonitis and sepsis and its potential impact on the host response, the function of endogenous tPA in the pathogenesis of sepsis has not been investigated thus far. By using tPA–/– mice, we here studied the role of tPA in E. coli-induced abdominal sepsis in vivo. Our results show for the first time that endogenous tPA is part of the protective immune response to abdominal sepsis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Animals

The Institutional Animal Care and Use Committee approved all experiments. C57BL/6 (wild-type (WT)), tPA–/–, and Plg–/– mice, both on a C57BL/6 genetic background, were obtained from The Jackson Laboratory. Female 8- to 10-wk-old mice were used in all experiments.

Induction of peritonitis

Peritonitis was induced as described previously (14, 15, 16). In brief, E. coli O18:K1 was cultured in Luria-Bertani medium (Difco) at 37°C, harvested at mid-log phase, and washed twice with sterile saline before injection. Mice were injected i.p. with 1 x 104 CFU of E. coli O18:K1 in 200 µl of sterile saline.

Sample harvesting

At the time of sacrifice, mice were first anesthetized by inhalation of isoflurane (Abbott Laboratories). A peritoneal lavage was then performed with 5 ml of sterile isotonic saline using an 18-gauge needle, and peritoneal lavage fluid was collected in sterile tubes (Plastipack; BD Biosciences). After collection of peritoneal fluid, deeper anesthesia was induced by i.p. injection of 0.07 ml of FFM mixture (fentanyl (0.315 mg/ml)-fluanisone (10 mg/ml); Janssen), midazolam (5 mg/ml; Roche) per gram of body weight. The abdomen was opened, and blood was drawn from the vena cava inferior into a sterile syringe, transferred to tubes containing heparin, and immediately placed on ice. Thereafter, livers and lungs were harvested and processed for histology and measurements of CFU as described before (14, 15, 16) and (for RT-PCR) below.

Evaluation of mRNA levels by quantitative RT-PCR

Total RNA was isolated using the RNeasy Mini kit system (Qiagen) and treated with RQ1 RNase-Free DNase (Promega) and reverse transcribed using oligo(dT) primer and Moloney murine leukemia virus reverse transcriptase (Invitrogen Life Technologies) according to recommendations of the suppliers. RT-PCRs were performed on cDNA samples that were 4-fold diluted in H2O using FastStart DNA Master SYBR Green I (Roche) with 2.5 mM MgCl2 in a LightCycler (Roche) apparatus. PCR conditions were: 5 min 95°C hot-start, followed by 40 cycles of amplification (95°C for 15 s, 60°C for 5 s, 72°C for 20 s). For quantification standard curves were constructed by PCR on serial dilutions of a concentrated cDNA and data were analyzed using the LightCycler software as described by the manufacturer. Gene expression is presented as a ratio of the expression of the housekeeping gene beta2m (17). All PCRs generated a single DNA product of the expected length as judged by evaluation on ethidium bromide-stained 1.2% agarose gel electrophoresis. Primers used for murine (m) tPA were mtPA-S1454 CTCCATTCTTCTCTGACCGG and mtPA-AS1630 TTGATCATGCACACCAGAGG. Primers for the housekeeping gene were mbeta2m S74 TGGTCTTTCTGGTGCTTGTCT and mbeta2m AS231 ATTTTTTTCCCGTTCTTCAGC.

In situ hybridization

tPA-specific digoxigenin-labeled riboprobes were prepared by T7 RNA polymerase driven in vitro transcription from clone-specific PCR products as template. Primers used in the PCR were: 5'-ATTTAGGTGACACTATAGGGCCCTGTATTTCTCTGACTT T –3' and 5'-TAATACGACTCACTATAGGGGTCC TCC ACG CTG TGT AAC TCT-3', yielding a 466-bp product. The underlined primer regions encode the T7-promoter element. Using these probes, in situ hybridization was performed as described previously (18), using the digoxigenin-labeled riboprobes at a concentration of 300 ng/ml. After hybridization, slides were washed and bound alkaline phosphatase activity was visualized with NBT chloride and 5-bromo-4-chloro-3-indolylphosphate (BCIP), toluidine salt (NBT/BCIP) (Roche).

Determination of bacterial outgrowth

Liver and lungs were homogenized as described earlier (14, 15, 16). In short, organs were weighed and to correct for the differences in weight of the organs, we added four times the weight of the organ (in milligrams) in microliters of sterile saline, in which it was homogenized. Next, eight serial 10-fold dilutions were made of each sample of the homogenates, peritoneal lavage fluid, and blood, in sterile saline, and 50 µl of each dilution was plated onto blood agar plates. The plates were incubated at 37°C under 5% CO2, and after 16 h CFU were counted and corrected for the dilution factor.

Monitoring of mortality

Our laboratory previously established that in this model mortality occurs predominantly between 24 and 72 h after the E. coli challenge (14). Therefore, mortality was assessed every hour during this period and at 6-h intervals thereafter. In this model, mice surviving for >3 days appeared healthy and remained alive for at least 4 wk (after which they were killed).

Phagocytosis assay

The uptake of E. coli by peritoneal macrophages was analyzed as described previously (19, 20). In short, macrophages were isolated from the peritoneal cavities of untreated WT and tPA–/– mice, and were cultured overnight at 37°C to allow adherence. FITC-labeled heat-killed (HK)-E. coli O18:K1 (equivalent to 5 x 107 CFU) were added to the cells (bacterium-cell ratio of 50:1) and incubated for 2 h at 37°C. Phagocytosis was stopped and the cells were treated with vital blue stain (Orpegen) to quench extracellular fluorescence, washed and analyzed using a FACSCalibur flow cytometer (BD Biosciences). Results are expressed as phagocytosis index, defined as the percentage of cells with internalized E. coli times the mean fluorescence intensity.

Cell counts and differentials

Cell counts were determined in peritoneal lavage fluid using a hemacytometer (Beckman Coulter). Subsequently, differential cell counts were performed on cytospin preparations stained with a modified Giemsa stain (Diff-Quick; Dade Behring).

Histology

Lungs and livers for histology were harvested 6 and 20 h after infection, fixed in 4% formalin, and embedded in paraffin. Four-micrometer sections were stained with H&E and analyzed by a pathologist who was blinded for groups. To score liver injury, the following parameters were analyzed (16): interstitial inflammation, formation of thrombi, hepatocellular necrosis, and portal inflammation. To score lung inflammation and damage, each entire left lung was screened for the following parameters: interstitial inflammation, edema, pleuritis, and thrombus formation. Each parameter was graded on a scale from 0 to 4, as follows: 0, absent; 1, mild; 2, moderate; 3, severe; 4, very severe. The total injury score was expressed as the sum of the scores for all parameters; the maximum values were 16.

Assays

mtPA (Kordia), keratinocyte-derived chemokine (KC) and MIP-2 (both obtained from R&D Systems) were measured by ELISA. TNF-{alpha}, IL-6, and IL-10 were measured by cytometric bead array multiplex assay (BD Biosciences). Aspartate aminotransferase and alanine aminotransferase were determined with commercially available kits (Sigma-Aldrich), using a Hittachi analyzer (Boehringer Mannheim). Human tPA was measured by ELISA (Kordia).

Intracellular TNF-{alpha} staining

For intracellular TNF-{alpha} staining, peritoneal macrophages from untreated tPA–/– and WT mice were washed and resuspended in medium (RPMI 1640 containing 1 mM pyruvate, 2 mM L-glutamine, penicillin, streptomycin, and 10% tPA-deficient serum (Molecular Innovations)). Cells were then incubated in 96-well flat-bottom microtiter plates (Greiner) (1 x 105/well) for 2 h at 37°C, 5% CO2 and than washed with medium to remove nonadherent cells. Next, the adherent monolayer cells were stimulated for 4 h in 200 µl of medium alone or with LPS from E. coli (100 µg/ml; Sigma-Aldrich) or HK-E. coli O18:K1 (1 x 107 CFU/ml) at 37°C, 5% CO2. After 1 h, brefeldin A (10 µg/ml) was added to the wells. The cells were harvested, fixed, and permeabilized using the BD Cytofix/Cytoperm kit (BD Biosciences) according to the manufacturer’s instructions. The cells were stained with allophycocyanin-conjugated anti-TNF-{alpha} Abs (BD Biosciences) for 30 min at room temperature. Stained cells were analyzed on the FACSCalibur flow cytometer with CellQuest software.

Sterile peritoneal inflammation model

A thioglycolate-induced inflammation model was used as described previously (21, 22). WT and tPA–/– mice (n = 8/group) were injected i.p. with 0.5 ml of a 4% Brewer thioglycolate medium (Difco Laboratories). At 6 h, the mice were sacrificed, and peritoneal lavage and cell counts were performed as described above

Adenoviral tPA gene transfer

The recombinant replication-defective adenoviral vector expressing human tPA (Ad.tPA) was generated by homologous recombination in 293 cells (23, 24, 25). After transfection, recombinant viral plaques were harvested and amplified (26, 27, 28) and large-scale production of recombinant adenovirus was performed as described (26). The kinetics and organ distribution of tPA expression after adenoviral transfer by i.v. bolus injection have been reported in detail elsewhere (29). In a first series of experiments, we injected WT mice i.p. with 2 x 109 PFU of Ad.tPA and determined human tPA levels in plasma obtained 1, 2, and 4 days later. In a second experiment, WT mice received an i.p. injection of 2 x 109 PFU of a control replication-defective adenoviral vector (Ad.RR5) or Ad.tPA in 200 µl of sterile isotonic saline 4 days before i.p. injection with E. coli and were sacrificed 20 h later as described above.

Statistical analysis

Differences between groups were calculated by using the Mann-Whitney U test. For survival analysis, a Kaplan-Meier analysis followed by a log-rank test was performed. Values are expressed as means ± SE. A p value of <0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
tPA is up-regulated during E. coli-induced abdominal sepsis in mice

To evaluate the role of tPA during Gram-negative abdominal sepsis, we used a murine E. coli peritonitis model. To confirm tPA production in this model, we measured tPA mRNA levels in liver and lung tissue, and tPA protein concentrations in plasma of WT mice at various time points after the induction of peritonitis. Intraperitoneal injection of E. coli significantly increased mRNA and protein levels of tPA (all p < 0.05 vs baseline; Fig. 1, A–C). To obtain insight into the cellular source of tPA during abdominal sepsis, we performed in situ hybridization on liver and lung tissue of WT mice at 20 h after E. coli injection. tPA mRNA expression colocalized mainly with the endothelium in both lung and liver tissues (Fig. 1, D and E).


