|
|
||||||||
Institut National de la Santé et de la Recherche Médicale (INSERM) Unité 643, Centre Hospitalo-Universitaire Nantes, Hotel Dieu, Institut de Transplantation et de Recherche en Transplantation (ITERT), and Université de Nantes, Unité de Formation et de Recherche de Médecine, Nantes, France
| Abstract |
|---|
|
|
|---|
. TLR7/8 and 9 triggering induced pDC to mature and produce copious amounts of IL-6, IL-12p40, and TNF-
and low IFN-
. CD4+ DC were very poor producers of inflammatory cytokines. This study suggests that the nature of spleen DC responses to pathogens is dependent on subset specific-stimulation rather than intrinsic plasticity. | Introduction |
|---|
|
|
|---|
Studies of DC subsets isolated from humans and mice have revealed that TLR have distinct expression patterns, indicating that DC subsets have different intrinsic capabilities to recognize and respond to pathogens (7). Human blood contains a subset of CD11c+ DC and a subset of CD11c DC, also known as plasmacytoid DC (pDC) (8). CD11c+ DC express TLR1, 2, 3, 5, 6, and 8, whereas pDC express TLR7 and 9 (9). In some studies, TLR7 expression was detected on both pDC and myeloid DC (10), whereas others found TLR7 to be expressed exclusively by pDC (9). These DC subsets exhibit different functions. For example, CD11c+ blood DC can produce large amounts of IL-12 upon exposure to specific pathogens or activated T cells and drive the differentiation of Th1 cells. pDC, on the other hand, produce large amounts of type I IFN upon exposure to virus and drive the differentiation of Th2 cells (8). However, the Th cell differentiation capacity of human DC subsets seems to depend on the nature of the stimulus (11, 12). In rodents, most knowledge of DC comes from studies of DC isolated from lymphoid organs. Thus, in mice, four DC subsets have been described so far: CD11b+CD4+CD8 DC, CD11bCD4CD8+ DC, CD11b+CD4CD8 DC, and pDC (13, 14). All splenic DC subsets express TLR1, 2, 4, 6, 8, and 9 mRNA (15). However, CD8+CD4 DC express high TLR3, lack TLR5 and 7 expression and fail to respond to TLR7 ligands, whereas CD8 DC lack TLR3 (16). The latter study suggests that the TLR repertoire of murine pDC is not as restricted as it is in humans (16), although a recent study suggested a preferential expression of TLR7 and 9 (17). The functions of these subsets in mice also appeared different (reviewed in Ref. 7), with CD8+CD4 DC being the strongest IL-12 producers and Th1 inducers together with having a strong Ag cross-presentation capacity, whereas CD8CD4 or CD4+ DC do not produce IL-12 and promote Th2 or Th0 differentiation (18, 19). The capacity of pDC to produce very large amounts of type I IFN has been conserved between mice and humans, although murine but not human pDC have been shown to produce IL-12p40 (20).
We and others have described three subsets of DC in the rat spleen: OX62+CD11b+CD4+SIRP
+ DC referred to as CD4+ DC, OX62+CD11b+CD4SIRP
DC (CD4 DC) (21, 22, 23), and OX62CD11bCD4+SIRP
+ DC that are the rat counterpart of pDC (24). Like human pDC, rat pDC are characterized by a strong and rather restricted expression of TLR7 and 9 and a strong responsiveness to CpG oligonucleotide (ODN), the natural ligands of TLR9 (24). We have additionally shown that CD4 DC are the main producers of IL-12 and that type I IFN production is restricted to pDC (24, 25). CD4 DC are also endowed with two specialized functions: a potent cell contact-dependent cytotoxic activity in vitro, mainly toward tumor cells (22) and the capacity to phagocytose apoptotic cells in vitro (26). In the present study, we sought to determine the expression repertoire of major pattern recognition receptors (PRR), including nucleotide-binding oligomerization domain 2 (NOD2), in rat spleen DC subsets using a highly sensitive and quantitative PCR method and to correlate this to the in vitro responsiveness of these subsets to specific PRR ligands. We found that each DC subset expressed a specific TLR repertoire and that their in vitro response to TLR ligands tended to be stereotyped.
| Materials and Methods |
|---|
|
|
|---|
Sprague Dawley (SPD), Lewis, and Brown Norway (BN) rats were obtained from the Centre dElevage Janvier and were used when 610 wk old. The study has been approved by our Institutional Review Board.
Reagents
The murine CD40L-human CD8 fusion molecule (supernatant of Sf9 insect cells transfected using a recombinant baculovirus) was provided by Prof. Y. Choi (Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA). Polyinosinic-polycytidylic acid (poly(I:C)), monensin, and brefeldin A were obtained from Sigma-Aldrich. The phosphodiester CpG ODN 2006 (tcgtcgttttgtcgttttgtcgtt) was synthesized by Sigma-Genosys. Heat-killed Listeria monocytogenes (HKLM), peptidoglycan (PGN), Flagellin, and R848 were purchased from InvivoGen.
Antibodies
A number of hybridomas were obtained from the European Collection of Cell Culture, and the corresponding mAbs were purified from supernatants in our laboratory with certain being coupled to FITC (Bioatlantic) or to AlexaFluor 488 or AlexaFluor 647 (kits from Invitrogen-Molecular Probes). Alternatively, FITC-conjugated anti-CD3 (clone G4.18), PE-conjugated anti-CD45R (clone HIS24), PerCP-cyanin 5.5-conjugated anti-CD11b (clone WT.5), PE-cyanin 7-conjugated anti-CD4 (clone OX35), allophycocyanin-Cy7-conjugated anti-MHC class II (MHC II) (clone OX6), FITC-conjugated anti-B7-2 (clone 24F), and PE-conjugated anti-B7-1 (clone 3H5) mAbs were purchased from BD Pharmingen. FITC-conjugated anti-IgD (MARD3) was purchased from Technopharm.
Cytofluorometric analysis
Cells were stained as previously described (25) and analyzed using a FACSCalibur or a FACSAria cytofluorometer (BD Biosciences).
Cells
Dendritic cells.
Spleens were minced and digested in 2 mg/ml collagenase D (Roche Diagnostics) in RPMI 1640/1% FCS for 15 min at 37°C. EDTA at 10 mM was added for the last 5 min, and the cell suspension was then pipetted up and down several times and filtered. Cells were separated into high-density cells (containing most of the pDC) and low-density cells (containing most of the OX62+CD1b+ DC) using a 14.5% Nycodenz (Nycomed) gradient centrifugation as described previously (25). CD11b+OX62+CD4 and CD11b+OX62+CD4+ subsets of spleen DC were isolated by FACS from low-density spleen cells. Cells were stained with TCR
-FITC (clone R7.3), CD45R-FITC (clone HIS24), CD4-PE (clone OX35), and CD103-Alexa 647 (clone OX62) mAbs. OX62highCD4 and OX62lowCD4high cells were then sorted on a FACSAria (BD Biosciences) after excluding FITC+ cells (see Fig. 2A). Purity was routinely >97 and >98%, respectively, for CD4+ and CD4 DC. pDC were isolated from high-density spleen cells after removal of RBC. T and partial B cell depletion was first performed by incubating cells with anti-TCR
and 
mAbs (clones R7.3 and V65, respectively), followed by a mixture of anti-mouse and anti-rat IgG-coated magnetic beads (Dynal Biotech). Cells were then stained with TCR
-FITC (clone R7.3), CD45RA-FITC (clone OX33), CD11b/c-FITC (clone OX42), CD45R-PE (clone HIS24), and CD4-AlexaFluor 647 (clone OX35) mAbs, and CD45R+ CD4+ were sorted on a FACSAria after excluding FITC+ cells (see Fig. 2A). Purity was routinely >97.5%.
|
98%. Blood monocytes. PBMC were cultured for 90 min at 3 x 106/ml in petri culture dishes in RPMI 1640 (Sigma-Aldrich) supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 1 mM sodium pyruvate, 1 mM HEPES, 5 x 105 M 2-ME, and 10% FCS (referred to as complete RPMI 1640). Nonadherent cells were removed by extensive washing with prewarmed medium. Adherent monocytes were then directly lysed in TRIzol solution for mRNA extraction.
Mixed leukocyte reaction
A total of 2 x 104 allogeneic DC was cultured with 1 x 105 purified CD4+ T cells in round-bottom 96-well plates in a final volume of 200 µl of complete RPMI 1640. After 4 days at 37°C in 5% CO2, cultures were pulsed for the last 8 h with 0.5 µCi [3H]TdR per well (Amersham Biosciences). The cells were then harvested onto glass fiber filters, and [3H]TdR incorporation was measured using standard scintillation procedures (Packard Instruments).
Cytokine production
Stimulation of isolated DC subsets for cytokine production. Sorted splenic OX62+CD4+ DC, OX62+CD4 DC, and pDC were stimulated at 1 x 105/ml (2 x 104 cells in 200 µl) in complete RPMI 1640 in 96-well plates. After 24 h, supernatants were collected and stored at 20°C until analysis. Stimuli were used at the following concentrations: HKLM5 (108/ml); PGN (10 µg/ml); poly(I:C) (25 µg/ml); LPS (0.5 µg/ml); flagellin (100 ng/ml); R848 (1 µg/ml); and CpG ODN 2006 (10 µM). For cytokine production, including type I IFN, the results are expressed as amount of cytokine for 1 x 105 cells/ml.
IFN-
bioassay.
A total of 1 x 105 C6 cells (a rat glioma tumor cell line) was cultured overnight in 100 µl of DMEM (Sigma-Aldrich) supplemented with 10% FCS, 2 mM L-glutamine, 100 U/ml penicillin, and 0.1 mg/ml streptomycin in flat-bottom 96-well plates in the presence or absence of a rat IFN-
reference standard (R&D Systems) or supernatants. The supernatants were then removed and the cells were infected with vesicular stomatitis virus (provided by Dr. A. Rufffault, Centre Hospitalo-Universitaire Régional Pontchaillou, Rennes, France) in a final volume of 100 µl of complete DMEM for 18 h at 37°C. The wells were then washed with 100 µl of Earles balanced salts (Sigma-Aldrich) and incubated with 100 µl of 5% Formalin for 10 min at room temperature, followed by 100 µl of crystal violet solution. Plates were examined visually and reciprocal titers of IFN-
(expressed as units per milliliter) were deduced by comparison with the reference standard.
ELISA test.
The levels of IL-10 and TNF-
in the supernatants were measured using OptEIA set ELISA kits from BD Pharmingen according to the manufacturers instructions. Rat IL-12p40 and IL-12p70 were detected using ELISA kits from BioSource International, and IL-6 was measured using an ELISA kit from R&D Systems.
Quantitative RT-PCR
The ODN sequences used in this study are described in Table I and II.
|
|
For TLR and hypoxanthine-guanine phosphoribosyltransferase (HPRT) genes, the target sequence was amplified by PCR from a spleen cDNA library, then electrophoresed and purified by phenol-chloroform extraction and ethanol precipitation. Subsequent dilutions of this standard DNA were performed to obtain 107, 106, 105, 104, 103, and 102 copies/well.
RNA extraction
Total RNA from 3 x 105 to 2 x 106 resting or stimulated spleen cells, OX62+CD4, OX62+CD4+ DC, pDC, and blood monocytes were prepared by TRIzol extraction (Invitrogen Life Technologies). Genomic DNA was removed by DNase treatment (Invitrogen Life Technologies), and reverse transcription was performed as described previously (25).
Real-time quantitative PCR
For NOD2, MyD88, TNFR-associated factor 6 (TRAF6), and IL-1R-associated kinase 4 (IRAK4) analyses, real-time quantitative PCR was performed using an Applied Biosystems GeneAmp 7700 Sequence Detection System with SYBR Green PCR Core Reagents (Applied Biosystems). Total cDNA was amplified in 25 µl of PCR mix containing 300 nM of each primer (Table II); 200 µM dATP, dGTP, and dCTP; 400 µM dUTP; 3 mM MgCl2; 0.25 U of uracil-N-glycosylase; 0.625 U of AmpliTaq Gold DNA polymerase; and 2.5 µl of the 10x SYBR Green buffer. The reaction started with a step of 2 min at 55°C to allow the uracil-N-glycosylase to eliminate putative PCR contaminants, followed by 10 min at 95°C to activate the AmpliTaq Gold DNA polymerase, and then 40 cycles each consisting of 15 s at 95°C and 1 min at 60°C.
For TLR analyses, real-time quantitative PCR was performed using TLR110-labeled TaqMan probes (Table I). Target transcripts and standard dilutions were amplified in a 25-µl reaction PCR mix containing 11 µl of diluted cDNA, 12.5 µl of TaqMan Universal 2x PCR Master Mix (Applied Biosystems), including AmpliTaq Gold DNA polymerase, dNTPs with dUTP and optimized buffer components, and 1.25 µl of 20x TaqMan probes and primer (Table I). Before the PCR cycle, samples were submitted to 50°C for 2 min, then at 95°C for 10 min. The step-cycle program was set for denaturing at 95°C for 15 s, and annealing and extension at 60°C for 1 min, for a total of 40 cycles (ABI Prism 7700 sequence detection system; Applied Biosystems).
Analysis
Direct detection of PCR products was monitored by measuring increase in fluorescence. For TLR, the exact number of copies was deduced by comparison of the measured fluorescence with the standard curve. For NOD2, MyD88, TRAF6, and IRAK-4 mRNA, relative expression (AU: arbitrary units) was calculated using the 2
Ct method as described previously (27).
Statistical analysis
Statistical analyses were performed using the Students t test.
| Results |
|---|
|
|
|---|
To determine the frequencies of spleen DC subsets in three different rat strains, we used six-color flow cytometry on collagenase-digested total spleen leukocytes. Cells were stained with CD3-FITC, anti-IgD-FITC, CD45R-PE, CD11b-PerCP-Cy5.5, CD4-PE-Cy7, OX-62-allophycocyanin, and MHC II-allophycocyanin-Cy7 mAbs (Fig. 1A). After gating on CD3IgDMHC II+ cells, spleen cells were separated into CD11b and CD11b+ populations. Due to the lack of an exclusive and homogeneous marker for rat B cells, the gating on CD3IgDMHC II+ cells was not sufficient to eliminate all B cells. Therefore, MHC II+CD11b+ cells were further gated on CD45R cells to exclude residual B cells (data not shown) and analyzed for the expression of OX62 and CD4. As we have previously shown (22, 25), two DC populations were defined (Fig. 1A): OX62highCD4 (gate B, referred to as CD4 DC) and OX62lowCD4high (gate C, referred to as CD4+ DC). MHC II+CD11b cells were OX62 and contained a population of CD45R+CD4high cells (gate A) that we have previously shown to be the rat counterpart of pDC (24).
|
Morphological features of spleen DC subsets
To sort spleen DC subsets, spleen cells were first separated into low-density cells that contain most of the OX62+ DC and high-density cells that contain most of the pDC (24). OX62highCD4 and OX62lowCD4high DC were then sorted by FACS from low-density cells, whereas CD4high CD45+ cells (pDC) were sorted from high-density cells after selective depletion of T cells, CD11b/c+ cells, and most B cells (Fig. 2A). Sorted cells were then analyzed by electron microscopy. As shown in Fig. 2B, the three DC subsets exhibited very different morphological and ultrastructural features. The population of CD4 DC was the most heterogeneous, with the majority of cells presenting a large and irregular shape with rather a small nucleus and a large cytoplasm containing numerous vesicules in which heterogeneous material was sometimes observed. CD4+ DC were a homogeneous population of medium-sized cells, with a high nuclear:cytoplasmic ratio, a regular nucleus with dense chromatin and very few cytoplasmic vesicles. The population of pDC was very homogeneous; these cells exhibited a round shape, an eccentric and irregular nucleus, together with a strongly developed endoplasmic reticulum reminiscent of that observed in plasmocytes.
Expression of TLR and NOD2 mRNA in spleen DC subsets
The expression of TLR110 mRNA was assessed in spleen DC subsets from SPD rats using real-time quantitative PCR. All TLR mRNA were detected in all DC subsets and in monocytes, but the levels of expression strongly differed. pDC were characterized by a strong expression of TLR7 and 9, a moderate expression of TLR 2, a low expression of TLR4 and 8, and a very low expression of TLR1, 3, 5, 6, and 10 (Fig. 3). In contrast, OX62+ DC expressed a much broader repertoire of TLR. CD4 DC expressed high levels of TLR1, 2, 3, and 10, moderate levels of TLR4, 5, 6, 7, and 9, and very low, if any, TLR8. CD4+ DC expressed all TLR, with high TLR1, 2, 3, and 7 levels and low TLR4, 5, 6, 8, 9, and 10 levels. The pattern of TLR mRNA expression was also assessed in blood adherent monocytes, which expressed high levels of TLR1, 2, 5, 6, 7, and 8, low TLR4 and 9 levels, and very low TLR3 and 10. Because the frequencies of DC subsets appeared strain dependent, we determined whether the repertoire of TLR expression was also influenced by the genetic background. This same global profile of TLR expression was found in Lewis and BN strains, with the exception of TLR7 mRNA that exhibited lower expression in CD4+ DC from Lewis and BN than from SPD rats (data not shown).
|
|
We next analyzed whether the pattern of TLR and NOD2 mRNA expression observed in the different DC subsets correlated with a specific responsiveness to well-defined TLR and NOD2 ligands. We first assessed the effects of these ligands on in vitro DC survival and maturation. pDC and CD4 DC exhibited an extremely poor spontaneous survival of <10% upon culture in medium alone, contrasting with the 30% spontaneous survival rate of CD4+ DC (Fig. 5). pDC survival was greatly enhanced by LPS (TLR4), R848 (TLR7/8), CpG2006 (TLR9), and PGN (NOD2) and was not affected by HKLM (TLR 2/6), poly(I:C) (TLR3), or flagellin (TLR5). CD4 DC survival was strongly enhanced by ligands of TLR 2/6, 3, 4, and 9 and NOD2, enhanced only modestly by TLR5 ligands, and unaffected by TLR7/8 ligands. The survival of CD4+ DC was slightly increased by triggering of all TLR tested but was not significantly influenced by PGN. The data described in Fig. 5 were obtained with SPD DC, but Lewis DC exhibited very similar responses (data not shown).
|
|
|
The production of IL-12p40, IL-10, TNF-
, IL-6, and type I IFN was assessed in the supernatant of TLR-stimulated SPD DC (Fig. 8). In agreement with our previous study (25), we found that CD4 DC produced much higher IL-12p40 than CD4+ DC (10- to 20-fold higher). Very low levels of IL-12p40 were sometimes detected in the supernatants of CD4 DC cultured in medium alone, indicating some degree of activation likely due to the DC purification procedure. TLR9 triggering was the strongest IL-12p40 inducer in CD4 DC, followed by NOD2 and TLR4. TLR3 and 5 stimulations were poor IL-12p40 inducers, whereas TLR7/8 ligands had no reproducible effect. CD4+ DC were found to produce very low amounts of IL-12p40 upon stimulation of TLR2/6, 7/8, and 9. Rat pDC produced large amounts of IL-12p40 upon ligation of TLR 7/8 and 9 exclusively. In our hands, the bioactive form of IL-12 (IL-12p70) was detected only in very low amounts (<100 pg/ml) and reproducibly in the supernatant of TLR9- but not TLR7/8-stimulated CD4 DC and of TLR7/8- but not TLR9-stimulated pDC (Fig. 9).
|
|
10 ng/105 cells/ml), as well as TLR9 (
6 ng/ml). In contrast, CD4 and CD4+ DC produced extremely low, if any, IL-6 using the same stimulation conditions. pDC were also the main producers of TNF-
(10- to 20-fold higher than OX62+ DC) upon TLR7/8 and 9 stimulation. In contrast, pDC produced very low, if any, IL-10 (<25 ng/ml). CD4 DC produced moderate levels of IL-10 upon TLR9 stimulation and low levels upon TLR4 stimulation. Contrasting with their extremely poor production of proinflammatory cytokines as compared with other DC subsets, CD4+ DC were found to produce moderate but quite variable amounts of IL-10 upon TLR7/8 and 9 stimulation. In agreement with our previous report (24), we confirm in this study that pDC were the only cells to produce type I IFN, as determined by an in vitro bioassay, with R848 being the strongest inducer. In contrast to CpG type A CpG2216 that induced very high amounts of type I IFN (24), the type B CpG 2006 was a poor inducer.
On a cell basis, there was no strain-dependent differences in the amounts of IL-12p40, IL-6, and TNF-
produced by the different DC subsets in response to TLR7/8 and 9 (data not shown). We also assessed whether CD40 triggering could synergize with TLR stimulation in inducing IL-12p40 production in DC subsets. No synergistic effect was observed for pDC, whereas a moderate synergistic effect between CD40L and NOD2 of TLR9, and between CD40L and TLR7/8 or 9 triggering, was observed in the induction of IL-12p40 by CD4+ and CD4 DC, respectively (data not shown). Finally and in agreement with our previous study (25), we could not significantly or reproducibly detect IFN-
in the supernatant of any stimulated rat DC subset (data not shown).
Expression of TLR signaling molecules in spleen DC subsets
According to our results, despite expressing the broadest repertoire of PRR among DC subsets, CD4+ DC exhibited poor responsiveness to all the PRR ligands tested in this study, at least in vitro. Because this could be related to differential intracellular TLR signaling, we analyzed the expression of MyD88, TRAF6, and IRAK4 mRNA in DC subsets (Fig. 10). In the three stains analyzed (SPD, Lewis, BN), MyD88 and TRAF6 mRNA were strongly expressed in DC, with pDC expressing significantly higher levels than OX62+ DC, and the CD4+ and CD4 subsets expressing similar levels. IRAK4 mRNA was expressed at very low levels in pDC and was undetectable in OX62+ DC.
|
| Discussion |
|---|
|
|
|---|
In agreement with a recent study performed in the mouse by Asselin-Paturel et al. (30), we found that the frequency of pDC in the spleen was strongly strain dependent. This was also true for the other DC subsets, although to a lesser extent. Thus, Lewis rats have 3- to 4-fold more pDC than the other strains tested, and BN rats have the highest numbers of CD4+ DC. The fact that DC subsets could influence Th1 or Th2 responses (5) makes the difference between the Lewis and BN strains especially relevant. Indeed, Lewis rats are known to be prone to several Th1-mediated autoimmune diseases while being resistant to those mediated by Th2, whereas BN rats behave oppositely (31). Moreover, we showed that CD4+ DC were the only DC subset to promote IL-13-producing CD4+ T cells (25) and that mature pDC drive Th1 differentiation (24). Whether the difference in DC subset numbers between strains is genetically determined or rather T cell dependent remains to be investigated. A study by Liu et al. (32) suggested differences in TLR expression between BALB/c and C57BL/6 DC. Although the levels of TLR and NOD2 mRNA expression also differed between rat strains (data not shown), the profile of each DC subset was similar in all strains. The fact that we detected all TLR mRNA in all DC is due to the high sensitivity of our PCR technique. We confirmed that rat pDC have a restricted TLR repertoire with high levels of TLR7 and 9 (24), a pattern that is conserved in human (9), as well as murine pDC (17, 33). The expression of other TLR in murine pDC is not as clear, probably because of different sensitivities in the PCR method used and different purity and tissue origin of the pDC studied. In a previous study, we found pDC to additionally express low levels of TLR1 and 6 mRNA rather than TLR2 as found in the present study. This is likely due to a technical change (TaqMan probes in this study vs SYBR Green in our previous study). TLR4 was not found in human pDC, whereas its expression in mouse was detected in thymic (33) but not in spleen pDC (17). We found very low levels of TLR4 mRNA in rat spleen pDC, which correlated with a partial response to LPS in vitro (survival). Another difference between human and rodent DC concerns TLR9, which is restricted to pDC in human blood, but which is expressed in all spleen DC subsets in mice (16, 17) and in rats, as shown in this study. However, it is difficult to draw conclusions before TLR9 expression in lymphoid organ-derived DC has been assessed in humans. In fact, a recent study has shown strong TLR9 gene expression in BDCA3+ tonsillar DC (34). Like human CD11c+ DC, OX62+ rat DC expressed a much broader TLR repertoire than pDC. The main feature of CD4 DC, as compared with other subsets, was a high expression of TLR3 and 10, a very low expression of TLR7 and a barely detectable TLR8. Finally, CD4+ DC expressed all TLR together with high levels of NOD2.
The repertoire of PRR expressed by CD4 and pDC correlated with their responsiveness to specific ligands and that these two subsets responded in quite a stereotyped fashion. pDC responded specifically to TLR7/8 and TLR9 stimulation by surviving, maturing, and producing high amounts of IL-12p40, IL-6, and TNF-
but not IL-10, whereas CD4 DC responded to TLR2/6, 3, 4, 5, and 9 by surviving, maturing, and producing high IL-12p40, low IL-10, very low TNF-
, and no IL-6. Both pDC and CD4 DC produced, however, very low amounts of the bioactive IL-12p70, suggesting that, at least in these in vitro stimulation conditions, the p40 chain was produced in very large excess. Whether an additional signal such as IFN-
or IL-4 priming (35) might be necessary for optimal IL-12p70 production in rat DC is currently under investigation. We previously demonstrated that the stimulation of pDC, but not other DC subsets, with influenza virus induced an alternate response characterized by high type I IFN but very low IL-12, IL-6, and TNF-
production and poor survival (24). In this previous study, we also found pDC to be poor producers of TNF-
. In fact, we were using the murine-specific CpG ODN 1668 instead of the human CpG ODN 2006 that is more efficient for inducing TNF-
, as well as IL-12 in rat DC, and, moreover, the effect of R848 was not assessed in our first study of rat pDC. pDC were actually the strongest producers of not only TNF-
but also IL-6 that was secreted in extremely high amounts. The fact that the production of IL-6 was restricted to pDC in the rat is surprising because this is not the case in humans (9) or in mice (36). A recent study indicated that pDC-produced IL-6 played a role in B cell differentiation and Ig production (37). Production of IL-6 by conventional DC in response to TLR ligation during infection could in addition be critical for T cell activation by allowing pathogen-specific T cells to overcome the suppressive effect of CD4+CD25+ T cells (38).
In contrast to other DC subsets and despite being equipped with the broadest repertoire of PRR, at least at the mRNA level, CD4+ DC exhibited poor responsiveness to TLR and NOD2 ligands. The expression of costimulatory molecules on CD4+ DC was only marginally affected by TLR ligation, suggesting that the effect of mechanical or chemical stresses induced during the purification procedure was dominant over TLR signaling. Their cytokine profile was characterized by low IL-12p40 and moderate IL-10 production in response to TLR2/5, 7/8, and 9. It is possible that their full activation requires synergistic signals from different TLR (39, 40). CD4+ DC were found to stimulate CD4+ and CD8+ T cells very efficiently and were shown to induce Th1 cells in vitro, probably using an IL-12 independent pathway, together with low numbers of IFN-
+IL-13-producing Th cells (25). In the steady-state spleen, these DC that coexpress high levels of CD4 and SIRP-
molecules were found to form a ring around the T cell area (41). Upon i.v. LPS injection, CD172a+ DC relocated to the T cell area and exhibited an increase in costimulatory molecule expression. Whether the effect of LPS on CD4+CD172a+ rat DC in vivo is direct or not is unknown. Interestingly, subsets of CD4+CD172high and CD4CD172low DC were also identified in afferent lymph and mesenteric lymph nodes by others (21). It is tempting to speculate that these subsets are related to the spleen CD4+ and CD4 DC we described here, however, although splenic DC are blood-derived cells, and DC circulating in lymph are tissue derived. Recent reports suggest the unifying hypothesis that most if not all lymphoid organ DC are monocyte-derived (42, 43). In addition, a recent report has shown, in the rat, that a CD43high subset of circulating monocyte could differentiate in intestinal lymph CD4+CD172high and CD4CD172low DC in the absence of inflammatory stimuli (44).
Although rat DC do not express CD8, as do mice DC, the recent description of a CD4+ subset of DC in mice (45) makes the comparison between mouse and rat DC much easier. CD4+ rat DC resemble mouse CD4+CD8 DC; both are found in the marginal zone, express all TLR, are poor producers of inflammatory cytokines, but are potent stimulators of allogeneic T cells. Rat CD4 DC share many common features with mouse CD4CD8+ DC; both are found in T cell areas and red pulp, express high TLR3 and very low (rat) or no (mouse) TLR7 (16), are the main producers of IL-12, potent stimulators of CD4+ but not CD8+ T cells (25, 46), and are Th1 inducers (18, 25). Recently, we showed that, unlike CD4+ or pDC, CD4 DC are very efficient at phagocytosing apoptotic cells (26), a property shared by CD4CD8+ DC in the mouse (47). Both rat CD4 (48, 49) and mouse CD8+ (50) DC subsets have been suggested to play a role in self-tolerance. However, their potent phagocytic activity, their rather large TLR repertoire, and their capacity to produce high IL-12 also suggest a role in immune responses to intracellular pathogens.
To conclude, together with recent data obtained in humans and in mice (45), our results suggest that the specialization in pathogen recognition capacity and immune functions of DC subsets is relatively conserved between species. Our results indicate that the differential expression of PRR in DC subsets is not limited to TLR but is also true for NOD2. Finally, the rather stereotyped response of each splenic DC subset suggests that their intrinsic plasticity is limited.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by INSERM, the Progreffe Foundation, and by a grant from the "Association pour la Recherche sur le Cancer" (ARC 5901) (to R.J.). F.-X.H. was supported by INSERM and the "Région des Pays de la Loire" and C.V. by "La Ligue Nationale Contre le Cancer." The high-speed cell sorter used in this study was purchased using a gift from the Caisse Régionale de Crédit Agricole Mutuel Atlantique Vendée. ![]()
2 Current address: Division of Parasitology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, U.K. ![]()
3 Current address: Diabetes Center, 513 Parnassus Avenue, HSW 1102, Box 0540, San Francisco, CA 94143. ![]()
4 Address correspondence and reprint requests to Dr. Régis Josien, INSERM U643, ITERT, CHU Hotel Dieu, 30 boulevard Jean Monnet, 44093 Nantes Cedex 1, France. E-mail address: Regis.Josien{at}univ-nantes.fr ![]()
5 Abbreviations used in this paper: DC, dendritic cell; BN, Brown Norway; HKLM, heat-killed Listeria monocytogene; HPRT, hypoxanthine-guanine phosphoribosyltransferase; IRAK4, IL-1R-associated kinase 4; MHC II, MHC class II; NOD2, nucleotide-binding oligomerization domain 2; ODN, oligonucleotide; pDC, plasmacytoid DC; PGN, peptidoglycan; poly(I:C), polyinosinic-polycytidylic acid; PRR, pattern recognition receptor; SPD, Sprague Dawley; TRAF6, TNFR-associated factor 6. ![]()
Received for publication February 3, 2006. Accepted for publication April 28, 2006.
| References |
|---|
|
|
|---|
and interleukin-12 are induced differentially by Toll-like receptor 7 ligands in human blood dendritic cell subsets. J. Exp. Med. 195: 1507-1512.
/
-producing cells link innate and adaptive immunity. J. Exp. Med. 192: 219-226.
+ and CD8
subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J. Exp. Med. 189: 587-592.
B interaction in acute allograft rejection and CD40L-independent chronic allograft rejection. J. Immunol. 172: 1619-1629. Related articles in The JI:
This article has been cited by other articles:
![]() |
V. Cerovic, C. D. Jenkins, A. G. C. Barnes, S. W. F. Milling, G. G. MacPherson, and L. S. Klavinskis Hyporesponsiveness of Intestinal Dendritic Cells to TLR Stimulation Is Limited to TLR4 J. Immunol., February 15, 2009; 182(4): 2405 - 2415. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chauvin, J.-M. Philippeau, C. Hemont, F.-X. Hubert, Y. Wittrant, F. Lamoureux, B. Trinite, D. Heymann, F. Redini, and R. Josien Killer Dendritic Cells Link Innate and Adaptive Immunity against Established Osteosarcoma in Rats Cancer Res., November 15, 2008; 68(22): 9433 - 9440. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Naito, T. Anzai, Y. Sugano, Y. Maekawa, T. Kohno, T. Yoshikawa, K. Matsuno, and S. Ogawa Differential Effects of GM-CSF and G-CSF on Infiltration of Dendritic Cells during Early Left Ventricular Remodeling after Myocardial Infarction J. Immunol., October 15, 2008; 181(8): 5691 - 5701. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chauvin and R. Josien Dendritic Cells as Killers: Mechanistic Aspects and Potential Roles J. Immunol., July 1, 2008; 181(1): 11 - 16. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ouabed, F.-X. Hubert, D. Chabannes, L. Gautreau, M. Heslan, and R. Josien Differential Control of T Regulatory Cell Proliferation and Suppressive Activity by Mature Plasmacytoid versus Conventional Spleen Dendritic Cells J. Immunol., May 1, 2008; 180(9): 5862 - 5870. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Forsbach, J.-G. Nemorin, C. Montino, C. Muller, U. Samulowitz, A. P. Vicari, M. Jurk, G. K. Mutwiri, A. M. Krieg, G. B. Lipford, et al. Identification of RNA Sequence Motifs Stimulating Sequence-Specific TLR8-Dependent Immune Responses J. Immunol., March 15, 2008; 180(6): 3729 - 3738. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Baba, S. Iwasaki, T. Maruoka, A. Suzuki, U. Tomaru, H. Ikeda, T. Yoshiki, M. Kasahara, and A. Ishizu Rat CD4+CD8+ Macrophages Kill Tumor Cells through an NKG2D- and Granzyme/Perforin-Dependent Mechanism J. Immunol., March 1, 2008; 180(5): 2999 - 3006. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Peyrin-Biroulet and M. Chamaillard Invited review: NOD2 and defensins: translating innate to adaptive immunity in Crohn's disease Innate Immunity, June 1, 2007; 13(3): 135 - 139. [Abstract] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |