HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Related articles in The JI Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hubert, F.-X. Articles by Josien, R. Search for Related Content PubMed PubMed Citation Articles by Hubert, F.-X. Articles by Josien, R. Pubmed/NCBI databases Gene GEO Profiles HomoloGene Protein UniGene Compound via MeSH Substance via MeSH

Differential Pattern Recognition Receptor Expression but Stereotyped Responsiveness in Rat Spleen Dendritic Cell Subsets¹

Institut National de la Santé et de la Recherche Médicale (INSERM) Unité 643, Centre Hospitalo-Universitaire Nantes, Hotel Dieu, Institut de Transplantation et de Recherche en Transplantation (ITERT), and Université de Nantes, Unité de Formation et de Recherche de Médecine, Nantes, France

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Dendritic cells (DC) are a heterogeneous population of APC endowed with specific functions. The nature of the DC subset involved in the course of an immune response to a specific pathogen might be important for inducing the appropriate effectors. In addition, each DC subset might also exhibit intrinsic functional plasticity. In the rat, spleen DC can be separated into three morphological and phenotypical distinct subsets, namely CD4⁺, CD4^–, and plasmacytoid DC (pDC), whose frequencies are strain dependent. We correlated the expression of TLR and nucleotide-binding oligomerization domain 2 (NOD2) in these DC subsets to their in vitro responsiveness to specific ligands. CD4^– DC expressed high levels of TLR1, 2, 3, and 10 mRNA, low TLR4, 5, 6, 7, and 9, and very low, if any, TLR8. pDC had a restricted repertoire characterized by high TLR7 and 9. CD4⁺ DC expressed all TLR and 10-fold higher levels of NOD2 mRNA than CD4^– and pDC. Upon stimulation by TLR and NOD2 ligands, each DC subset responded in quite a stereotyped fashion. TLR2/6, 3, 4, 5, 9, and NOD2 triggering induced CD4^– DC to mature and produce high IL-12p40, low IL-10, and TNF-. TLR7/8 and 9 triggering induced pDC to mature and produce copious amounts of IL-6, IL-12p40, and TNF- and low IFN-. CD4⁺ DC were very poor producers of inflammatory cytokines. This study suggests that the nature of spleen DC responses to pathogens is dependent on subset specific-stimulation rather than intrinsic plasticity.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Recognition of microbial infection and initiation of host defense responses is controlled by multiple mechanisms. TLR have recently emerged as key components of the innate immune system that detect microbial infection and trigger antimicrobial host defense responses (1). TLR activate multiple steps in the inflammatory reactions that lead to elimination of invading pathogens (2). In addition, TLR control multiple dendritic cell (DC)⁵ functions and activate signals that are critically involved in the initiation of adaptive immune responses (3). It has become clear that the crucial maturation checkpoint of DC is tightly controlled at least in part by the innate immune system (4). DC are central to T lymphocyte activation and differentiation into Th1 and Th2 cells (5). DC take up Ags, become activated, and migrate to local lymphoid tissues where they present the antigenic peptides on their MHC molecules (6). This process involves phagocytosis, up-regulation of costimulatory and MHC molecules, secretion of cytokines, and Ag presentation by DC. All of these events are notably regulated through the recognition of pathogens via TLR expressed by DC (4).

Studies of DC subsets isolated from humans and mice have revealed that TLR have distinct expression patterns, indicating that DC subsets have different intrinsic capabilities to recognize and respond to pathogens (7). Human blood contains a subset of CD11c⁺ DC and a subset of CD11c^– DC, also known as plasmacytoid DC (pDC) (8). CD11c⁺ DC express TLR1, 2, 3, 5, 6, and 8, whereas pDC express TLR7 and 9 (9). In some studies, TLR7 expression was detected on both pDC and myeloid DC (10), whereas others found TLR7 to be expressed exclusively by pDC (9). These DC subsets exhibit different functions. For example, CD11c⁺ blood DC can produce large amounts of IL-12 upon exposure to specific pathogens or activated T cells and drive the differentiation of Th1 cells. pDC, on the other hand, produce large amounts of type I IFN upon exposure to virus and drive the differentiation of Th2 cells (8). However, the Th cell differentiation capacity of human DC subsets seems to depend on the nature of the stimulus (11, 12). In rodents, most knowledge of DC comes from studies of DC isolated from lymphoid organs. Thus, in mice, four DC subsets have been described so far: CD11b⁺CD4⁺CD8^– DC, CD11b^–CD4^–CD8⁺ DC, CD11b⁺CD4^–CD8^– DC, and pDC (13, 14). All splenic DC subsets express TLR1, 2, 4, 6, 8, and 9 mRNA (15). However, CD8⁺CD4^– DC express high TLR3, lack TLR5 and 7 expression and fail to respond to TLR7 ligands, whereas CD8^– DC lack TLR3 (16). The latter study suggests that the TLR repertoire of murine pDC is not as restricted as it is in humans (16), although a recent study suggested a preferential expression of TLR7 and 9 (17). The functions of these subsets in mice also appeared different (reviewed in Ref. 7), with CD8⁺CD4^– DC being the strongest IL-12 producers and Th1 inducers together with having a strong Ag cross-presentation capacity, whereas CD8^–CD4^– or CD4⁺ DC do not produce IL-12 and promote Th2 or Th0 differentiation (18, 19). The capacity of pDC to produce very large amounts of type I IFN has been conserved between mice and humans, although murine but not human pDC have been shown to produce IL-12p40 (20).

We and others have described three subsets of DC in the rat spleen: OX62⁺CD11b⁺CD4⁺SIRP⁺ DC referred to as CD4⁺ DC, OX62⁺CD11b⁺CD4^–SIRP^– DC (CD4^– DC) (21, 22, 23), and OX62^–CD11b^–CD4⁺SIRP⁺ DC that are the rat counterpart of pDC (24). Like human pDC, rat pDC are characterized by a strong and rather restricted expression of TLR7 and 9 and a strong responsiveness to CpG oligonucleotide (ODN), the natural ligands of TLR9 (24). We have additionally shown that CD4^– DC are the main producers of IL-12 and that type I IFN production is restricted to pDC (24, 25). CD4^– DC are also endowed with two specialized functions: a potent cell contact-dependent cytotoxic activity in vitro, mainly toward tumor cells (22) and the capacity to phagocytose apoptotic cells in vitro (26). In the present study, we sought to determine the expression repertoire of major pattern recognition receptors (PRR), including nucleotide-binding oligomerization domain 2 (NOD2), in rat spleen DC subsets using a highly sensitive and quantitative PCR method and to correlate this to the in vitro responsiveness of these subsets to specific PRR ligands. We found that each DC subset expressed a specific TLR repertoire and that their in vitro response to TLR ligands tended to be stereotyped.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Animals

Sprague Dawley (SPD), Lewis, and Brown Norway (BN) rats were obtained from the Centre d’Elevage Janvier and were used when 6–10 wk old. The study has been approved by our Institutional Review Board.

Reagents

The murine CD40L-human CD8 fusion molecule (supernatant of Sf9 insect cells transfected using a recombinant baculovirus) was provided by Prof. Y. Choi (Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA). Polyinosinic-polycytidylic acid (poly(I:C)), monensin, and brefeldin A were obtained from Sigma-Aldrich. The phosphodiester CpG ODN 2006 (tcgtcgttttgtcgttttgtcgtt) was synthesized by Sigma-Genosys. Heat-killed Listeria monocytogenes (HKLM), peptidoglycan (PGN), Flagellin, and R848 were purchased from InvivoGen.

Antibodies

A number of hybridomas were obtained from the European Collection of Cell Culture, and the corresponding mAbs were purified from supernatants in our laboratory with certain being coupled to FITC (Bioatlantic) or to AlexaFluor 488 or AlexaFluor 647 (kits from Invitrogen-Molecular Probes). Alternatively, FITC-conjugated anti-CD3 (clone G4.18), PE-conjugated anti-CD45R (clone HIS24), PerCP-cyanin 5.5-conjugated anti-CD11b (clone WT.5), PE-cyanin 7-conjugated anti-CD4 (clone OX35), allophycocyanin-Cy7-conjugated anti-MHC class II (MHC II) (clone OX6), FITC-conjugated anti-B7-2 (clone 24F), and PE-conjugated anti-B7-1 (clone 3H5) mAbs were purchased from BD Pharmingen. FITC-conjugated anti-IgD (MARD3) was purchased from Technopharm.

Cytofluorometric analysis

Cells were stained as previously described (25) and analyzed using a FACSCalibur or a FACSAria cytofluorometer (BD Biosciences).

Cells

Dendritic cells. Spleens were minced and digested in 2 mg/ml collagenase D (Roche Diagnostics) in RPMI 1640/1% FCS for 15 min at 37°C. EDTA at 10 mM was added for the last 5 min, and the cell suspension was then pipetted up and down several times and filtered. Cells were separated into high-density cells (containing most of the pDC) and low-density cells (containing most of the OX62⁺CD1b⁺ DC) using a 14.5% Nycodenz (Nycomed) gradient centrifugation as described previously (25). CD11b⁺OX62⁺CD4^– and CD11b⁺OX62⁺CD4⁺ subsets of spleen DC were isolated by FACS from low-density spleen cells. Cells were stained with TCR-FITC (clone R7.3), CD45R-FITC (clone HIS24), CD4-PE (clone OX35), and CD103-Alexa 647 (clone OX62) mAbs. OX62^highCD4^– and OX62^lowCD4^high cells were then sorted on a FACSAria (BD Biosciences) after excluding FITC⁺ cells (see Fig. 2A). Purity was routinely >97 and >98%, respectively, for CD4⁺ and CD4^– DC. pDC were isolated from high-density spleen cells after removal of RBC. T and partial B cell depletion was first performed by incubating cells with anti-TCR and mAbs (clones R7.3 and V65, respectively), followed by a mixture of anti-mouse and anti-rat IgG-coated magnetic beads (Dynal Biotech). Cells were then stained with TCR-FITC (clone R7.3), CD45RA-FITC (clone OX33), CD11b/c-FITC (clone OX42), CD45R-PE (clone HIS24), and CD4-AlexaFluor 647 (clone OX35) mAbs, and CD45R⁺ CD4⁺ were sorted on a FACSAria after excluding FITC⁺ cells (see Fig. 2A). Purity was routinely >97.5%.

View larger version (89K): [in this window] [in a new window]   FIGURE 2. Sorting and morphology of splenic DC subsets. A, Cells were separated into high-density cells (containing most of the pDC) and low-density cells (containing most of the OX62+CD11b+ DC). pDC were isolated from high-density spleen cells after removal of RBC. T and partial B cell depletion was first performed by incubating cells with anti-TCR and mAbs. Cells were then stained with TCR-FITC, CD45RA-FITC, CD11b/c-FITC, CD45R-PE, and CD4– AlexaFluor 647 mAbs, and CD45R+CD4+ DC were sorted on a FACSAria after excluding FITC+ cells (left). CD11b+OX62+CD4– and CD11b+OX62+CD4+ subsets of spleen DC were isolated by FACS from low-density spleen cells. Cells were stained with TCR-FITC, CD45R-FITC, CD4-PE, and CD103-Alexa 647 mAbs. OX62highCD4– and OX62lowCD4high cells were then sorted on a FACSAria after excluding FITC+ cells (right). B, Typical morphology of DC subsets from SPD rat as shown by electron microscopy (x5000).

Blood monocytes. PBMC were cultured for 90 min at 3 x 10⁶/ml in petri culture dishes in RPMI 1640 (Sigma-Aldrich) supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 1 mM sodium pyruvate, 1 mM HEPES, 5 x 10^–5 M 2-ME, and 10% FCS (referred to as complete RPMI 1640). Nonadherent cells were removed by extensive washing with prewarmed medium. Adherent monocytes were then directly lysed in TRIzol solution for mRNA extraction.

Mixed leukocyte reaction

A total of 2 x 10⁴ allogeneic DC was cultured with 1 x 10⁵ purified CD4⁺ T cells in round-bottom 96-well plates in a final volume of 200 µl of complete RPMI 1640. After 4 days at 37°C in 5% CO₂, cultures were pulsed for the last 8 h with 0.5 µCi [³H]TdR per well (Amersham Biosciences). The cells were then harvested onto glass fiber filters, and [³H]TdR incorporation was measured using standard scintillation procedures (Packard Instruments).

Cytokine production

Stimulation of isolated DC subsets for cytokine production. Sorted splenic OX62⁺CD4⁺ DC, OX62⁺CD4^– DC, and pDC were stimulated at 1 x 10⁵/ml (2 x 10⁴ cells in 200 µl) in complete RPMI 1640 in 96-well plates. After 24 h, supernatants were collected and stored at –20°C until analysis. Stimuli were used at the following concentrations: HKLM⁵ (10⁸/ml); PGN (10 µg/ml); poly(I:C) (25 µg/ml); LPS (0.5 µg/ml); flagellin (100 ng/ml); R848 (1 µg/ml); and CpG ODN 2006 (10 µM). For cytokine production, including type I IFN, the results are expressed as amount of cytokine for 1 x 10⁵ cells/ml.

IFN- bioassay. A total of 1 x 10⁵ C6 cells (a rat glioma tumor cell line) was cultured overnight in 100 µl of DMEM (Sigma-Aldrich) supplemented with 10% FCS, 2 mM L-glutamine, 100 U/ml penicillin, and 0.1 mg/ml streptomycin in flat-bottom 96-well plates in the presence or absence of a rat IFN- reference standard (R&D Systems) or supernatants. The supernatants were then removed and the cells were infected with vesicular stomatitis virus (provided by Dr. A. Rufffault, Centre Hospitalo-Universitaire Régional Pontchaillou, Rennes, France) in a final volume of 100 µl of complete DMEM for 18 h at 37°C. The wells were then washed with 100 µl of Earle’s balanced salts (Sigma-Aldrich) and incubated with 100 µl of 5% Formalin for 10 min at room temperature, followed by 100 µl of crystal violet solution. Plates were examined visually and reciprocal titers of IFN- (expressed as units per milliliter) were deduced by comparison with the reference standard.

ELISA test. The levels of IL-10 and TNF- in the supernatants were measured using OptEIA set ELISA kits from BD Pharmingen according to the manufacturer’s instructions. Rat IL-12p40 and IL-12p70 were detected using ELISA kits from BioSource International, and IL-6 was measured using an ELISA kit from R&D Systems.

Quantitative RT-PCR

The ODN sequences used in this study are described in Table I and II.

For TLR and hypoxanthine-guanine phosphoribosyltransferase (HPRT) genes, the target sequence was amplified by PCR from a spleen cDNA library, then electrophoresed and purified by phenol-chloroform extraction and ethanol precipitation. Subsequent dilutions of this standard DNA were performed to obtain 10⁷, 10⁶, 10⁵, 10⁴, 10³, and 10² copies/well.

RNA extraction

Total RNA from 3 x 10⁵ to 2 x 10⁶ resting or stimulated spleen cells, OX62⁺CD4^–, OX62⁺CD4⁺ DC, pDC, and blood monocytes were prepared by TRIzol extraction (Invitrogen Life Technologies). Genomic DNA was removed by DNase treatment (Invitrogen Life Technologies), and reverse transcription was performed as described previously (25).

Real-time quantitative PCR

For NOD2, MyD88, TNFR-associated factor 6 (TRAF6), and IL-1R-associated kinase 4 (IRAK4) analyses, real-time quantitative PCR was performed using an Applied Biosystems GeneAmp 7700 Sequence Detection System with SYBR Green PCR Core Reagents (Applied Biosystems). Total cDNA was amplified in 25 µl of PCR mix containing 300 nM of each primer (Table II); 200 µM dATP, dGTP, and dCTP; 400 µM dUTP; 3 mM MgCl₂; 0.25 U of uracil-N-glycosylase; 0.625 U of AmpliTaq Gold DNA polymerase; and 2.5 µl of the 10x SYBR Green buffer. The reaction started with a step of 2 min at 55°C to allow the uracil-N-glycosylase to eliminate putative PCR contaminants, followed by 10 min at 95°C to activate the AmpliTaq Gold DNA polymerase, and then 40 cycles each consisting of 15 s at 95°C and 1 min at 60°C.

For TLR analyses, real-time quantitative PCR was performed using TLR1–10-labeled TaqMan probes (Table I). Target transcripts and standard dilutions were amplified in a 25-µl reaction PCR mix containing 11 µl of diluted cDNA, 12.5 µl of TaqMan Universal 2x PCR Master Mix (Applied Biosystems), including AmpliTaq Gold DNA polymerase, dNTPs with dUTP and optimized buffer components, and 1.25 µl of 20x TaqMan probes and primer (Table I). Before the PCR cycle, samples were submitted to 50°C for 2 min, then at 95°C for 10 min. The step-cycle program was set for denaturing at 95°C for 15 s, and annealing and extension at 60°C for 1 min, for a total of 40 cycles (ABI Prism 7700 sequence detection system; Applied Biosystems).

Analysis

Direct detection of PCR products was monitored by measuring increase in fluorescence. For TLR, the exact number of copies was deduced by comparison of the measured fluorescence with the standard curve. For NOD2, MyD88, TRAF6, and IRAK-4 mRNA, relative expression (AU: arbitrary units) was calculated using the 2^–Ct method as described previously (27).

Statistical analysis

Statistical analyses were performed using the Student’s t test.

	Results

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Definition and frequencies of spleen DC subsets

To determine the frequencies of spleen DC subsets in three different rat strains, we used six-color flow cytometry on collagenase-digested total spleen leukocytes. Cells were stained with CD3-FITC, anti-IgD-FITC, CD45R-PE, CD11b-PerCP-Cy5.5, CD4-PE-Cy7, OX-62-allophycocyanin, and MHC II-allophycocyanin-Cy7 mAbs (Fig. 1A). After gating on CD3^–IgD^–MHC II⁺ cells, spleen cells were separated into CD11b^– and CD11b⁺ populations. Due to the lack of an exclusive and homogeneous marker for rat B cells, the gating on CD3^–IgD^–MHC II⁺ cells was not sufficient to eliminate all B cells. Therefore, MHC II⁺CD11b⁺ cells were further gated on CD45R^– cells to exclude residual B cells (data not shown) and analyzed for the expression of OX62 and CD4. As we have previously shown (22, 25), two DC populations were defined (Fig. 1A): OX62^highCD4^– (gate B, referred to as CD4^– DC) and OX62^lowCD4^high (gate C, referred to as CD4⁺ DC). MHC II⁺CD11b^– cells were OX62^– and contained a population of CD45R⁺CD4^high cells (gate A) that we have previously shown to be the rat counterpart of pDC (24).

View larger version (45K): [in this window] [in a new window]   FIGURE 1. Gating strategy and frequency of splenic DC subsets in different rat strains. A, Gating strategy for the identification of spleen DC subsets. After digestion of spleen leukocytes, cells were stained with CD3-FITC, anti-IgD-FITC, CD45R-PE, CD11b-PerCP-CyR.5, CD4-PE-Cy7, OX62-allophycocyanin, and MHC II-allophycocyanin-Cy7 mAbs. After gating on CD3–IgD–MHC II+ cells (lower left panel), spleen cells were separated into CD11b– and CD11b+ populations (lower middle panel). MHC II+CD11b+ cells were further gated on CD45R– (data not shown) cells and analyzed for the expression of OX62 and CD4 (upper right panel). Two DC populations are found: OX62highCD4– (gate B) and OX62lowCD4+ (gate C). MHC II+CD11b– cells were analyzed for the expression of CD4 and CD45R (lower right panel). pDC were identified as CD45R+CD4high cells (gate A). B, Using this gating strategy, the frequencies of these three DC subsets were determined in different rat strains. Results are expressed as mean ± SD of three animals per strain. See the text for results of statistical analysis.

Morphological features of spleen DC subsets

To sort spleen DC subsets, spleen cells were first separated into low-density cells that contain most of the OX62⁺ DC and high-density cells that contain most of the pDC (24). OX62^highCD4^– and OX62^lowCD4^high DC were then sorted by FACS from low-density cells, whereas CD4^high CD45⁺ cells (pDC) were sorted from high-density cells after selective depletion of T cells, CD11b/c⁺ cells, and most B cells (Fig. 2A). Sorted cells were then analyzed by electron microscopy. As shown in Fig. 2B, the three DC subsets exhibited very different morphological and ultrastructural features. The population of CD4^– DC was the most heterogeneous, with the majority of cells presenting a large and irregular shape with rather a small nucleus and a large cytoplasm containing numerous vesicules in which heterogeneous material was sometimes observed. CD4⁺ DC were a homogeneous population of medium-sized cells, with a high nuclear:cytoplasmic ratio, a regular nucleus with dense chromatin and very few cytoplasmic vesicles. The population of pDC was very homogeneous; these cells exhibited a round shape, an eccentric and irregular nucleus, together with a strongly developed endoplasmic reticulum reminiscent of that observed in plasmocytes.

Expression of TLR and NOD2 mRNA in spleen DC subsets

The expression of TLR1–10 mRNA was assessed in spleen DC subsets from SPD rats using real-time quantitative PCR. All TLR mRNA were detected in all DC subsets and in monocytes, but the levels of expression strongly differed. pDC were characterized by a strong expression of TLR7 and 9, a moderate expression of TLR 2, a low expression of TLR4 and 8, and a very low expression of TLR1, 3, 5, 6, and 10 (Fig. 3). In contrast, OX62⁺ DC expressed a much broader repertoire of TLR. CD4^– DC expressed high levels of TLR1, 2, 3, and 10, moderate levels of TLR4, 5, 6, 7, and 9, and very low, if any, TLR8. CD4⁺ DC expressed all TLR, with high TLR1, 2, 3, and 7 levels and low TLR4, 5, 6, 8, 9, and 10 levels. The pattern of TLR mRNA expression was also assessed in blood adherent monocytes, which expressed high levels of TLR1, 2, 5, 6, 7, and 8, low TLR4 and 9 levels, and very low TLR3 and 10. Because the frequencies of DC subsets appeared strain dependent, we determined whether the repertoire of TLR expression was also influenced by the genetic background. This same global profile of TLR expression was found in Lewis and BN strains, with the exception of TLR7 mRNA that exhibited lower expression in CD4⁺ DC from Lewis and BN than from SPD rats (data not shown).

View larger version (31K): [in this window] [in a new window]   FIGURE 3. TLR expression by splenic DC subsets. The expression of TLR1–10 was assessed in total mRNA prepared from FACS-sorted spleen pDC, CD4+ DC, CD4– DC, and peripheral blood adherent monocytes from SPD rats by real-time quantitative PCR. The results are expressed as a ratio of TLR to HPRT mRNA expression and represent the mean ± SD of three independent experiments for pDC, CD4+ DC, CD4– DC, and monocytes. Very similar profiles were observed with Lewis and BN DC subsets (data not shown). *, p < 0.05; **, p < 0.01; ***, p < 0.001.

View larger version (15K): [in this window] [in a new window]   FIGURE 4. NOD2 expression in splenic DC subsets. NOD2 mRNA levels measured in freshly isolated splenic DC subsets from SPD rats by quantitative RT-PCR as described in Materials and Methods. Results expressed as the mean ± SD of three independent experiments are shown. *, p < 0.05; **, p < 0.01; ***, p < 0.001.

We next analyzed whether the pattern of TLR and NOD2 mRNA expression observed in the different DC subsets correlated with a specific responsiveness to well-defined TLR and NOD2 ligands. We first assessed the effects of these ligands on in vitro DC survival and maturation. pDC and CD4^– DC exhibited an extremely poor spontaneous survival of <10% upon culture in medium alone, contrasting with the 30% spontaneous survival rate of CD4⁺ DC (Fig. 5). pDC survival was greatly enhanced by LPS (TLR4), R848 (TLR7/8), CpG2006 (TLR9), and PGN (NOD2) and was not affected by HKLM (TLR 2/6), poly(I:C) (TLR3), or flagellin (TLR5). CD4^– DC survival was strongly enhanced by ligands of TLR 2/6, 3, 4, and 9 and NOD2, enhanced only modestly by TLR5 ligands, and unaffected by TLR7/8 ligands. The survival of CD4⁺ DC was slightly increased by triggering of all TLR tested but was not significantly influenced by PGN. The data described in Fig. 5 were obtained with SPD DC, but Lewis DC exhibited very similar responses (data not shown).

View larger version (22K): [in this window] [in a new window]   FIGURE 5. In vitro survival of splenic DC subsets. A total of 2 x 104 FACS-sorted DC from SPD rats was cultured in triplicate for 24 h in 200 µl of culture medium in the absence or presence of different TLR ligands (HKLM, poly(I:C), LPS, flagellin, R848, or CpG2006) or PGN. Live cells were counted by FACS after exclusion of dead cells with Topro-3. Similar results were obtained in three independent experiments and with DC from the Lewis strain. *, p < 0.05; **, p < 0.01; ***, p < 0.001, as compared with cells cultured in medium alone (none).

View larger version (42K): [in this window] [in a new window]   FIGURE 6. In vitro maturation of splenic DC subsets. The expression of CD80, CD86, and MHC II was assessed by FACS on freshly sorted cells or on SPD DC cultured for 24 h in the absence or presence of different TLR ligands (HKLM, poly(I:C), LPS, flagellin, R848, or CpG2006) or PGN. Similar results were obtained in three independent experiments and with DC from the Lewis strain. Statistical analysis was performed on mean fluorescence intensity. Asterisks indicate statistical significance (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

View larger version (18K): [in this window] [in a new window]   FIGURE 7. Allogeneic CD4+ T cell proliferation in response to TLR-stimulated splenic DC subsets. Allogeneic (SPD) CD4+ T cells (2 x 104) were cultured for 4 days with 4 x 103 TLR-stimulated pDC (A), CD4+ (B), or CD4– (C) Lewis DC in round-bottom, 96-well plates in the presence of [3H]TdR for the last 8 h. Proliferation was assessed, and results are expressed as the mean counts per minute ± SD of between three and four experiments according to the type of stimulation. Asterisks indicate statistical significance as compared with cells cultures in medium alone (none). *, p < 0.05; **, p < 0.01; ***, p < 0.001.

The production of IL-12p40, IL-10, TNF-, IL-6, and type I IFN was assessed in the supernatant of TLR-stimulated SPD DC (Fig. 8). In agreement with our previous study (25), we found that CD4^– DC produced much higher IL-12p40 than CD4⁺ DC (10- to 20-fold higher). Very low levels of IL-12p40 were sometimes detected in the supernatants of CD4^– DC cultured in medium alone, indicating some degree of activation likely due to the DC purification procedure. TLR9 triggering was the strongest IL-12p40 inducer in CD4^– DC, followed by NOD2 and TLR4. TLR3 and 5 stimulations were poor IL-12p40 inducers, whereas TLR7/8 ligands had no reproducible effect. CD4⁺ DC were found to produce very low amounts of IL-12p40 upon stimulation of TLR2/6, 7/8, and 9. Rat pDC produced large amounts of IL-12p40 upon ligation of TLR 7/8 and 9 exclusively. In our hands, the bioactive form of IL-12 (IL-12p70) was detected only in very low amounts (<100 pg/ml) and reproducibly in the supernatant of TLR9- but not TLR7/8-stimulated CD4^– DC and of TLR7/8- but not TLR9-stimulated pDC (Fig. 9).

View larger version (16K): [in this window] [in a new window]   FIGURE 8. Cytokine production by splenic DC. Splenic DC subsets from SPD rats were sorted by FACS and cultured for 24 h (1 x 105/ml) in the absence or presence of different TLR ligands (HKLM, poly(I:C), LPS, flagellin, R848, or CpG2006) or PGN. The amounts of IL-12p40 (A), IL-10 (B), IL-6 (C), and TNF- (D) were measured by ELISA. Supernatants were collected, and the amounts of type I IFN were assessed by a bioassay (E). Results are expressed as the mean ± SD of three experiments. Very similar results were obtained with DC from Lewis rats. *, p < 0.05; **, p < 0.01; ***, p < 0.001.

View larger version (11K): [in this window] [in a new window]   FIGURE 9. IL-12p70 production by splenic DC. Splenic DC from SPD rats were stimulated as described in Fig. 8, and the amounts of IL-12p70 in the supernatants were measured by ELISA. Results are expressed as the mean ± SD of three experiments.

On a cell basis, there was no strain-dependent differences in the amounts of IL-12p40, IL-6, and TNF- produced by the different DC subsets in response to TLR7/8 and 9 (data not shown). We also assessed whether CD40 triggering could synergize with TLR stimulation in inducing IL-12p40 production in DC subsets. No synergistic effect was observed for pDC, whereas a moderate synergistic effect between CD40L and NOD2 of TLR9, and between CD40L and TLR7/8 or 9 triggering, was observed in the induction of IL-12p40 by CD4⁺ and CD4^– DC, respectively (data not shown). Finally and in agreement with our previous study (25), we could not significantly or reproducibly detect IFN- in the supernatant of any stimulated rat DC subset (data not shown).

Expression of TLR signaling molecules in spleen DC subsets

According to our results, despite expressing the broadest repertoire of PRR among DC subsets, CD4⁺ DC exhibited poor responsiveness to all the PRR ligands tested in this study, at least in vitro. Because this could be related to differential intracellular TLR signaling, we analyzed the expression of MyD88, TRAF6, and IRAK4 mRNA in DC subsets (Fig. 10). In the three stains analyzed (SPD, Lewis, BN), MyD88 and TRAF6 mRNA were strongly expressed in DC, with pDC expressing significantly higher levels than OX62⁺ DC, and the CD4⁺ and CD4^– subsets expressing similar levels. IRAK4 mRNA was expressed at very low levels in pDC and was undetectable in OX62⁺ DC.

View larger version (11K): [in this window] [in a new window]   FIGURE 10. MyD88 (A), TRAF6 (B), and IRAK4 (C) expression in splenic DC subsets. MyD88, TRAF6, and IRAK4 mRNA levels were measured in freshly isolated splenic DC subsets from SPD rats by quantitative RT-PCR as described in Materials and Methods. Results expressed as the mean ± SD of three independent experiments are shown. Similar profiles were observed in DC from Lewis or BN rats. **, p < 0.01.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

In agreement with a recent study performed in the mouse by Asselin-Paturel et al. (30), we found that the frequency of pDC in the spleen was strongly strain dependent. This was also true for the other DC subsets, although to a lesser extent. Thus, Lewis rats have 3- to 4-fold more pDC than the other strains tested, and BN rats have the highest numbers of CD4⁺ DC. The fact that DC subsets could influence Th1 or Th2 responses (5) makes the difference between the Lewis and BN strains especially relevant. Indeed, Lewis rats are known to be prone to several Th1-mediated autoimmune diseases while being resistant to those mediated by Th2, whereas BN rats behave oppositely (31). Moreover, we showed that CD4⁺ DC were the only DC subset to promote IL-13-producing CD4⁺ T cells (25) and that mature pDC drive Th1 differentiation (24). Whether the difference in DC subset numbers between strains is genetically determined or rather T cell dependent remains to be investigated. A study by Liu et al. (32) suggested differences in TLR expression between BALB/c and C57BL/6 DC. Although the levels of TLR and NOD2 mRNA expression also differed between rat strains (data not shown), the profile of each DC subset was similar in all strains. The fact that we detected all TLR mRNA in all DC is due to the high sensitivity of our PCR technique. We confirmed that rat pDC have a restricted TLR repertoire with high levels of TLR7 and 9 (24), a pattern that is conserved in human (9), as well as murine pDC (17, 33). The expression of other TLR in murine pDC is not as clear, probably because of different sensitivities in the PCR method used and different purity and tissue origin of the pDC studied. In a previous study, we found pDC to additionally express low levels of TLR1 and 6 mRNA rather than TLR2 as found in the present study. This is likely due to a technical change (TaqMan probes in this study vs SYBR Green in our previous study). TLR4 was not found in human pDC, whereas its expression in mouse was detected in thymic (33) but not in spleen pDC (17). We found very low levels of TLR4 mRNA in rat spleen pDC, which correlated with a partial response to LPS in vitro (survival). Another difference between human and rodent DC concerns TLR9, which is restricted to pDC in human blood, but which is expressed in all spleen DC subsets in mice (16, 17) and in rats, as shown in this study. However, it is difficult to draw conclusions before TLR9 expression in lymphoid organ-derived DC has been assessed in humans. In fact, a recent study has shown strong TLR9 gene expression in BDCA3⁺ tonsillar DC (34). Like human CD11c⁺ DC, OX62⁺ rat DC expressed a much broader TLR repertoire than pDC. The main feature of CD4^– DC, as compared with other subsets, was a high expression of TLR3 and 10, a very low expression of TLR7 and a barely detectable TLR8. Finally, CD4⁺ DC expressed all TLR together with high levels of NOD2.

The repertoire of PRR expressed by CD4^– and pDC correlated with their responsiveness to specific ligands and that these two subsets responded in quite a stereotyped fashion. pDC responded specifically to TLR7/8 and TLR9 stimulation by surviving, maturing, and producing high amounts of IL-12p40, IL-6, and TNF- but not IL-10, whereas CD4^– DC responded to TLR2/6, 3, 4, 5, and 9 by surviving, maturing, and producing high IL-12p40, low IL-10, very low TNF-, and no IL-6. Both pDC and CD4^– DC produced, however, very low amounts of the bioactive IL-12p70, suggesting that, at least in these in vitro stimulation conditions, the p40 chain was produced in very large excess. Whether an additional signal such as IFN- or IL-4 priming (35) might be necessary for optimal IL-12p70 production in rat DC is currently under investigation. We previously demonstrated that the stimulation of pDC, but not other DC subsets, with influenza virus induced an alternate response characterized by high type I IFN but very low IL-12, IL-6, and TNF- production and poor survival (24). In this previous study, we also found pDC to be poor producers of TNF-. In fact, we were using the murine-specific CpG ODN 1668 instead of the human CpG ODN 2006 that is more efficient for inducing TNF-, as well as IL-12 in rat DC, and, moreover, the effect of R848 was not assessed in our first study of rat pDC. pDC were actually the strongest producers of not only TNF- but also IL-6 that was secreted in extremely high amounts. The fact that the production of IL-6 was restricted to pDC in the rat is surprising because this is not the case in humans (9) or in mice (36). A recent study indicated that pDC-produced IL-6 played a role in B cell differentiation and Ig production (37). Production of IL-6 by conventional DC in response to TLR ligation during infection could in addition be critical for T cell activation by allowing pathogen-specific T cells to overcome the suppressive effect of CD4⁺CD25⁺ T cells (38).

In contrast to other DC subsets and despite being equipped with the broadest repertoire of PRR, at least at the mRNA level, CD4⁺ DC exhibited poor responsiveness to TLR and NOD2 ligands. The expression of costimulatory molecules on CD4⁺ DC was only marginally affected by TLR ligation, suggesting that the effect of mechanical or chemical stresses induced during the purification procedure was dominant over TLR signaling. Their cytokine profile was characterized by low IL-12p40 and moderate IL-10 production in response to TLR2/5, 7/8, and 9. It is possible that their full activation requires synergistic signals from different TLR (39, 40). CD4⁺ DC were found to stimulate CD4⁺ and CD8⁺ T cells very efficiently and were shown to induce Th1 cells in vitro, probably using an IL-12 independent pathway, together with low numbers of IFN-⁺IL-13-producing Th cells (25). In the steady-state spleen, these DC that coexpress high levels of CD4 and SIRP- molecules were found to form a ring around the T cell area (41). Upon i.v. LPS injection, CD172a⁺ DC relocated to the T cell area and exhibited an increase in costimulatory molecule expression. Whether the effect of LPS on CD4⁺CD172a⁺ rat DC in vivo is direct or not is unknown. Interestingly, subsets of CD4⁺CD172^high and CD4^–CD172^low DC were also identified in afferent lymph and mesenteric lymph nodes by others (21). It is tempting to speculate that these subsets are related to the spleen CD4⁺ and CD4^– DC we described here, however, although splenic DC are blood-derived cells, and DC circulating in lymph are tissue derived. Recent reports suggest the unifying hypothesis that most if not all lymphoid organ DC are monocyte-derived (42, 43). In addition, a recent report has shown, in the rat, that a CD43^high subset of circulating monocyte could differentiate in intestinal lymph CD4⁺CD172^high and CD4^–CD172^low DC in the absence of inflammatory stimuli (44).

Although rat DC do not express CD8, as do mice DC, the recent description of a CD4⁺ subset of DC in mice (45) makes the comparison between mouse and rat DC much easier. CD4⁺ rat DC resemble mouse CD4⁺CD8^– DC; both are found in the marginal zone, express all TLR, are poor producers of inflammatory cytokines, but are potent stimulators of allogeneic T cells. Rat CD4^– DC share many common features with mouse CD4^–CD8⁺ DC; both are found in T cell areas and red pulp, express high TLR3 and very low (rat) or no (mouse) TLR7 (16), are the main producers of IL-12, potent stimulators of CD4⁺ but not CD8⁺ T cells (25, 46), and are Th1 inducers (18, 25). Recently, we showed that, unlike CD4⁺ or pDC, CD4^– DC are very efficient at phagocytosing apoptotic cells (26), a property shared by CD4^–CD8⁺ DC in the mouse (47). Both rat CD4^– (48, 49) and mouse CD8⁺ (50) DC subsets have been suggested to play a role in self-tolerance. However, their potent phagocytic activity, their rather large TLR repertoire, and their capacity to produce high IL-12 also suggest a role in immune responses to intracellular pathogens.

To conclude, together with recent data obtained in humans and in mice (45), our results suggest that the specialization in pathogen recognition capacity and immune functions of DC subsets is relatively conserved between species. Our results indicate that the differential expression of PRR in DC subsets is not limited to TLR but is also true for NOD2. Finally, the rather stereotyped response of each splenic DC subset suggests that their intrinsic plasticity is limited.

	Acknowledgments

 
We thank Paul Pilet for expert electronic microscopy.

	Disclosures

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The authors have no financial conflict of interest.

	Footnotes

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ This work was supported by INSERM, the Progreffe Foundation, and by a grant from the "Association pour la Recherche sur le Cancer" (ARC 5901) (to R.J.). F.-X.H. was supported by INSERM and the "Région des Pays de la Loire" and C.V. by "La Ligue Nationale Contre le Cancer." The high-speed cell sorter used in this study was purchased using a gift from the Caisse Régionale de Crédit Agricole Mutuel Atlantique Vendée.

² Current address: Division of Parasitology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, U.K.

³ Current address: Diabetes Center, 513 Parnassus Avenue, HSW 1102, Box 0540, San Francisco, CA 94143.

⁴ Address correspondence and reprint requests to Dr. Régis Josien, INSERM U643, ITERT, CHU Hotel Dieu, 30 boulevard Jean Monnet, 44093 Nantes Cedex 1, France. E-mail address: Regis.Josien{at}univ-nantes.fr

⁵ Abbreviations used in this paper: DC, dendritic cell; BN, Brown Norway; HKLM, heat-killed Listeria monocytogene; HPRT, hypoxanthine-guanine phosphoribosyltransferase; IRAK4, IL-1R-associated kinase 4; MHC II, MHC class II; NOD2, nucleotide-binding oligomerization domain 2; ODN, oligonucleotide; pDC, plasmacytoid DC; PGN, peptidoglycan; poly(I:C), polyinosinic-polycytidylic acid; PRR, pattern recognition receptor; SPD, Sprague Dawley; TRAF6, TNFR-associated factor 6.

Received for publication February 3, 2006. Accepted for publication April 28, 2006.

	References

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 

1. Janeway, C. A., Jr, R. Medzhitov. 2002. Innate immune recognition. Annu. Rev. Immunol. 20: 197-216. [Medline]
2. Akira, S., K. Takeda, T. Kaisho. 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2: 675-680. [Medline]
3. Banchereau, J., R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392: 245-252. [Medline]
4. Schnare, M., G. M. Barton, A. C. Holt, K. Takeda, S. Akira, R. Medzhitov. 2001. Toll-like receptors control activation of adaptive immune responses. Nat. Immunol. 2: 947-950. [Medline]
5. Pulendran, B.. 2004. Modulating Th1/Th2 responses with microbes, dendritic cells, and pathogen recognition receptors. Immunol. Res. 29: 187-196. [Medline]
6. Banchereau, J., F. Briere, C. Caux, J. Davoust, S. Lebecque, Y. J. Liu, B. Pulendran, K. Palucka. 2000. Immunobiology of dendritic cells. Annu. Rev. Immunol. 18: 767-811. [Medline]
7. Pulendran, B.. 2004. Modulating vaccine responses with dendritic cells and Toll-like receptors. Immunol. Rev. 199: 227-250. [Medline]
8. Rissoan, M. C., V. Soumelis, N. Kadowaki, G. Grouard, F. Briere, R. de Waal Malefyt, Y. J. Liu. 1999. Reciprocal control of T helper cell and dendritic cell differentiation. Science 283: 1183-1186. [Abstract/Free Full Text]
9. Kadowaki, N., S. Ho, S. Antonenko, R. W. Malefyt, R. A. Kastelein, F. Bazan, Y. J. Liu. 2001. Subsets of human dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens. J. Exp. Med. 194: 863-869. [Abstract/Free Full Text]
10. Ito, T., R. Amakawa, T. Kaisho, H. Hemmi, K. Tajima, K. Uehira, Y. Ozaki, H. Tomizawa, S. Akira, S. Fukuhara. 2002. Interferon and interleukin-12 are induced differentially by Toll-like receptor 7 ligands in human blood dendritic cell subsets. J. Exp. Med. 195: 1507-1512. [Abstract/Free Full Text]
11. Kalinski, P., C. M. Hilkens, E. A. Wierenga, M. L. Kapsenberg. 1999. T cell priming by type-1 and type-2 polarized dendritic cells: the concept of a third signal. Immunol. Today 20: 561-567. [Medline]
12. Kadowaki, N., S. Antonenko, J. Y. Lau, Y. J. Liu. 2000. Natural interferon /-producing cells link innate and adaptive immunity. J. Exp. Med. 192: 219-226. [Abstract/Free Full Text]
13. Vremec, D., J. Pooley, H. Hochrein, L. Wu, K. Shortman. 2000. CD4 and CD8 expression by dendritic cell subtypes in mouse thymus and spleen. J. Immunol. 164: 2978-2986. [Abstract/Free Full Text]
14. Asselin-Paturel, C., A. Boonstra, M. Dalod, I. Durand, N. Yessaad, C. Dezutter-Dambuyant, A. Vicari, A. O’Garra, C. Biron, F. Briere, G. Trinchieri. 2001. Mouse type I IFN-producing cells are immature APCs with plasmacytoid morphology. Nat. Immunol. 2: 1144-1150. [Medline]
15. Reis e Sousa, C., S. D. Diebold, A. D. Edwards, N. Rogers, O. Schulz, R. Sporri. 2003. Regulation of dendritic cell function by microbial stimuli. Pathol. Biol. 51: 67-68. [Medline]
16. Edwards, A. D., S. S. Diebold, E. M. C. Slack, H. Tomizawa, H. Hemmi, T. Kaisho, S. Akira, C. Reis e Sousa. 2003. Toll-like receptor expression in murine DC subsets: lack of TLR7 expression by CD8a⁺ DC correlates with unresponsiveness to imidazoquinolines. Eur. J. Immunol. 33: 827-833. [Medline]
17. Naik, S. H., A. I. Proietto, N. S. Wilson, A. Dakic, P. Schnorrer, M. Fuchsberger, M. H. Lahoud, M. O’Keeffe, Q. X. Shao, W. F. Chen, et al 2005. Cutting edge: generation of splenic CD8⁺ and CD8^– dendritic cell equivalents in Fms-like tyrosine kinase 3 ligand bone marrow cultures. J. Immunol. 174: 6592-6597. [Abstract/Free Full Text]
18. Maldonado-Lopez, R., T. De Smedt, P. Michel, J. Godfroid, B. Pajak, C. Heirman, K. Thielemans, O. Leo, J. Urbain, M. Moser. 1999. CD8⁺ and CD8^– subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J. Exp. Med. 189: 587-592. [Abstract/Free Full Text]
19. Pulendran, B., J. L. Smith, G. Caspary, K. Brasel, D. Pettit, E. Maraskovsky, C. R. Maliszewski. 1999. Distinct dendritic cell subsets differentially regulate the class of immune response in vivo. Proc. Natl. Acad. Sci. USA 96: 1036-1041. [Abstract/Free Full Text]
20. Liu, Y. J.. 2005. IPC: professional type 1 interferon-producing cells and plasmacytoid dendritic cell precursors. Annu. Rev. Immunol. 23: 275-306. [Medline]
21. Liu, L., M. Zhang, C. Jenkins, G. G. MacPherson. 1998. Dendritic cell heterogeneity in vivo: two functionally different dendritic cell populations in rat intestinal lymph can be distinguished by CD4 expression. J. Immunol. 161: 1146-1155. [Abstract/Free Full Text]
22. Trinite, B., C. Voisine, H. Yagita, R. Josien. 2000. A subset of cytolytic dendritic cells in rat. J. Immunol. 165: 4202-4208. [Abstract/Free Full Text]
23. Turnbull, E., G. MacPherson. 2001. Immunobiology of dendritic cells in the rat. Immunol. Rev. 184: 58-68. [Medline]
24. Hubert, F. X., C. Voisine, C. Louvet, M. Heslan, R. Josien. 2004. Rat plasmacytoid dendritic cells are an abundant subset of MHC class II⁺CD4⁺CD11b^–OX62^– and type I IFN-producing cells that exhibit selective expression of Toll-like receptors 7 and 9 and strong responsiveness to CpG. J. Immunol. 172: 7485-7494. [Abstract/Free Full Text]
25. Voisine, C., F. X. Hubert, B. Trinite, M. Heslan, R. Josien. 2002. Two phenotypically distinct subsets of spleen dendritic cells in rats exhibit different cytokine production and T cell stimulatory activity. J. Immunol. 169: 2284-2291. [Abstract/Free Full Text]
26. Trinite, B., C. Chauvin, H. Peche, C. Voisine, M. Heslan, R. Josien. 2005. Immature CD4^–CD103⁺ rat dendritic cells induce rapid caspase-independent apoptosis-like cell death in various tumor and nontumor cells and phagocytose their victims. J. Immunol. 175: 2408-2417. [Abstract/Free Full Text]
27. Guillonneau, C., C. Louvet, K. Renaudin, J. M. Heslan, M. Heslan, L. Tesson, C. Vignes, C. Guillot, Y. Choi, L. A. Turka, et al 2004. The role of TNF-related activation-induced cytokine-receptor activating NF-B interaction in acute allograft rejection and CD40L-independent chronic allograft rejection. J. Immunol. 172: 1619-1629. [Abstract/Free Full Text]
28. Girardin, S. E., I. G. Boneca, J. Viala, M. Chamaillard, A. Labigne, G. Thomas, D. J. Philpott, P. J. Sansonetti. 2003. Nod2 is a general sensor of peptidoglycan through muramyl dipeptide (MDP) detection. J. Biol. Chem. 278: 8869-8872. [Abstract/Free Full Text]
29. Travassos, L. H., S. E. Girardin, D. J. Philpott, D. Blanot, M. A. Nahori, C. Werts, I. G. Boneca. 2004. Toll-like receptor 2-dependent bacterial sensing does not occur via peptidoglycan recognition. EMBO Rep. 5: 1000-1006. [Medline]
30. Asselin-Paturel, C., G. Brizard, J. J. Pin, F. Briere, G. Trinchieri. 2003. Mouse strain differences in plasmacytoid dendritic cell frequency and function revealed by a novel monoclonal antibody. J. Immunol. 171: 6466-6477. [Abstract/Free Full Text]
31. Fournie, G. J., B. Cautain, E. Xystrakis, J. Damoiseaux, M. Mas, D. Lagrange, I. Bernard, J. F. Subra, L. Pelletier, P. Druet, A. Saoudi. 2001. Cellular and genetic factors involved in the difference between Brown Norway and Lewis rats to develop respectively type-2 and type-1 immune-mediated diseases. Immunol. Rev. 184: 145-160. [Medline]
32. Liu, T., T. Matsuguchi, N. Tsuboi, T. Yajima, Y. Yoshikai. 2002. Differences in expression of Toll-like receptors and their reactivities in dendritic cells in BALB/c and C57BL/6 mice. Infect. Immun. 70: 6638-6645. [Abstract/Free Full Text]
33. Okada, T., Z. X. Lian, M. Naiki, A. A. Ansari, S. Ikehara, M. E. Gershwin. 2003. Murine thymic plasmacytoid dendritic cells. Eur. J. Immunol. 33: 1012-1019. [Medline]
34. Lindstedt, M., K. Lundberg, C. A. Borrebaeck. 2005. Gene family clustering identifies functionally associated subsets of human in vivo blood and tonsillar dendritic cells. J. Immunol. 175: 4839-4846. [Abstract/Free Full Text]
35. Trinchieri, G.. 2003. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat. Rev. Immunol. 3: 133-146. [Medline]
36. Sato, A., M. Hashiguchi, E. Toda, A. Iwasaki, S. Hachimura, S. Kaminogawa. 2003. CD11b⁺ Peyer’s patch dendritic cells secrete IL-6 and induce IgA secretion from naive B cells. J. Immunol. 171: 3684-3690. [Abstract/Free Full Text]
37. Jego, G., A. K. Palucka, J. P. Blanck, C. Chalouni, V. Pascual, J. Banchereau. 2003. Plasmacytoid dendritic cells induce plasma cell differentiation through type I interferon and interleukin 6. Immunity 19: 225-234. [Medline]
38. Pasare, C., R. Medzhitov. 2003. Toll pathway-dependent blockade of CD4⁺CD25⁺ T cell-mediated suppression by dendritic cells. Science 299: 1033-1036. [Abstract/Free Full Text]
39. Gautier, G., M. Humbert, F. Deauvieau, M. Scuiller, J. Hiscott, E. E. Bates, G. Trinchieri, C. Caux, P. Garrone. 2005. A type I interferon autocrine-paracrine loop is involved in Toll-like receptor-induced interleukin-12p70 secretion by dendritic cells. J. Exp. Med. 201: 1435-1446. [Abstract/Free Full Text]
40. Napolitani, G., A. Rinaldi, F. Bertoni, F. Sallusto, A. Lanzavecchia. 2005. Selected Toll-like receptor agonist combinations synergistically trigger a T helper type 1-polarizing program in dendritic cells. Nat. Immunol. 6: 769-776. [Medline]
41. Turnbull, E. L., U. Yrlid, C. D. Jenkins, G. G. Macpherson. 2005. Intestinal dendritic cell subsets: differential effects of systemic TLR4 stimulation on migratory fate and activation in vivo. J. Immunol. 174: 1374-1384. [Abstract/Free Full Text]
42. Geissmann, F., S. Jung, D. R. Littman. 2003. Blood monocytes consist of two principal subsets with distinct migratory properties. Immunity 19: 71-82. [Medline]
43. Leon, B., G. Martinez del Hoyo, V. Parrillas, H. H. Vargas, P. Sanchez-Mateos, N. Longo, M. Lopez-Bravo, C. Ardavin. 2004. Dendritic cell differentiation potential of mouse monocytes: monocytes represent immediate precursors of CD8^– and CD8⁺ splenic dendritic cells. Blood 103: 2668-2676. [Abstract/Free Full Text]
44. Yrlid, U., C. D. Jenkins, G. G. Macpherson. 2006. Relationships between distinct blood monocyte subsets and migrating intestinal lymph dendritic cells in vivo under steady-state conditions. J. Immunol. 176: 4155-4162. [Abstract/Free Full Text]
45. Shortman, K., Y. J. Liu. 2002. Mouse and human dendritic cell subtypes. Nat. Rev. Immunol. 2: 151-161. [Medline]
46. Kronin, V., K. Winkel, G. Suss, A. Kelso, W. Heath, J. Kirberg, H. von Boehmer, K. Shortman. 1996. A subclass of dendritic cells regulates the response of naive CD8 T cells by limiting their IL-2 production. J. Immunol. 157: 3819-3827. [Abstract]
47. Iyoda, T., S. Shimoyama, K. Liu, Y. Omatsu, Y. Akiyama, Y. Maeda, K. Takahara, R. M. Steinman, K. Inaba. 2002. The CD8⁺ dendritic cell subset selectively endocytoses dying cells in culture and in vivo. J. Exp. Med. 195: 1289-1302. [Abstract/Free Full Text]
48. Huang, F. P., N. Platt, M. Wykes, J. R. Major, T. J. Powell, C. D. Jenkins, G. G. MacPherson. 2000. A discrete subpopulation of dendritic cells transports apoptotic intestinal epithelial cells to T cell areas of mesenteric lymph nodes. J. Exp. Med. 191: 435-444. [Abstract/Free Full Text]
49. Steinman, R. M., S. Turley, I. Mellman, K. Inaba. 2000. The induction of tolerance by dendritic cells that have captured apoptotic cells. J. Exp. Med. 191: 411-416. [Free Full Text]
50. Heath, W. R., F. R. Carbone. 2001. Cross-presentation, dendritic cells, tolerance and immunity. Annu. Rev. Immunol. 19: 47-64. [Medline]

Related articles in The JI:

IN THIS ISSUE

The JI 2006 177: 767-768. [Full Text]  

This article has been cited by other articles:

				V. Cerovic, C. D. Jenkins, A. G. C. Barnes, S. W. F. Milling, G. G. MacPherson, and L. S. Klavinskis Hyporesponsiveness of Intestinal Dendritic Cells to TLR Stimulation Is Limited to TLR4 J. Immunol., February 15, 2009; 182(4): 2405 - 2415. [Abstract] [Full Text] [PDF]

				C. Chauvin, J.-M. Philippeau, C. Hemont, F.-X. Hubert, Y. Wittrant, F. Lamoureux, B. Trinite, D. Heymann, F. Redini, and R. Josien Killer Dendritic Cells Link Innate and Adaptive Immunity against Established Osteosarcoma in Rats Cancer Res., November 15, 2008; 68(22): 9433 - 9440. [Abstract] [Full Text] [PDF]

				K. Naito, T. Anzai, Y. Sugano, Y. Maekawa, T. Kohno, T. Yoshikawa, K. Matsuno, and S. Ogawa Differential Effects of GM-CSF and G-CSF on Infiltration of Dendritic Cells during Early Left Ventricular Remodeling after Myocardial Infarction J. Immunol., October 15, 2008; 181(8): 5691 - 5701. [Abstract] [Full Text] [PDF]

				C. Chauvin and R. Josien Dendritic Cells as Killers: Mechanistic Aspects and Potential Roles J. Immunol., July 1, 2008; 181(1): 11 - 16. [Abstract] [Full Text] [PDF]

				A. Ouabed, F.-X. Hubert, D. Chabannes, L. Gautreau, M. Heslan, and R. Josien Differential Control of T Regulatory Cell Proliferation and Suppressive Activity by Mature Plasmacytoid versus Conventional Spleen Dendritic Cells J. Immunol., May 1, 2008; 180(9): 5862 - 5870. [Abstract] [Full Text] [PDF]

				A. Forsbach, J.-G. Nemorin, C. Montino, C. Muller, U. Samulowitz, A. P. Vicari, M. Jurk, G. K. Mutwiri, A. M. Krieg, G. B. Lipford, et al. Identification of RNA Sequence Motifs Stimulating Sequence-Specific TLR8-Dependent Immune Responses J. Immunol., March 15, 2008; 180(6): 3729 - 3738. [Abstract] [Full Text] [PDF]

				T. Baba, S. Iwasaki, T. Maruoka, A. Suzuki, U. Tomaru, H. Ikeda, T. Yoshiki, M. Kasahara, and A. Ishizu Rat CD4+CD8+ Macrophages Kill Tumor Cells through an NKG2D- and Granzyme/Perforin-Dependent Mechanism J. Immunol., March 1, 2008; 180(5): 2999 - 3006. [Abstract] [Full Text] [PDF]

				L. Peyrin-Biroulet and M. Chamaillard Invited review: NOD2 and defensins: translating innate to adaptive immunity in Crohn's disease Innate Immunity, June 1, 2007; 13(3): 135 - 139. [Abstract] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Related articles in The JI Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hubert, F.-X. Articles by Josien, R. Search for Related Content PubMed PubMed Citation Articles by Hubert, F.-X. Articles by Josien, R. Pubmed/NCBI databases Gene GEO Profiles HomoloGene Protein UniGene Compound via MeSH Substance via MeSH