Figure 1
View larger version (80K):
[in this window]
[in a new window]
 
FIGURE 1. Enhanced tPA production during septic peritonitis. WT mice were injected i.p. with 104 CFU E. coli (0 h) and sacrificed just before and at various hours after infection. Liver (A) and lung (B) tPA mRNA expression was determined by RT-PCR. Plasma tPA protein levels (C) were measured by ELISA. Results are expressed as means ± SE; n = 4 mice/time point. *, p < 0.05 vs 0 h. Localization of tPA mRNA in liver (D) and lung (E) tissue as determined by in situ hybridization at 20 h postinfection. Slides are representatives of n = 8 mice. Magnification, x200.

 
tPA–/– mice are more susceptible to E. coli-induced abdominal sepsis

In a first attempt to determine the role of tPA in E. coli abdominal sepsis, tPA–/– and WT mice were injected i.p. with 104 CFU of E. coli and either observed for 4 days to monitor survival or sacrificed after 6 or 20 h. When compared with WT mice, tPA–/– mice showed a significantly reduced survival (Fig. 2). The mice that survived the infection stayed alive for at least 4 wk, after which they were killed. Furthermore, at the time points indicated, we counted the number of E. coli CFUs in the peritoneal lavage fluid to assess the bacterial load at the site of the infection, in the blood to evaluate to which extent the bacteria escaped to the circulation and the infection became systemic, and in the liver and lungs to evaluate whether the infection had spread to distant organs (Fig. 3). Whereas at 6-h postinfection, tPA–/– mice tended to have higher bacterial loads, significantly more E. coli CFUs were recovered from their peritoneal fluid, liver, and lungs at 20 h. These data indicate that endogenous tPA limits the outgrowth of bacteria at the primary site of infection, contributes to containment of the infection in the peritoneal cavity, and thereby plays a protective role against lethality during E. coli-induced abdominal sepsis.


Figure 2
View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 2. tPA protects against E. coli-induced mortality. Survival was monitored in tPA–/– ({blacksquare}) and WT ({square}) mice after i.p. infection with 104 CFU of E. coli; n = 12 mice/group.

 

Figure 3
View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 3. tPA–/– mice demonstrate an enhanced bacterial outgrowth and dissemination. Numbers of E. coli CFU in peritoneal lavage fluid, blood, liver, and lungs at 6 and 20 h after i.p. injection of E. coli in tPA–/– ({blacksquare}) and WT ({square}) mice. Data are expressed as means ± SE; n = 8 mice/group/time point. **, p < 0.001 and *, p < 0.05 vs WT at the same time point.

 
Unchanged phagocytosis of E. coli by tPA–/– peritoneal macrophages

To investigate whether the increased bacterial outgrowth in tPA–/– mice could be the result of an intrinsic defect in the ability of tPA–/– macrophages to phagocytose E. coli, we harvested macrophages from uninfected tPA–/– and WT mice and compared their capacity to phagocytose HK-E. coli. Peritoneal macrophages from the tPA–/– mice displayed a normal ability to phagocytose E. coli (phagocytosis index of 1131 ± 121 vs 1007 ± 70 in WT mice, nonsignificant).

Inflammatory cell influx

The recruitment of leukocytes to the site of an infection is an essential part of the host defense to invading bacteria. The mouse CXC chemokines KC and MIP-2 have been implicated to play an important role in the attraction of neutrophils during inflammation (30, 31). Therefore, we determined chemokine levels and leukocyte counts and differentials in peritoneal fluid at 6 and 20 h after E. coli or saline injection in tPA–/– and WT mice. KC and MIP-2 levels were strongly elevated at 6 and 20 h postinfection. tPA–/– mice had significantly increased levels of both chemokines compared with WT mice at 20 h postinfection (Table I). Saline injection did not result in a change in leukocyte counts or differentials (data not shown). However, E. coli injection resulted in a profound increase in total leukocyte numbers in the peritoneal fluid, which was mainly due to neutrophil influx (Table I). Despite the much higher local chemokine levels and the higher local bacterial load (providing a more potent proinflammatory stimulus), tPA–/– mice showed similar neutrophil numbers in their peritoneal lavage fluid compared with WT mice at both time points.


View this table:
[in this window]
[in a new window]
 
Table I. Chemokine levels and inflammatory cell counts in peritoneal fluida

 
Higher cytokine levels in tPA–/– mice

To determine whether tPA influenced the production of cytokines during septic peritonitis, local and systemic levels of pro- and anti-inflammatory cytokines were measured in WT and tPA–/– mice (Fig. 4). At 6 h after infection, peritoneal lavage fluid and plasma TNF-{alpha}, IL-6, and IL-10 levels were similar in both mouse strains. However, at 20 h both peritoneal and plasma levels of these cytokines were significantly higher in tPA–/– mice. Hence, tPA–/– deficiency was associated with an exaggerated release of cytokines.


Figure 4
View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 4. Higher cytokine levels in tPA–/– mice. TNF-{alpha}, IL-6, and IL-10 levels in peritoneal fluid (A) and plasma (B) of tPA–/– and WT mice at 6 and 20 h after i.p. infection with E. coli. Data are expressed as means ± SE; n = 8/group/time point. **, p < 0.001 and *, p < 0.05 vs WT at the same time point.

 
Normal TNF-{alpha} production by tPA–/– peritoneal macrophages ex vivo

Having established that tPA–/– mice display altered cytokine levels during abdominal sepsis, we next investigated whether tPA deficiency directly influenced TNF-{alpha} production by peritoneal macrophages ex vivo. Therefore, we stimulated peritoneal macrophages from WT and tPA–/– mice for 16 h with either LPS, HK-E. coli, or medium alone. LPS and HK-E. coli significantly increased the percentage of TNF-{alpha}-positive cells in both groups (all p < 0.05 vs medium alone, data not shown). WT and tPA–/– peritoneal macrophages showed no significant differences in percentages of TNF-{alpha}-positive cells after stimulation with LPS (71 ± 5 vs 63 ± 8%, respectively) or HK-E. coli (63 ± 3 vs 51 ± 8%, respectively).

Organ injury

Our model of E. coli peritonitis is associated with profound liver injury (14, 15, 16). To evaluate the role of endogenous tPA in liver injury during abdominal sepsis, we determined liver damage in tPA–/– and WT mice 20 h after infection (Fig. 5). Upon histopathological examination by a pathologist who was blinded for groups, both tPA–/– and WT mice showed inflammation of the hepatic parenchyma, areas of liver necrosis (Fig. 5, A and B) and presence of intravascular thrombi (Fig. 5, A and B, insets). There was no difference in the mean total histology scores of the liver tissues (quantified according to the scoring system described in Materials and Methods) between WT and tPA–/– mice (score of 7.56 ± 1.25 vs 8.19 ± 0.89, respectively). This was confirmed by clinical chemistry, i.e., tPA–/– mice showed similar plasma levels of aspartate aminotransferase (3127 ± 612 vs 3204 ± 808 U/L; p = 0.9) and alanine aminotransferase (976 ± 240 vs 1335 ± 333 U/L; p = 0.4) compared with WT mice. To obtain insight into the role of tPA in the development of inflammation in a more distant organ, lungs were harvested at 20 h after the induction of E. coli infection. Lungs showed clear signs of inflammation in both WT and tPA–/– mice, as reflected by accumulation of leukocytes in the interstitium (Fig. 5, C and D). The total histological scores were significantly higher in tPA–/– mice (score of 5.94 ± 0.47 vs 3.83 ± 0.50 in WT mice; p < 0.05), which was mainly due to higher scores for the amount and size of thrombi in the lungs (Fig. 5, C and D, arrows).


Figure 5
View larger version (148K):
[in this window]
[in a new window]
 
FIGURE 5. Organ damage. Representative H&E stainings of liver (A and B) and lung (C and D) tissue at 20 h after i.p. injection of 104 CFU E. coli in WT (A and C) and tPA –/– (B and D) mice. Microscopic magnification: liver x40, inset in A x200, inset in B x125, lungs x100.

 
Impaired host defense of tPA–/– mice is independent of plasmin

These studies with tPA–/– mice showed an important role for tPA during E. coli peritonitis. Because the major function of tPA is to convert plasminogen into the active protease plasmin, the key enzyme of the fibrinolytic system, we wanted to investigate whether the changes in host defense in tPA–/– mice could be the result of diminished plasmin generation. Therefore, we injected Plg–/–-deficient and WT mice with 1 x 104 CFU E. coli and sacrificed them at 20 h postinfection. In contrast to the tPA–/– mice, Plg–/– mice showed bacterial loads in peritoneal lavage fluid, blood, liver, and lungs that were similar to those recovered from WT mice (Fig. 6). In addition, leukocyte counts and differentials (Table II), local KC and MIP-2 levels and local and circulating cytokine concentrations were similar in Plg–/– and WT mice (data not shown). Liver and lung histology scores were indistinguishable between the two genotypes (data not shown). These data show that plasminogen deficiency does not affect the antibacterial host defense or inflammatory responses in this model, indicating that the role of tPA during E. coli peritonitis is independent of its function as an activator of plasmin.


Figure 6
View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 6. Bacterial outgrowth in plasminogen–/– mice. Numbers of E. coli CFU in peritoneal lavage fluid, blood, liver, and lungs at 20 h after i.p. injection of E. coli in plasminogen–/– ({blacksquare}) and WT ({square}) mice. Data are expressed as means ± SE; n = 6/group.

 

View this table:
[in this window]
[in a new window]
 
Table II. Cell influx in Plg–/– micea

 
Role of tPA in neutrophil migration during peritonitis

We hypothesized that tPA–/– mice had a relatively impaired neutrophil recruitment into the peritoneal cavity after E. coli injection, which was masked by the differences in neutrophil attracting stimuli (higher bacterial load and CXC chemokines) between WT and tPA–/– mice in this model. Therefore, we wanted to examine whether tPA–/– mice have an impaired neutrophil recruitment to the peritoneal cavity during acute sterile inflammation. For this, we used a well-known model of sterile peritonitis induced by thioglycolate. Indeed, at 6 h after i.p. injection of 1 ml of a 4% thioglycolate solution, the tPA–/– mice had lower numbers of neutrophils in their peritoneal lavage fluid compared with WT mice (Fig. 7A). To obtain further evidence for a role of tPA in neutrophil recruitment, we administered 2 x 109 PFU Ad.tPA i.p. to WT mice. By using this approach, we sought to examine the effect of high levels of tPA on the host response, i.e., the "reverse experiment" with regard to the experiments with tPA–/– mice. Administration of this vector produced high levels of tPA in plasma peaking after 4 days (Fig. 7B). Transgenic tPA was undetectable in peritoneal fluid. To evaluate the effect of tPA overexpression on neutrophil migration during E. coli peritonitis, we injected WT mice with Ad.tPA or Ad.RR5 4 days before infection. At the time of E. coli injection, there were no differences in leukocyte counts or differentials between Ad.tPA- and Ad.RR5-injected mice (data not shown). At 20 h postinfection, mice overexpressing tPA had significantly higher numbers of neutrophils and macrophages in their peritoneal lavage fluid compared with the controls (Fig. 7C). There was no effect of tPA overexpression on the bacterial outgrowth (data not shown).


Figure 7
View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 7. Role of tPA in neutrophil migration. A, Mice were injected i.p. with 1 ml of 4% thioglycolate solution and neutrophil numbers were counted in peritoneal lavage fluid harvested after 6 h. Data are means ± SE; n = 8 mice/genotype. *, p < 0.05 vs WT. B, tPA levels were in measured in plasma at different time points after i.p. injection of 2 x 109 PFU Ad.tPA. C, A total of 1 x 104 CFU E. coli was injected i.p. 4 days after injection of 2 x 109 PFU Ad.tPA or AdRR5. Neutrophil and macrophage numbers were counted in peritoneal lavage fluid harvested after 20 h. Data are means ± SE; n = 8 mice/group. **, p < 0.01; *, p < 0.05 vs WT.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Peritonitis is the second most common cause of sepsis and, especially abdominal sepsis, bears a grim prognosis (32, 33). Severe sepsis is associated with an early fibrinolytic response, which is primarily mediated by enhanced release of tPA. Recent studies have indicated that tPA may influence several inflammatory pathways by actions that at least in part are unrelated to its classical function in the fibrinolytic system (12, 13, 34, 35, 36, 37). We here demonstrate for the first time that endogenous tPA serves a protective role during E. coli peritonitis that is independent of plasmin.

We investigated the changes in tPA levels during E. coli peritonitis in mice. tPA is expressed constitutively in most organs in the mouse, including lungs and liver (38). We found that E. coli peritonitis caused an up-regulation of tPA mRNA in liver and lung tissue. These data are in line with a previous study showing enhanced tPA mRNA expression in various murine tissues after E. coli LPS injection (38). In our model, plasma tPA levels started to rise from 4 h after infection onward and peak plasma concentrations were detected at the end of the 20-h observation period (i.e., shortly before the first animals died). This prolonged time course of tPA release, corresponding with the gradually growing bacterial load, is in line with studies in patients with sepsis in whom plasma tPA concentrations were proportional to the severity of disease (5). Furthermore, in experimental models of self-limiting acute systemic inflammation, such as induced by i.v. injection of low dose LPS into healthy humans, tPA release into the circulation is transient (7, 8). Previous studies also documented elevated tPA levels in peritoneal fluid of patients and rats with bacterial peritonitis (6, 39, 40). In our study, tPA levels remained undetectable in peritoneal lavage fluid, which was probably due to the high dilution factor since we performed the peritoneal lavages with 5 ml of saline.

This is the first study investigating the role of tPA in host defense to abdominal sepsis in mice. The most striking finding of our study was that endogenous tPA played an important role in reducing the outgrowth of E. coli, which was associated with an improved survival of WT mice relative to tPA–/– mice. TPA–/– mice also showed higher chemokine and cytokine levels in their peritoneal lavage fluid and plasma at this time point, which most likely was the consequence of the increased bacterial load, providing a more potent proinflammatory stimulus. Indeed, the ex vivo production of TNF-{alpha} by peritoneal macrophages was not influenced by the absence of tPA. Theoretically, one would expect that the locally higher bacterial load and more elevated chemokine levels would result in an increased neutrophil influx to the peritoneal cavity in tPA–/– mice. However, we did not find any difference in inflammatory cell recruitment between tPA–/– and WT mice. This led us to the possibility of a relatively impaired migratory response in tPA–/– mice. To our knowledge, a direct role of tPA in inflammatory cell migration has not been described to date. However, Roelofs et al. (41) recently reported that tPA deficiency was associated with an impaired neutrophil influx into the kidneys in a model of ischemia reperfusion injury, which is associated with a profound inflammatory response (41). Furthermore, they found no differences in cytokine levels between WT and tPA–/– mice (41), which is in agreement with our ex vivo experiments. To investigate whether the neutrophil migratory response to the peritoneal cavity was indeed impaired in tPA–/– mice, we used the well-known model of thioglycolate-induced sterile peritonitis. Although it should be noted that thioglycolate-induced cell migration cannot be directly compared with E. coli-induced cell recruitment, we indeed found that the absence of tPA was associated with a reduced neutrophil influx in this model of sterile inflammation. Furthermore, enhanced expression of tPA by the administration of Ad.tPA increased neutrophil influx into the peritoneal cavity during peritonitis. This transgenic overexpression of tPA was done to determine the effects of artificially elevated levels of tPA on host defense in this model, i.e., the approach opposite to the total absence of tPA such as in tPA–/– mice. It should be emphasized that human tPA is produced by this vector (not mouse tPA) and that the plasma levels of human tPA after Ad.tPA administration were >1000 ng/ml whereas endogenous tPA levels increased to ~3 ng/ml in WT mice. Furthermore, this approach cannot reproduce the kinetics of endogenous tPA production and release such as observed in WT mice during abdominal sepsis. Thus, we chose to administer Ad.tPA to WT mice, not to tPA–/– mice, because Ad.tPA would not make tPA–/– mice phenotypically comparable to WT mice for the reasons described above.

Together, these data suggest that there might be a role for tPA in inflammatory cell recruitment to the peritoneal cavity, which may have contributed to the reduced antibacterial defense in tPA–/– mice. Finally, we examined organ damage in both genotypes at 20 h postinfection. We found more and bigger thrombi in the lungs of the tPA–/– mice compared with WT mice. The higher susceptibility of tPA–/– mice to thrombi formation might have been due to the stimulatory role of tPA in plasmin activation and subsequent fibrin degradation. However, previous studies using anti-IL-6 Abs showed that IL-6 plays a very important role in both systemic and pulmonary coagulation activation after i.v. E. coli LPS injection in chimpanzees, which was measured by prothrombin activation fragment F1 + 2 and thrombin-antithrombin complexes in plasma and bronchoalveolar lavage fluids (42, 43). Thus, it is possible that the strongly enhanced circulating IL-6 levels in the tPA–/– mice might also have contributed to the enhanced thrombi formation in the lungs of these mice in this model.

The main physiological function of tPA is to convert plasminogen into the active protease plasmin. Besides binding to fibrin, plasmin(ogen) can bind to many cell types, including neutrophils (44, 45). Plasmin has the ability to directly degrade extracellular matrix proteins and can also activate matrix metalloproteinases. Thereby, cell-associated plasmin might promote cellular migration (10). Indeed, plasmin-induced neutrophil aggregation and adhesion in vitro (46, 47). Moreover, studies using Plg–/– mice have provided in vivo evidence for an essential role of the plasminogen system in thioglycolate-induced macrophage migration (21). To investigate whether plasmin might play a role in the impaired host defense of tPA–/– mice during E. coli peritonitis, we infected Plg–/– mice and studied the number of E. coli CFUs in several body compartments and the inflammatory response (cell influx, chemokine or cytokine levels, histopathology) at 20 h postinfection. We found no differences between Plg–/– and WT mice, strongly suggesting that the role of tPA in host defense against E. coli is independent of its fibrinolytic function.

Peritonitis is a common cause of sepsis in humans. Intraperitoneal administration of live E. coli results in a paradigm that resembles a clinical condition commonly associated with septic peritonitis, with diaphragmatic lymphatic clearance, and systemic bacteremia and endotoxemia (48). We here used this model to investigate the function of tPA in host defense against septic peritonitis. Our results identify for the first time a protective role for tPA in the immune response to abdominal sepsis. The mechanism by which tPA mediates this effect seems independent of its plasminogen-activating function. Our data extend rapidly increasing knowledge of the biology of fibrinolytic mediators involved in plasminogen activation, such as tPA, urokinase-type plasminogen activator and its receptor, and plasminogen activator inhibitor-1, which clearly exert activities that go beyond their ability to stimulate or inhibit fibrinolysis.


    Acknowledgments
 
We thank Anita de Boer and Joost Daalhuisen for providing expert technical assistance.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by a grant from the Netherlands Heart Foundation (No. 2001B114) to R.R. Back

2 Address correspondence and reprint requests to Dr. Rosemarijn Renckens, Laboratory of Experimental Internal Medicine, Academic Medical Center, Room G2-132, Meibergdreef 9, 1105 AZ Amsterdam, The Netherlands. E-mail address: r.renckens{at}amc.uva.nl Back

3 Abbreviations used in this paper: tPA, tissue-type plasminogen activator; WT, wild type; m, murine; KC, keratinocyte-derived chemokine; HK, heat killed. Back

Received for publication November 16, 2005. Accepted for publication April 12, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Hotchkiss, R. S., I. E. Karl. 2003. The pathophysiology and treatment of sepsis. N. Engl. J. Med. 348: 138-150. [Free Full Text]
  2. Bosscha, K., K. Reijnders, P. F. Hulstaert, A. Algra, C. van der Werken. 1997. Prognostic scoring systems to predict outcome in peritonitis and intra-abdominal sepsis. Br. J. Surg. 84: 1532-1534. [Medline]
  3. McClean, K. L., G. J. Sheehan, G. K. Harding. 1994. Intraabdominal infection: a review. Clin. Infect. Dis. 19: 100-116. [Medline]
  4. Cesarman-Maus, G., K. A. Hajjar. 2005. Molecular mechanisms of fibrinolysis. Br. J. Haematol. 129: 307-321. [Medline]
  5. Mavrommatis, A. C., T. Theodoridis, M. Economou, A. Kotanidou, M. El Ali, V. Christopoulou-Kokkinou, S. G. Zakynthinos. 2001. Activation of the fibrinolytic system and utilization of the coagulation inhibitors in sepsis: comparison with severe sepsis and septic shock. Intensive Care Med. 27: 1853-1859. [Medline]
  6. van Goor, H., V. J. Bom, J. van der Meer, W. J. Sluiter, R. P. Bleichrodt. 1996. Coagulation and fibrinolytic responses of human peritoneal fluid and plasma to bacterial peritonitis. Br. J. Surg. 83: 1133-1135. [Medline]
  7. van Deventer, S. J., H. R. Buller, J. W. ten Cate, L. A. Aarden, C. E. Hack, A. Sturk. 1990. Experimental endotoxemia in humans: analysis of cytokine release and coagulation, fibrinolytic, and complement pathways. Blood 76: 2520-2526. [Abstract/Free Full Text]
  8. Renckens, R., S. Weijer, A. F. de Vos, J. M. Pater, J. C. Meijers, C. E. Hack, M. Levi, T. van der Poll. 2004. Inhibition of plasmin activity by tranexamic acid does not influence inflammatory pathways during human endotoxemia. Arterioscler. Thromb. Vasc. Biol. 24: 483-488. [Abstract/Free Full Text]
  9. Baines, P., E. D. Carrol. 2004. Recombinant tissue plasminogen activator in children with meningococcal purpura fulmicans—role uncertain. Crit. Care Med. 32: 1806-1807. [Medline]
  10. Carmeliet, P., D. Collen. 1998. Development and disease in proteinase-deficient mice: role of the plasminogen, matrix metalloproteinase and coagulation system. Thromb. Res. 91: 255-285. [Medline]
  11. Wang, Y. F., S. E. Tsirka, S. Strickland, P. E. Stieg, S. G. Soriano, S. A. Lipton. 1998. Tissue plasminogen activator (tPA) increases neuronal damage after focal cerebral ischemia in wild-type and tPA-deficient mice. Nat. Med. 4: 228-231. [Medline]
  12. Wang, X., S. R. Lee, K. Arai, K. Tsuji, G. W. Rebeck, E. H. Lo. 2003. Lipoprotein receptor-mediated induction of matrix metalloproteinase by tissue plasminogen activator. Nat. Med. 9: 1313-1317. [Medline]
  13. Yang, J., R. W. Shultz, W. M. Mars, R. E. Wegner, Y. Li, C. Dai, K. Nejak, Y. Liu. 2002. Disruption of tissue-type plasminogen activator gene in mice reduces renal interstitial fibrosis in obstructive nephropathy. J. Clin. Invest. 110: 1525-1538. [Medline]
  14. Sewnath, M. E., D. P. Olszyna, R. Birjmohun, F. J. ten Kate, D. J. Gouma, T. van Der Poll. 2001. IL-10-deficient mice demonstrate multiple organ failure and increased mortality during Escherichia coli peritonitis despite an accelerated bacterial clearance. J. Immunol. 166: 6323-6331. [Abstract/Free Full Text]
  15. Weijer, S., S. H. Schoenmakers, S. Florquin, M. Levi, G. P. Vlasuk, W. E. Rote, P. H. Reitsma, C. A. Spek, T. van der Poll. 2004. Inhibition of the tissue factor/factor VIIa pathway does not influence the inflammatory or antibacterial response to abdominal sepsis induced by Escherichia coli in mice. J. Infect. Dis. 189: 2308-2317. [Medline]
  16. van Westerloo, D. J., I. A. Giebelen, S. Florquin, J. Daalhuisen, M. J. Bruno, A. F. de Vos, K. J. Tracey, T. van der Poll. 2005. The cholinergic anti-inflammatory pathway regulates the host response during septic peritonitis. J. Infect. Dis. 191: 2138-2148. [Medline]
  17. Lupberger, J., K. A. Kreuzer, G. Baskaynak, U. R. Peters, P. le Coutre, C. A. Schmidt. 2002. Quantitative analysis of beta-actin, beta2-microglobulin and porphobilinogen deaminase mRNA and their comparison as control transcripts for RT-PCR. Mol. Cell. Probes 16: 25-30. [Medline]
  18. Roelofs, J. J., A. T. Rowshani, J. G. van den Berg, N. Claessen, J. Aten, I. J. ten Berge, J. J. Weening, S. Florquin. 2003. Expression of urokinase plasminogen activator and its receptor during acute renal allograft rejection. Kidney Int. 64: 1845-1853. [Medline]
  19. Wan, C. P., C. S. Park, B. H. Lau. 1993. A rapid and simple microfluorometric phagocytosis assay. J. Immunol. Methods 162: 1-7. [Medline]
  20. Weijer, S., M. E. Sewnath, A. F. de Vos, S. Florquin, K. van der Sluis, D. J. Gouma, K. Takeda, S. Akira, T. van der Poll. 2003. Interleukin-18 facilitates the early antimicrobial host response to Escherichia coli peritonitis. Infect. Immun. 71: 5488-5497. [Abstract/Free Full Text]
  21. Ploplis, V. A., E. L. French, P. Carmeliet, D. Collen, E. F. Plow. 1998. Plasminogen deficiency differentially affects recruitment of inflammatory cell populations in mice. Blood 91: 2005-2009. [Abstract/Free Full Text]
  22. Swaisgood, C. M., D. Schmitt, D. Eaton, E. F. Plow. 2002. In vivo regulation of plasminogen function by plasma carboxypeptidase B. J. Clin. Invest. 110: 1275-1282. [Medline]
  23. McGrory, W. J., D. S. Bautista, F. L. Graham. 1988. A simple technique for the rescue of early region I mutations into infectious human adenovirus type 5. Virology 163: 614-617. [Medline]
  24. Gomez-Foix, A. M., W. S. Coats, S. Baque, T. Alam, R. D. Gerard, C. B. Newgard. 1992. Adenovirus-mediated transfer of the muscle glycogen phosphorylase gene into hepatocytes confers altered regulation of glycogen metabolism. J. Biol. Chem. 267: 25129-25134. [Abstract/Free Full Text]
  25. Graham, F. L., J. Smiley, W. C. Russell, R. Nairn. 1977. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J. Gen. Virol. 36: 59-74. [Abstract/Free Full Text]
  26. Gerard, R. D., R. S. Meidell. 1995. Adenovirus vectors. D. Glover, ed. DNA Cloning: A Practical Approach: Mammalian Systems 285-307. Oxford University Press, Oxford.
  27. Alcorn, J. L., E. Gao, Q. Chen, M. E. Smith, R. D. Gerard, C. R. Mendelson. 1993. Genomic elements involved in transcriptional regulation of the rabbit surfactant protein-A gene. Mol. Endocrinol. 7: 1072-1085. [Abstract]
  28. Kopfler, W. P., M. Willard, T. Betz, J. E. Willard, R. D. Gerard, R. S. Meidell. 1994. Adenovirus-mediated transfer of a gene encoding human apolipoprotein A-I into normal mice increases circulating high-density lipoprotein cholesterol. Circulation 90: 1319-1327. [Abstract/Free Full Text]
  29. Carmeliet, P., J. M. Stassen, I. Van Vlaenderen, R. S. Meidell, D. Collen, R. D. Gerard. 1997. Adenovirus-mediated transfer of tissue-type plasminogen activator augments thrombolysis in tissue-type plasminogen activator-deficient and plasminogen activator inhibitor-1-overexpressing mice. Blood 90: 1527-1534. [Abstract/Free Full Text]
  30. Walley, K. R., N. W. Lukacs, T. J. Standiford, R. M. Strieter, S. L. Kunkel. 1997. Elevated levels of macrophage inflammatory protein 2 in severe murine peritonitis increase neutrophil recruitment and mortality. Infect. Immun. 65: 3847-3851. [Abstract]
  31. Olson, T. S., K. Ley. 2002. Chemokines and chemokine receptors in leukocyte trafficking. Am. J. Physiol. 283: R7-R28.
  32. Wheeler, A. P., G. R. Bernard. 1999. Treating patients with severe sepsis. N. Engl. J. Med. 340: 207-214. [Free Full Text]
  33. Holzheimer, R. G., K. H. Muhrer, N. L’Allemand, T. Schmidt, K. Henneking. 1991. Intraabdominal infections: classification, mortality, scoring and pathophysiology. Infection 19: 447-452. [Medline]
  34. Stringer, K. A., B. M. Hybertson, O. J. Cho, Z. Cohen, J. E. Repine. 1998. Tissue plasminogen activator (tPA) inhibits interleukin-1 induced acute lung leak. Free Radic. Biol. Med. 25: 184-188. [Medline]
  35. Yang, Y. H., P. Carmeliet, J. A. Hamilton. 2001. Tissue-type plasminogen activator deficiency exacerbates arthritis. J. Immunol. 167: 1047-1052. [Abstract/Free Full Text]
  36. Cook, A. D., E. L. Braine, I. K. Campbell, J. A. Hamilton. 2002. Differing roles for urokinase and tissue-type plasminogen activator in collagen-induced arthritis. Am. J. Pathol. 160: 917-926. [Abstract/Free Full Text]
  37. Stringer, K. A., J. S. Dunn, D. L. Gustafson. 2004. Administration of exogenous tissue plasminogen activator reduces oedema in mice lacking the tissue plasminogen activator gene. Clin. Exp. Pharmacol. Physiol. 31: 327-330. [Medline]
  38. Yamamoto, K., D. J. Loskutoff. 1996. Fibrin deposition in tissues from endotoxin-treated mice correlates with decreases in the expression of urokinase-type but not tissue-type plasminogen activator. J. Clin. Invest. 97: 2440-2451. [Medline]
  39. van Goor, H., J. S. de Graaf, J. Grond, W. J. Sluiter, J. van der Meer, V. J. Bom, R. P. Bleichrodt. 1994. Fibrinolytic activity in the abdominal cavity of rats with faecal peritonitis. Br. J. Surg. 81: 1046-1049. [Medline]
  40. van Goor, H., V. J. Bom, J. van der Meer, W. J. Sluiter, S. Geerards, W. van der Schaaf, J. S. de Graaf, R. P. Bleichrodt. 1996. Pharmacokinetics of human recombinant tissue-type plasminogen activator, administered intra-abdominally, in a rat peritonitis model. Eur. Surg. Res. 28: 287-294. [Medline]
  41. Roelofs, J. J., K. M. Rouschop, J. C. Leemans, N. Claessen, A. M. de Boer, W. M. Frederiks, H. R. Lijnen, J. J. Weening, S. Florquin. 2006. Tissue-type plasminogen activator modulates inflammatory responses and renal function in ischemia reperfusion injury. J. Am. Soc. Nephrol. 17: 131-140. [Abstract/Free Full Text]
  42. van der Poll, T., M. Levi, C. E. Hack, H. ten Cate, S. J. van Deventer, A. J. Eerenberg, E. R. de Groot, J. Jansen, H. Gallati, H. R. Buller, et al 1994. Elimination of interleukin 6 attenuates coagulation activation in experimental endotoxemia in chimpanzees. J. Exp. Med. 179: 1253-1259. [Abstract/Free Full Text]
  43. Levi, M., T. van der poll, H. ten Cate, B. Kuipers, B. J. Biemond, H. M. Jansen, J. W. ten Cate. 1998. Differential effects of anti-cytokine treatment on bronchoalveolar hemostasis in endotoxemic chimpanzees. Am. J. Respir. Crit. Care Med. 158: 92-98.
  44. Herren, T., T. A. Burke, M. Jardi, J. Felez, E. F. Plow. 2001. Regulation of plasminogen binding to neutrophils. Blood 97: 1070-1078. [Abstract/Free Full Text]
  45. Herren, T., C. Swaisgood, E. F. Plow. 2003. Regulation of plasminogen receptors. Front. Biosci. 8: d1-d8. [Medline]
  46. Ryan, T. J., L. Lai, A. B. Malik. 1992. Plasmin generation induces neutrophil aggregation: dependence on the catalytic and lysine binding sites. J. Cell. Physiol. 151: 255-261. [Medline]
  47. Montrucchio, G., E. Lupia, A. De Martino, L. Silvestro, S. R. Savu, G. Cacace, P. G. De Filippi, G. Emanuelli, G. Camussi. 1996. Plasmin promotes an endothelium-dependent adhesion of neutrophils: involvement of platelet activating factor and P-selectin. Circulation 93: 2152-2160. [Abstract/Free Full Text]
  48. Fink, M. P., S. O. Heard. 1990. Laboratory models of sepsis and septic shock. J. Surg. Res. 49: 186-196. [Medline]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
E. Cuadrado, L. Ortega, M. Hernandez-Guillamon, A. Penalba, I. Fernandez-Cadenas, A. Rosell, and J. Montaner
Tissue plasminogen activator (t-PA) promotes neutrophil degranulation and MMP-9 release
J. Leukoc. Biol., July 1, 2008; 84(1): 207 - 214.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Schouten, W. J. Wiersinga, M. Levi, and T. van der Poll
Inflammation, endothelium, and coagulation in sepsis
J. Leukoc. Biol., March 1, 2008; 83(3): 536 - 545.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. A. D. van Zoelen, S. Florquin, J. C. M. Meijers, R. de Beer, A. F. de Vos, O. J. de Boer, and T. van der Poll
Platelet-Activating Factor Receptor Contributes to Host Defense against Pseudomonas aeruginosa Pneumonia but Is Not Essential for the Accompanying Inflammatory and Procoagulant Response
J. Immunol., March 1, 2008; 180(5): 3357 - 3365.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Renckens, R.
Right arrow Articles by van der Poll, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Renckens, R.
Right arrow Articles by van der Poll, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS