The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bu, H.-F.
Right arrow Articles by Tan, X.-D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bu, H.-F.
Right arrow Articles by Tan, X.-D.
The Journal of Immunology, 2006, 177: 8767-8776.
Copyright © 2006 by The American Association of Immunologists, Inc.

Lysozyme-Modified Probiotic Components Protect Rats against Polymicrobial Sepsis: Role of Macrophages and Cathelicidin-Related Innate Immunity1

Heng-Fu Bu*,{dagger}, Xiao Wang*,{dagger}, Ya-Qin Zhu*,{ddagger}, Roxanne Y. Williams*, Wei Hsueh{dagger}, Xiaotian Zheng{dagger}, Ranna A. Rozenfeld{ddagger}, Xiu-Li Zuo{dagger} and Xiao-Di Tan2,*,{dagger},{ddagger}

* Molecular and Cellular Pathobiology Program, Children’s Memorial Research Center, Children’s Memorial Hospital, Chicago, IL 60614; {dagger} Department of Pathology, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611; and {ddagger} Department of Pediatrics, Feinberg School of Medicine, Northwestern University, Chicago, IL 60611


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Severe sepsis is associated with dysfunction of the macrophage/monocyte, an important cellular effector of the innate immune system. Previous investigations suggested that probiotic components effectively enhance effector cell functions of the immune system in vivo. In this study, we produced bacteria-free, lysozyme-modified probiotic components (LzMPC) by treating the probiotic bacteria, Lactobacillus sp., with lysozyme. We showed that oral delivery of LzMPC effectively protected rats against lethality from polymicrobial sepsis induced by cecal ligation and puncture. We found that orally administrated LzMPC was engulfed by cells such as macrophages in the liver after crossing the intestinal barrier. Moreover, LzMPC-induced protection was associated with an increase in bacterial clearance in the liver. In vitro, LzMPC up-regulated the expression of cathelicidin-related antimicrobial peptide (CRAMP) in macrophages and enhanced bactericidal activity of these cells. Furthermore, we demonstrated that surgical stress or cecal ligation and puncture caused a decrease in CRAMP expression in the liver, whereas enteral administration of LzMPC restored CRAMP gene expression in these animals. Using a neutralizing Ab, we showed that protection against sepsis by LzMPC treatment required endogenous CRAMP. In addition, macrophages from LzMPC-treated rats had an enhanced capacity of cytokine production in response to LPS or LzMPC stimulation. Together, our data suggest that the protective effect of LzMPC in sepsis is related to an enhanced cathelicidin-related innate immunity in macrophages. Therefore, LzMPC, a novel probiotic product, is a potent immunomodulator for macrophages and may be beneficial for the treatment of sepsis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Severe sepsis is a serious and extremely costly medical problem in the U.S. The disease develops in >750,000 people annually, and ~30% of them die (1, 2). It is often caused by infection of commensal bacteria derived from mucosal or skin surfaces. In past decades, extensive efforts have been made to understand how microbes trigger the innate immune response to infections and the pathophysiology of sepsis (3, 4). We have learned that the innate immune system (including humoral and cellular components) is in a dynamic state during sepsis (reviewed in Refs. 3 , 5 , and 6). The sepsis syndrome is associated with an initially overwhelming innate immune response, characterized by unabated activation and release of proinflammatory mediators, i.e., humoral effectors. Subsequently, the exaggerated systemic inflammatory response is counterbalanced by a sustained expression of potent anti-inflammatory mediators, which often results in the desensitization of effector cells (such as phagocytes) and the development of immunosuppression. Both the excessive inflammation and the profound immunosuppression are major determinants to an adverse clinical outcome in sepsis. Furthermore, physiological functions of cellular effectors of the innate immune system such as macrophages/monocytes and neutrophils are altered in sepsis. Recently, several investigations suggested that modulation of immune cell function might be a novel therapeutic strategy for attenuation of sepsis (7, 8, 9, 10, 11, 12).

Cathelicidin is a protein stored in granules as inactive propeptide precursors in polymorphonuclear leukocytes (PMN)3 and monocytes/macrophages (13, 14, 15). Upon stimulation, cathelicidin is released from phagocytes. After release, the C-terminal end of cathelicidin is processed into active peptides. It has been demonstrated that human and rodent phagocytes express a single cathelicidin peptide, namely, hCAP-18/LL-37 in humans and cathelicidin-related antimicrobial peptide (CRAMP) in rodents (16, 17). hCAP-18/LL-37 and CRAMP are effective killers of a variety of bacteria, including Escherichia coli, Pseudomonas aeruginosa, and Staphylococcus aureus (14, 16, 17, 18, 19). CRAMP has been shown to impair intracellular replication of pathogens (20). Apart from its antimicrobial properties, hCAP-18/LL-37 has also been demonstrated to neutralize LPS and protect mice from LPS lethality (14, 18). CRAMP-deficient mice are susceptible to severe bacterial infection (21). Administration of hCAP-18/LL-37 protects against sepsis in neonatal rats (22). Thus, cathelicidin-related peptides play an important role in the maintenance of protective innate immunity.

Probiotics are nonpathogenic microorganisms, which confer benefits to the host when administrated in sufficient amounts (23). Previous studies have shown that oral administration of probiotics modulates intestinal immunity, improves the balance of the gut microflora, enhances the recovery of the disturbed gut mucosal barrier, and prevents microbial translocation (23, 24). Experimental and clinical studies have provided evidence for the possible use of probiotics in several inflammatory diseases, including inflammatory bowel disease, enteritis, diarrhea, and pancreatitis (24, 25, 26, 27). In addition, studies have shown that the protective effect of probiotics is not limited to the gut (24, 28, 29). However, enteral delivery of intact probiotic bacteria has not been shown to prevent sepsis. Although probiotics have been suggested to enhance natural and acquired immunity, it is unclear whether their effects are associated with cathelicidin-related innate immunity. There have been a few reports indicating that heat-killed probiotics or their cell wall fractions effectively enhance effector cell functions of the immune system in vivo (30, 31, 32). Despite these promising results, the effect of probiotic components in the prevention and treatment of sepsis has not been investigated. In this study, we sought to use probiotic bacteria treated in vitro with lysozyme, an enzyme breaking down bacterial cell walls and releasing bacterial cell wall components. Then we tested the hypothesis that oral delivery of lysozyme-modified probiotic components (LzMPC) modulates the innate immunity and protects against sepsis-induced lethality in rats. We also sought to determine the tissue uptake of LzMPC and study whether LzMPC targets macrophages. Furthermore, we investigated the mechanism of LzMPC action by examining the regulatory effect of LzMPC on the cathelicidin-related innate immune capacity of macrophages and studied whether CRAMP mediates the protective effect of LzMPC on sepsis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Materials

All cell culture medium was obtained from Invitrogen Life Technologies. Lactobacillus sp. (ATCC 53103) and E. coli (ATCC 25922) strains were obtained from American Type Culture Collection. Chicken egg white lysozyme (Sigma-Aldrich; L-6876), chemicals, and molecular biology reagents were purchased from Sigma-Aldrich. Limulus amebocyte lysate assay for measuring endotoxin contents was obtained from Cambrex. BacLight Green Stain was provided by Molecular Probes. Rat TNF-{alpha} QuantiKine Colormetric Sandwich ELISA Kit was purchased from R&D Systems. RNA extraction kit and real-time PCR reagents were supplied by Qiagen. PCR primers were synthesized from Integrated DNA Technologies. All tissue culture plasticwares were supplied by Costar. Goat polyclonal Ab (pAb) against rat CRAMP (catalog SC-34170) was purchased from Santa Cruz Biotechnology. The Ab used for in vivo neutralization of CRAMP did not contain sodium azide and gelatin.

Preparation of LzMPC and lysozyme-modified E. coli components (LzMEcC)

Lactobacillus sp. was used for preparation of LzMPC. Lactobacillus is a bacterial genus, which is the most often used probiotic (33). The safety and the risk-to-benefit ratio of Lactobacillus have been carefully studied and assessed (34, 35). Previous studies have shown that enteral administration of cell wall components of Lactobacillus provides enhancement of immunity in animals (28, 31). Thus, this commercially available strain was used in this study. The bacteria were cultured in Lactobacillus MRS broth (Difco 0881) at 37°C with 5% CO2. A commensal E. coli strain was used for LzMEcC. The E. coli bacteria were cultured in Luria-Bertani medium at 37°C.

Preparation of preps for in vivo experiments. Fresh cultured bacteria (1011 CFU) were washed with PBS (pH 7.0) three times, suspended in 100 ml of PBS (pH 7.0) containing lysozyme (2 mg/ml), and incubated at 37°C for 60 min. After the digestion, cell suspension was centrifuged at 7000 x g for 30 min at 4°C. Supernatant was collected and cell pellets were discarded. To inactivate lysozyme, supernatant was heated at 100°C for 30 min. Then it was cooled down to room temperature and centrifuged at 10,000 x g for 30 min at 4°C. The supernatant (i.e., LzMPC or LzMEcC) was used in various in vivo experiments in the present study. In preps used for in vivo experiments, 1 ml of LzMPC contains probiotic components derived from 109 bacteria. The LzMPC prep was gavaged to rats at a dose of 10 ml/kg.

Preparation of preps for in vitro experiments. Fresh cultured bacteria (1 g) were washed with PBS and digested with lysozyme (2 mg/ml) in PBS, as described above. After the digestion, cells were processed for centrifugation at 7000 x g for 30 min at 4°C. The supernatant was collected, and cell pellets were discarded. To inactivate lysozyme, the supernatant was boiled for 30 min. Then it was cooled down to room temperature and centrifuged at 10,000 x g for 30 min at 4°C. The supernatant was collected, processed for column chromatography on a Detoxi-gel to remove endotoxin from the prep, and then filtrated through a 0.2-µm filter before applying to in vitro experiments. An aliquot of preps was routinely processed for Limulus amebocyte lysate assay to ensure no contamination with endotoxin. Our preliminary data showed that LzMPC prep activates macrophages at a dose of 10 µl/ml.

Polymicrobial sepsis induced by cecal ligation and puncture (CLP)

The CLP procedure was modified from previously described protocols (36, 37). All surgical instruments were steam autoclaved. Male Sprague Dawley rats (120–150 g) were purchased from Harlan Sprague-Dawley. They were anesthetized by i.p. injection of Nembutal (65 mg/kg) and placed under a heating lamp. A 2-cm midline incision was made through the abdominal wall. The cecum was identified and removed from the abdominal cavity. The distal portion (30%) of the cecum was ligated with 5-0 silk suture. The ligated cecum was then punctured twice with an 18-gauge needle and slightly compressed with an applicator until a small amount of stool appeared. On sham-operated animals, the cecum was manipulated, but without ligation and puncture. Thereafter, the cecum was replaced in the peritoneum. The incision was closed using a two-layer procedure: 5-0 silk suture on the muscle layer and surgical staples (9 mm) on the skin. Rats were monitored and weighed on a daily basis until the end of the experiments. The protocol was approved by the Institutional Animal Care and Use Committee.

Bacterial load of liver tissues

Rats were sacrificed 3 days after CLP. Liver tissues were collected, weighed, extensively washed with sterile PBS four times, and homogenized in sterile PBS (1 ml/g). Serial dilutions of liver homogenates in PBS were placed on Luria-Bertani agar plates. Bacteria colonies were counted after incubation overnight at 37°C. Bacterial counts were expressed as CFU/g tissue.

Fluorescent labeling of LzMPC prep with BacLight Green Stain

The BacLight Green Stain is a nonnucleic acid fluorescent labeling reagent. It has a high affinity to the bacterial cell wall. The reagent is nonfluorescent when not associated with bacteria or cell wall components. The protocol suggested by the manufacturer was followed. Briefly, 1 µl of working dye solution was added into 1 ml of LzMPC prep, followed by incubation of samples at room temperature for 15 min. The intensity of fluorescence in the labeled LzMPC was determined with LS55 Luminescence Spectrometer (PerkinElmer) with excitation at 480 nm and emission at 516 nm to ensure labeling efficiency.

Preparation and examination of tissue sections for determining tissue uptake of LzMPC labeled with BacLight Green Stain

The labeled LzMPC (450,000 fluorescent U/kg) was gavaged to rats. At the end of the experiments, the rats were sacrificed. Tissues were extensively washed with cold saline, embedded into the OCT compound, and snap frozen in liquid nitrogen. Cryosections were cut at 10 µm, postfixed in 10% neutral buffered formalin for 10 min, washed with PBS, and mounted in VECTASHIELD Mounting Medium with 4',6'-diamidino-2-phenylindole (DAPI; Vector Laboratories). Slides were visualized under an upright fluorescence microscope (model MD R; Leica Microsystems). The filter set for fluorescein was used for detecting LzMPC labeled with BacLight Green Stain in cells, and the filter set for DAPI was used for visualizing nuclei. Images were acquired with a digital camera (model C4742-95; Hamamatsu). They were transferred to a G4 Macintosh computer (Apple Computer), analyzed by the image-analysis software Openlab, and assembled with software Adobe Photoshop 8.0.

Isolation of peritoneal residential macrophages

Rats were sacrificed with inhalation of CO2 and used for isolation of peritoneal residential macrophages. The protocol described by Davies and Gordon (38) was followed. Briefly, the peritoneum was lavaged with cold serum-free RPMI 1640 several times. The exudate cells were washed and plated at 1 x 106 cells/ml in cell culture plates. After incubation for 2 h at 37°C in a humidified air atmosphere containing 5% CO2, nonadherent cells were removed by washing with HBSS buffered with 10 mM HEPES. Cells were then cultured with RPMI 1640 medium with 10% FBS overnight and used for various experiments.

Rat PMN isolation

A standard method in our laboratory was used (39). Briefly, rats were injected i.p. with 10 ml of 10% casein (in sterile water) under anesthesia. After 4 h, the peritoneal cavity was lavaged with 10 ml of sterile Hank’s salt solution, centrifuged at 500 x g. Contaminated RBC were removed by hypotonic shock. Then the cells were resuspended in DMEM with 10% FBS, counted, and used. PMNs were >95% pure, as assessed by May-Giemsa staining.

Macrophage bactericidal assay

Intracellular bacterial killing was determined with a method described by Hamrick et al. (40). Briefly, macrophages were exposed to E. coli at 37°C for 15 min with a multiplicity of infection rate at 10 bacteria per macrophage. Extracellular bacteria were removed by washing twice with PBS and further killed by culturing macrophages with RPMI 1640 containing 5 µg/ml gentamicin for 30 min. Then wells were randomly named as T0 (for determining initial count Tinitial) and T90 (for determining final count Tfinal), respectively. In T0 wells, the medium was discarded and macrophages were lysed with 0.1% Triton X-100. Cell lysates were immediately used to determine remaining intracellular bacterial counts by incubation of serial 10-fold dilutions of the lysates on Luria-Bertani agar plates at 37°C for 24 h. In T90 wells, cells were cultured with RPMI 1640 for an additional 90 min and then processed for determining intracellular bacterial counts with the same procedure as for T0 wells described above. The intracellular bacterial killing efficiency was determined as follows: percentage of killing = (TinitialTfinal)/Tinitial x 100.

Isolation of RNA, reverse transcription, and conventional and real-time RT-PCR

Total RNA from rat liver or peritoneal macrophages was extracted with an RNeasy Mini Kit (Qiagen). The protocol provided by the manufacturer was followed. Exactly 1 µg of total RNA from each tissue was annealed at 42°C with random hexamers for 30 min in the iScript reaction mix (Bio-Rad) containing dNTP and 1 U of Moloney murine leukemia virus-derived iScript reverse transcriptase (Bio-Rad), which was preblended with RNase inhibitor. The resulting cDNA was then amplified with the specific primers for rats. For conventional PCR, the primers for the rat housekeeping gene GAPDH are as follows: forward, 5'-TGAAGGTCGGAGTCAACGGATTTGGT-3' and reverse, 5'-CATGTGGGCCATGAGGTCCACCAC-3'. The primers for the rat target gene CRAMP are as follows: forward, 5'-TCTGAGCCCCAAGGGGATGAGGA-3' and reverse, 5'-CCAAGGCAGGCCTACTGCTCTAT-3'. PCR was performed with a melting temperature of 94°C for 30 s, followed by annealing at 61°C for 30 s, extension at 72°C for 1 min for a total of 35 cycles, and then a final extension at 72°C for 7 min. The PCR products were separated on a 2% agarose gel and photographed using Alpha Imager 2200 (Alpha Innotech). In some experiments, the resulting cDNA was also amplified by quantitative RT-PCR, using the 7500 real-time PCR system (Applied Biosystems). Two microliters of cDNA product and QuantiTect SYBR Green PCR kit (Qiagen) were used to perform the PCR. Rat 18S housekeeping gene primers are as follows: forward, 5'-TTG ATT AAG TCC CTG CCC TTT GT-3' and reverse, 5'-CGA TCC GAG GGC CTA ACT A-3'. The rat CRAMP target gene primers are as follows: forward, GCGCTCACTGTCACTGCTAT and reverse, 5'-GTCCAAAGACTGCTGGTTGA-3'. These primers were used with the following thermal cycle profile: initiation step at 50°C for 5 min, hold at 95°C for 10 min, 40 cycles of 95°C for 15 s, and 60°C for 1 min for annealing and extension. Data were analyzed with 7500 SDS software.

ELISA for quantitation of TNF in conditioned medium

Conditional medium from macrophage culture was collected, and TNF was detected using rat TNF-{alpha} Quantikine colorimetric sandwich ELISA kit, as described previously (41). The protocol provided by the manufacturer was followed. Standard curves were generated for TNF using the standard provided in the kit, and the concentration of TNF in the cell supernatant was determined by interpreting from the appropriate standard curve.

Western blotting (41)

Total cellular protein was isolated from macrophages, resolved on 4–20% SDS-PAGE gel, and transferred onto a nitrocellulose membrane, as described previously (42). The membranes containing sample proteins were used for immunodetection of CRAMP protein. Briefly, blots preincubated with PBS containing 5% nonfat dry milk (Bio-Rad; 170-6404) were reacted with primary Ab against CRAMP (1:100) for 1 h at room temperature. After incubation, the blot was washed four times with PBS containing 0.05% Tween 20 (PBS-T), and then incubated with PBS-T containing 1/2,000 diluted HRP-conjugated donkey anti-goat IgG for 1 h at room temperature. After additional washing with PBS-T, immune complexes on the blot were visualized by the ECL system. Blots were stripped and reprobed with mAb against beta-actin (1/10,000) following a standard procedure (43).

Statistics

Data are expressed as means ± SEM. ANOVA and one-way ANOVA, followed by Fisher’s least significant difference post hoc test were used to assess the significant of differences; p < 0.05 was considered significant. Survival was analyzed and plotted by the Kaplan-Meier method using GraphPad Prism version 4.0 for Macintosh (GraphPad).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Preparation and characterization of LzMPC

LzMPC were prepared from Lactobacillus sp. (ATCC 53103), a probiotic strain isolated from human feces, with a protocol described in Materials and Methods. LzMPC prep contains heat-stable molecules and is free of bacteria. LzMPC used for in vitro studies was further subjected to column chromatography on a Detoxi gel to remove endotoxin from the prep. To ensure removal of endotoxin from the prep, LzMPC was processed for the Limulus amebocyte lysate assay. LzMPC used for cell culture experiments contained <0.4 EU/ml endotoxin. As a control for LzMPC, we also prepared components named LzMEcC using a commensal bacteria strain (ATCC 25922) utilizing the same procedure.

LzMPC specifically protects against sepsis-induced lethality in rats

To investigate the role of LzMPC in sepsis in vivo, a polymicrobial sepsis model of CLP was used (44). The CLP procedure involves surgical stress and triggers disseminated infection. It leads to development of peritonitis, bacteremia, and polymicrobial sepsis. In many respects, this model mimics the clinical course of sepsis in humans (45, 46). Thus, this model was used in the present study. To test the hypothesis that oral delivery of LzMPC provides protection against sepsis-induced lethality, we randomly assigned rats to either an experimental or several control groups, including the following: 1) LzMPC + CLP (i.e., experimental group, enteral administration of LzMPC and operation with CLP; n = 18); 2) vehicle + CLP (enteral administration of vehicle and operation with CLP; n = 18); 3) viable Lactobacillus + CLP (enteral administration of Lactobacillus (109 CFU/gavage) and operation with CLP; n = 10); 4) LzMEcC + CLP (enteral administration of LzMEcC and operation with CLP; n = 10); and 5) sham operated (enteral administration of vehicle and sham surgery; n = 6). The enteral administration of vehicle or bacterial components and CLP were conducted using a protocol described in Fig. 1A. Survival was monitored for 9 days after CLP or sham surgery. In vehicle + CLP and LzMEcC + CLP groups, as shown in Fig. 1B, survival was 83 and 80%, respectively, 24 h after CLP. This diminished progressively each day until day 6, at which time only 33 and 40% were alive, respectively, in these groups. LzMPC markedly improved the survival. In the LzMPC + CLP group, ~15% of rats died by day 1 and 75% of animals survived by day 9 after the CLP challenge. In contrast, 60% of animals in alive Lactobacillus + CLP group died within 9 days after CLP. All rats in the sham-operated group survived during the 9-day interval (data not shown).


Figure 1
View larger version (76K):
[in this window]
[in a new window]

 
FIGURE 1. LzMPC protects rats against polymicrobial sepsis-induced lethality. A, Protocol for delivery of LzMPC and induction of sepsis by CLP. Rats were gavaged with vehicle, LzMPC, or other bacteria components, and subjected to CLP at time points indicated in the figure. B, Survival rate of animals after CLP. Rats were randomly assigned to four groups, including the following: 1) LzMPC + CLP, n = 18; 2) vehicle + CLP, n = 18; 3) alive Lactobacillus (LB) + CLP, n = 10; and 4) LzMEcC + CLP, n = 10. The protocol shown in A was used for enteral administration of vehicle or bacterial components and conducting CLP. An 18-gauge needle was used for puncturing the cecum in CLP. Survival was monitored for 9 days after CLP. *, p < 0.05 compared with the vehicle + CLP group. C and D, Enteral delivery of LzMPC does not preserve rat intestinal mucosa in polymicrobial sepsis. Rats were subjected to vehicle + CLP or LzMPC + CLP treatment, as described in A. Tissues of the small intestine were taken from animals on day 3 after CLP for histological examination. Typical sections are shown in vehicle + CLP (C), and LzMPC + CLP (D). H&E staining, original magnification x100.

 
In addition, small intestinal tissue samples were taken from LzMPC + CLP and vehicle + CLP groups on day 3 after CLP for histological examination. We found extensive small intestinal injury in animals from both groups (Fig. 1, C and D).

Taken together, the data indicated that oral administration of LzMPC protected rats against CLP-induced death, whereas oral delivery of LzMEcC or live probiotics was ineffective. However, enteral delivery of LzMPC did not ameliorate intestinal injury in sepsis or preserve mucosal barrier function.

Oral administration of LzMPC enhances bacterial clearance in the liver during post-CLP period

Invasion by enteral commensal bacteria contributes to the development of sepsis in the CLP model. The level of the bacterial count in tissues is known to be associated with the severity of CLP-induced inflammatory response (45, 46, 47). Because the liver is a major organ responsible for bacterial clearance in abdominal infection, we examined whether the survival benefit afforded by LzMPC was related to bacterial elimination function in the liver. Briefly, rats were subjected to vehicle + CLP or LzMPC + CLP treatment, as described above. Livers were harvested 72 h after CLP and processed for measurement of bacterial load. As shown in Fig. 2, livers isolated from animals in vehicle + CLP group (n = 10) contained a substantial amount of bacteria. In contrast, the bacterial load in the liver of LzMPC + CLP group (n = 9) was markedly reduced (p < 0.01). The data indicated that LzMPC treatment reduced bacterial load in sepsis.


Figure 2
View larger version (7K):
[in this window]
[in a new window]

 
FIGURE 2. Effect of LzMPC treatment on bacterial clearance in the liver of septic rats. Rats were subjected to vehicle + CLP (n = 10) or LzMPC + CLP (n = 9) treatment, as described in Fig. 1A. Livers were harvested 72 h after CLP and processed for measurement of the bacterial load, as described in Materials and Methods. **, p < 0.01 compared with the vehicle + CLP group.

 
Orally administrated LzMPC is engulfed by cells in the liver after crossing the intestinal barrier

Because oral administration of LzMPC results in the enhancement of bactericidal activity in the liver, we investigated whether LzMPC is translocated into the liver. To this end, we gavaged rats with BacLight Green-labeled LzMPC. Then we examined cryosections of the liver from rats 16 h after enteral feeding with the labeled LzMPC. As illustrated in Fig. 3, particles with green fluorescence were found in the liver sinusoids and cells in the liver sections from rats fed with LzMPC labeled with BacLight Green Stain (Fig. 3A). Some of these cells displayed a distinct morphology of Kupffer cells (Fig. 3B), the residential macrophages in the liver. In contrast, the green fluorescent signal was barely found in the liver sections from normal control animals (Fig. 3C). The data indicated the uptake of LzMPC into the liver and macrophages.


Figure 3
View larger version (91K):
[in this window]
[in a new window]

 
FIGURE 3. LzMPC is distributed in the liver after passing the intact intestinal barrier. A–C, Uptake of LzMPC by liver cells. Rats were gavaged with LzMPC labeled with BacLight Green Stain. The control animals were fed with normal diet. Sixteen hours after enteral feeding, the liver tissues were sectioned with a cryostat. Slides were counterstained with DAPI, followed by examination under a fluorescent microscope. Typical sections are shown in rats fed with the labeled LzMPC (A and B) and the normal control rats (C). Original magnification, x400 in A and C; x630 in B. The arrows indicate Kupffer cells. D and E, Absorption of LzMPC by intestinal mucosa. Rats were gavaged with LzMPC labeled with BacLight Green Stain. The control animals were fed with normal diet. Ninety minutes after enteral feeding, the small intestinal tissues were taken and sectioned with a cryostat. Slides were counterstained with DAPI, followed by examination under a fluorescent microscope. Typical sections are shown in rats fed with the labeled LzMPC (D) and the normal control rats (E). Original magnification, x200.

 
Furthermore, we examined cryosections of the small intestine from rats 90 min after enteral feeding with the labeled LzMPC. This effort enabled us to identify labeled LzMPC at the early stages after it crossed the intact mucosal barrier. When comparing sections from rats fed with labeled LzMPC with sections from controls, cells throughout the lamina propria contained particles with a strong degree of green fluorescence (Fig. 3D), whereas they exhibited only a weak autofluorescence in the controls (Fig. 3E). The data suggested translocation of LzMPC from the gut lumen into intestinal lamina propria.

LzMPC activates macrophage’s bactericidal activity

Macrophages play an essential role in the innate immune response against bacterial invasion. They eliminate bacteria from tissues during sepsis. Because LzMPC enhances bacterial clearance, we further examined whether LzMPC directly targeted the innate immune activity of macrophages. First, freshly isolated rat residential peritoneal macrophages were treated with LzMPC (10 µl/ml) or vehicle (control) for 6 h and examined under a microscope. As illustrated in Fig. 4A, LzMPC profoundly induced pseudopod formation in rat macrophages, as compared with the control group (Fig. 4B).


Figure 4
View larger version (40K):
[in this window]
[in a new window]

 
FIGURE 4. LzMPC induces protective innate immunity of macrophage in vitro. A and B, LzMPC activates macrophages. Rat peritoneal macrophages were treated with LzMPC (10 µl/ml) or vehicle for 6 h. The cells were examined under a microscope. Typical photographs are shown in LzMPC (A) and vehicle (B). Original magnification, x400. C, LzMPC enhances macrophage’s bactericidal activity. Peritoneal macrophages were pretreated with LzMPC (10 µl/ml) or medium (control) overnight. Cells were then processed for a bacterial killing assay, as described in Materials and Methods. The mean ± SEM of three experiments are shown; n = 5 per group; *, p < 0.05 compared with the vehicle group.

 
Furthermore, rat residential peritoneal macrophages were pretreated with LzMPC (10 µl/ml) or vehicle (control) overnight, then processed for a bacterial killing assay. As shown in Fig. 4C, macrophages from the control group killed ~50% of ingested bacteria within 90 min. Pretreatment with LzMPC led to a significant increase in intracellular killing of bacteria by macrophages (p < 0.05). Together, the data suggested that LzMPC activated bactericidal activity of macrophages in vitro.

LzMPC induces expression of CRAMP in macrophages

To understand the mechanism whereby LzMPC stimulates protective innate immunity of macrophages against invasion of bacteria induced by CLP, we determined whether LzMPC modulated the expression of CRAMP gene, which encodes an important antimicrobial peptide in rat phagocytes (17). Residential peritoneal macrophages were stimulated with LzMPC (10 µl/ml) for 2 h. In control groups, cells were treated with LPS (1 µg/ml) or medium instead. Total cellular RNA was then isolated, and CRAMP gene expression was determined with semiquantitative conventional RT-PCR. As shown in Fig. 5A, CRAMP gene was constitutively expressed in rat macrophages. LzMPC, but not LPS, enhanced CRAMP gene expression.


Figure 5
View larger version (17K):
[in this window]
[in a new window]

 
FIGURE 5. LzMPC up-regulates CRAMP gene expression in macrophages. A, Effect of bacterial components on CRAMP expression. Rat residential peritoneal macrophages were stimulated with LPS (1 µg/ml) or LzMPC (10 µl/ml) for 2 h. Then total cellular RNA was isolated and used for detection of CRAMP gene expression with conventional RT-PCR. The PCR products were size fractionized with 2% agarose gel. Data are representative of three separate experiments. B, CRAMP gene in macrophages is up-regulated by LzMPC in vitro. Macrophages were stimulated with LPS (1 µg/ml) or LzMPC (10 µl/ml) for 6 h, total cellular RNA was isolated, and CRAMP gene transcripts were quantitatively determined with real time RT-PCR; n = 3 per group. Results are the means ± SEM; **, p < 0.01 compared with the control group. C, LzMPC and LPS induce TNF production in macrophage in vitro. Peritoneal macrophages were subjected to stimulation with LPS (1 µg/ml) or LzMPC (10 µl/ml) for 6 h. The culture supernatants were processed for measuring the TNF-{alpha} level, as described in Materials and Methods; n = 3 per group. Results are the means ± SEM; **, p < 0.01 compared with the control group.

 
Next, we stimulated macrophages with LPS (1 µg/ml) or LzMPC (10 µl/ml) for 6 h, and determined CRAMP gene expression quantitatively with real-time RT-PCR. As shown in Fig. 5B, LPS had no effect on CRAMP expression in macrophages. In contrast, the gene expression was increased >14-fold within 6 h in response to LzMPC stimulation (p < 0.01 compared with control).

To confirm that both LPS and LzMPC activated macrophages, the culture supernatants were assayed for TNF using ELISA. As shown in Fig. 5C, TNF production was increased by ~50-fold in LPS-stimulated cells and 10-fold in LzMPC-treated cells, indicating that cells were activated by both stimulations, although only LzMPC induced CRAMP gene expression. Together, these observations suggested that LzMPC specifically up-regulated CRAMP-associated innate immune capacity of macrophages.

Surgical stress or CLP causes decrease in CRAMP expression in the rat liver, whereas LzMPC restores CRAMP gene expression in the liver of septic rats

To assess the in vivo contribution of LzMPC treatment on CRAMP expression during the development of sepsis triggered by CLP, rats were divided into groups of the following: 1) normal control, 2) sham surgery, 3) CLP, and 4) LzMPC + CLP. The enteral feeding of LzMPC was conducted using the protocol described in Fig. 1A. Animals were sacrificed 72 h after surgery, total cellular RNA of liver was isolated, and CRAMP gene expression was determined with real-time RT-PCR. As shown in Fig. 6, CRAMP gene was constitutively expressed in the rat liver. The gene expression was down-regulated in the liver 72 h after sham surgery or CLP. Oral administration of LzMPC prevented or reversed the down-regulation of CRAMP gene expression in the liver of septic rats. Taken together, the data suggested that: 1) surgical stress or CLP inhibited CRAMP-associated innate immune capacity in tissues, and 2) LzMPC restored the capacity of CRAMP.


Figure 6
View larger version (21K):
[in this window]
[in a new window]

 
FIGURE 6. Effects of surgical stress, CLP, or LzMPC on CRAMP expression in the liver. Rats were divided into groups of the following: 1) normal control, n = 7; 2) sham surgery, n = 7; 3) CLP, n = 6; and 4) LzMPC + CLP, n = 7. The enteral feeding of LzMPC was conducted using a protocol described in Fig. 1A. Animals were sacrificed 72 h after surgery. Total cellular RNA was isolated from the liver, and CRAMP gene expression was quantitatively determined with real-time RT-PCR. Results are the means ± SEM; **, p < 0.01 compared with the control group.

 
Oral administration of LzMPC enhances the expression of CRAMP mRNA and protein in macrophages, but not in neutrophils

To examine whether LzMPC modulates CRAMP gene expression in macrophages in vivo, rats were gavaged with LzMPC for 5 days. Peritoneal macrophages were then isolated, and total cellular RNA and protein were extracted, respectively. Then CRAMP mRNA was measured with real-time RT-PCR and CRAMP protein was analyzed with Western blotting. As demonstrated in Fig. 7A, CRAMP mRNA was constitutively expressed in macrophages. Treatment with LzMPC in vivo resulted in a marked up-regulation of CRAMP mRNA in the peritoneal residential macrophages. Furthermore, we found that LzMPC up-regulated the expression of CRAMP protein in macrophages (Fig. 7B).


Figure 7
View larger version (18K):
[in this window]
[in a new window]

 
FIGURE 7. Effect of LzMPC treatment on CRAMP gene expression in phagocytes in vivo. A and B, LzMPC up-regulates CRAMP gene expression in macrophages in vivo. Rats were gavaged with LzMPC or vehicle for 5 days. Then animals were sacrificed and peritoneal macrophages were isolated from animals. Total cellular RNA and protein were isolated from macrophages. Then CRAMP mRNA was quantitatively determined with real-time RT-PCR, and CRAMP protein was analyzed with Western blotting, respectively. A, Data of real-time PCR. Results are the mean ± SEM; n = 3 per group; *, p < 0.05 compared with untreated group. B, Typical Western blot for detection of CRAMP protein. C, LzMPC does not modulate CRAMP gene expression in PMNs in vivo. Rats were gavaged with LzMPC for 5 days. Peritoneal neutrophils were isolated from rats 4 h after peritoneal injection of 10% casein, total cellular RNA was extracted, and CRAMP gene expression was quantitatively determined with real-time RT-PCR. Results are the mean ± SEM; n = 3 per group.

 
Neutrophils/PMNs also express CRAMP and play a critical role in killing bacteria (17). Thus, we further examined whether LzMPC modulates CRAMP gene expression in PMNs in vivo. As demonstrated in Fig. 7C, LzMPC does not modulate CRAMP gene expression in PMNs.

Ab against CRAMP blocks the protective effect of LzMPC on sepsis

Because the survival benefit of administrating LzMPC is associated with induction of CRAMP, we next examined the role of cathelicidin-related innate immunity in LzMPC-induced protection against sepsis by using an Ab against CRAMP. To accomplish this, we divided rats into groups of the following: 1) LzMPC + CLP (n = 10); 2) LzMPC + CLP + control IgG (n = 13); and 3) LzMPC + CLP + anti-CRAMP pAb (n = 17). Animals were subjected to treatment with LzMPC and challenged with lethal CLP using a protocol described in Fig. 8A. As stated above, LzMPC treatment resulted in a marked decrease in mortality 2 days after CLP challenge (Fig. 1B). Animals who survived 2 days after CLP were then treated with goat anti-CRAMP Ab (0.75 mg/kg, i.p.). The normal goat IgG was used as a control. The animals were continuously treated with LzMPC and monitored for an additional 8 days after administration of Abs. As illustrated in Fig. 8B, survival in LzMPC + CLP + control IgG group was similar to that in LzMPC + CLP group, indicating that administration of control goat IgG (i.e., IgG prepared from nonimmunized animals) did not result in any change in survival rate. In contrast, rats in LzMPC + CLP + anti-CRAMP pAb group had worse survival after CLP. The data suggest that endogenous CRAMP is a mediator for LzMPC action.


Figure 8
View larger version (12K):
[in this window]
[in a new window]

 
FIGURE 8. Anti-CRAMP Ab blocks the protective effect of LzMPC on sepsis. A, Protocol for delivery of LzMPC, induction of sepsis by CLP, and administration of Abs. Rats were gavaged with LzMPC, subjected to CLP, and i.p. injected with Abs at time points indicated in the figure. Abs, Abs such as anti-CRAMP pAb and normal IgG. B, Survival rate of animals after CLP and Ab treatment. Rats were randomly assigned to three groups, including the following: 1) LzMPC + CLP, n = 10; 2) LzMPC + CLP + control IgG, n = 13; and 3) LzMPC + CLP + anti-CRAMP pAb, n = 17. The protocol shown in A was used for enteral feeding of LzMPC, conducting CLP, and i.p. injection of Abs. An 18-gauge needle was used for puncturing the cecum in CLP. Survival was monitored for 10 days after CLP. CRAMP-Ab, anti-CRAMP pAb.

 
Effect of repeated enteral delivery of LzMPC on 1) cytokine production by peritoneal macrophages and 2) enteral flora in cecum

Pretreatment with LPS (a bacterial component) could result in the development of tolerance, which may lead to protection against septic peritonitis (48). Because LzMPC is also derived from bacteria, we investigated whether treatment with LzMPC would alter cytokine production by phagocytes. Briefly, rats were subjected to LzMPC or vehicle treatment for 5 days. Peritoneal macrophages were then isolated and stimulated with LzMPC (10 µl/ml) for 6 h, and TNF secretion was determined by ELISA. As shown in Fig. 9, macrophages spontaneously secreted TNF in vitro. Oral administration of LzMPC had no effect on the basal level of TNF production in macrophages. However, TNF secretion by macrophages was increased by LzMPC stimulation in vitro. Macrophages from LzMPC-treated animals had an increased capacity of TNF production in response to LzMPC stimulation in vitro. In addition, cells were also stimulated with LPS (1 µg/ml) for 6 h, and TNF secretion was determined. We found that LPS induced TNF production at 954 ± 26.35 pg/106 cells in macrophages of vehicle group and 1033 ± 16.95 pg/106 cells in LzMPC group (p < 0.05; vehicle vs LzMPC). Together, the data indicated that enteral treatment with LzMPC caused an increase in the capacity of cytokine production by macrophages rather than tolerance against LzMPC or cross-tolerance against bacterial component stimulation.


Figure 9
View larger version (10K):
[in this window]
[in a new window]

 
FIGURE 9. Enteral delivery of LzMPC results in an increase in the capacity of cytokine production by phagocytes. Rats were subjected to LzMPC or vehicle treatment on a daily basis for 5 days. Macrophages were isolated from peritoneum and then treated with medium or stimulated with LzMPC (10 µl/ml) for 6 h ex vivo. The culture supernatants were used for measuring TNF by ELISA, as described in Materials and Methods; n = 3 per group. Results are the means ± SEM; *, p < 0.05 compared with the control group (i.e., fed with vehicle).

 
Enteral delivery of probiotics may influence the status of the gut flora. To examine the effect of LzMPC on bacterial growth in the cecum, we subjected rats to LzMPC or vehicle treatment for 5 days, collected lumenal contents from the cecum by needle-puncture, and processed samples for measurement of bacterial count. As shown in Fig. 10, cecal bacterial colony count in the LzMPC group was similar to the count in the control, indicating that LzMPC did not modulate bacterial growth in the gut. This observation suggested that LzMPC-induced protective effect in sepsis was derived from mechanisms other than reduction of the amount of commensal bacteria in the intestine.


Figure 10
View larger version (7K):
[in this window]
[in a new window]

 
FIGURE 10. Effect of LzMPC on bacterial growth in the cecum. Rats were subjected to LzMPC or vehicle treatment on a daily basis for 5 days. Then lumen contents of the cecum were collected by needle-puncture. Samples were processed for measurement of bacterial count, as described in Materials and Methods; n = 13 per group. Horizontal bars represent the mean for each group.

 
Effect of LzMPC treatment on serum TNF level during CLP-induced sepsis

As stated above, LzMPC induces the capacity of TNF production by macrophages (Fig. 9). Therefore, we further analyzed the effect of LzMPC treatment on systemic TNF level during the development of sepsis. Rats were divided into the following groups: 1) CLP alone (n = 3); 2) LzMPC + CLP (i.e., enteral feeding LzMPC for 5 days, followed by CLP; n = 5); and 3) LzMPC + CLP + LzMPC (i.e., enteral feeding LzMPC for 5 days, challenging with CLP, and enteral feeding LzMPC 2 h after CLP; n = 6). All rats were sacrificed 6 h after CLP. ELISA analysis of serum TNF level of rats in each group demonstrated a similar degree of TNF production 6 h after CLP stimulation (Fig. 11). The data suggested that LzMPC treatment did not lead to the alteration of systemic TNF level in response to acute polymicrobial sepsis.


Figure 11
View larger version (15K):
[in this window]
[in a new window]

 
FIGURE 11. Effect of LzMPC treatment on serum TNF level during CLP-induced sepsis. Rats were divided into groups of CLP alone (n = 3), LzMPC + CLP (n = 5), and LzMPC + CLP + LzMPC (n = 6), as stated in Results. LzMPC serum samples were obtained from rats 6 h after CLP. ELISA analysis for serum TNF was conducted, as described in Materials and Methods. Results are the means ± SEM.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Treatment of severe sepsis is still a major challenge in clinical practice (1, 3, 6, 49). In the past decade, many therapeutic approaches have focused on targeting humoral effectors (such as pro- or anti-inflammatory cytokines) of the innate immune system, which govern the development of pathophysiological disorders (such as hyper- or hypoinflammation) in sepsis (50, 51). However, attempts to neutralize proinflammatory cytokines such as TNF or IL-1beta have failed to significantly improve the outcome of sepsis (52, 53, 54). In contrast, targeting anti-inflammatory cytokines such as IL-10 has been shown to be a complicated issue (55, 56, 57, 58, 59, 60). Thus, it is a great practical and intellectual challenge to use immunoregulation as a means to prevent and treat sepsis. In the present study, we found that oral delivery of LzMPC protected rats against CLP-induced death. LzMPC enhanced bacterial killing and proinflammatory cytokine production by macrophages. The protective effect of LzMPC in sepsis was associated with augmentation of innate immunity in macrophages rather than induction of tolerance to bacterial products in macrophages or modulation of enteral flora. Previously, Iwata et al. (7) demonstrated that overexpression of Bcl-2 in phagocytes enhanced survival of the cells, thereby providing protection in experimental sepsis. Administration of molecules targeting phagocytes has been shown to be effective in the prevention and treatment of sepsis (8, 9, 10, 11). Recently, Chung et al. (12) showed that preserving functional capacity of macrophages resulted in improvement of survival to sepsis. Taken together, our findings in this study in conjunction with these previous studies suggest that the immunomodulatory strategy to modulate macrophage/monocyte function should be pursued as a treatment for sepsis.

A growing body of evidence has suggested the potential usage of probiotic bacteria for therapy and immunomodulation (reviewed in Refs. 23 and 29). Because severe sepsis is associated with dysfunction of the innate immune system, theoretically, using probiotic bacteria should be an ideal immunomodulatory strategy to prevent or fight the disease. However, recent clinical studies using live probiotics yielded discouraging results: enteral delivery of live probiotics to patients at high risk of sepsis could cause secondary nosocomial infections in these individuals, because the gut mucosal barrier function is impaired during sepsis (61, 62, 63). Thus, we prepared a novel, bacteria-free probiotic product, namely LzMPC, by digesting the probiotic bacteria with lysozyme. We demonstrated for the first time that oral delivery of LzMPC resulted in improvement in the survival of animals challenged with lethal CLP. The beneficial effect of oral administration of LzMPC was associated with enhancement of bacterial clearance in tissues. In contrast, enteral delivery of live probiotic bacteria increased death rate after CLP. These observations suggested a potential clinical use of LzMPC to protect against polymicrobial sepsis, or as a supplement for patients with immature mucosal barrier who are at high risk for sepsis.

For decades, probiotics have been defined as a live microbial food ingredient that is beneficial to health (reviewed in Ref. 33). This concept guides investigators to study the effects of probiotics in vivo. Recently, Salminen and colleagues (23, 64, 65) proposed that components of probiotic bacteria should also be included in the probiotic family. This updated definition for probiotics is supported by several studies. For example, Jijon et al. (66) reported that DNA from killed probiotics inhibits the production of IL-8 and IFN-{gamma} by intestinal epithelial cells in response to commensal bacterial DNA. Several investigators demonstrated that functions of immune cells are modulated by oral administration of components derived from probiotic bacteria (31, 32). In addition, enteral delivery of killed probiotics results in enhancement of the host systemic innate immunity (28, 30). LzMPC is also a bacteria-free product derived from a probiotic bacteria strain. Our data suggested that ingesting LzMPC resulted in not only an improvement of innate immune capacity, but also an increased resistance to severe systemic inflammation. Thus, we believe that the study of probiotic elements is at least as important as the study of probiotics themselves.

Another important issue concerns the tissue uptake of LzMPC and its active ingredients. In the present study, we showed that LzMPC crossed the mucosal barrier and was then distributed in the liver. However, mechanisms of the gastrointestinal uptake of LzMPC remain undetermined. Previous investigations have demonstrated a normal physiological event called persorption, the paracellular uptake of substances from the digestive tract into the body (reviewed in Ref. 67). It is possible that LzMPC crosses the gut barrier via the mechanism of persorption. In addition, LzMPC is a complex preparation. It contains heat-stable components derived from probiotics. Previous investigations demonstrated that oral feeding heat-killed probiotics resulted in modulation of host immune function (28, 30). Hydrolysis of the bacterial cell wall with lysozyme yields several components such as N-acetylglucosamine-N-acetylmuramic acid peptides and polysaccharides, which are resistant to heat. Further investigations will be required to examine whether these components play a role in the modulation of sepsis.

The mechanisms of action of probiotics are multiple (reviewed in Ref. 24). Lactobacillus is the most commonly used probiotic strain. Perdigon et al. (68) have shown that oral administration of lactobacilli activated macrophages in mice. However, it has not been elucidated whether any host factors in the intestinal lumen play a role in mediating the beneficial effect of probiotics. Lysozyme is a peptidoglycan (an essential cell wall component of bacteria) recognition protein (69, 70). It is an important bacterial-recognizing molecule secreted by phagocytes and Paneth cells in the small intestine (69, 71). In the intestinal lumen, host lysozyme interacts with ingested probiotic bacteria and releases components from bacterial cells. However, little is known about whether components derived from lysozyme-modified probiotics play a role in vivo. In the present study, we mimicked this event by modifying Lactobacillus bacteria with lysozyme in vitro and administering them into the intestinal lumen. We showed that these components (i.e., LzMPC) had potent immune-enhancing properties and increase resistance against sepsis. In contrast, LzMEcC did not protect against sepsis. Our observation suggests that lysozyme is an important host factor, which may mediate probiotic function in vivo.

CRAMP is a unique antimicrobial peptide expressed in phagocytes and epithelial cells (17). Recently, Nizet et al. (21) demonstrated that CRAMP-deficient mice lack innate immunity against bacterial infection, suggesting that CRAMP plays an essential role in the host defense. In addition, CRAMP-related peptides have also been demonstrated to neutralize LPS, protect mice from LPS lethality, and attenuate sepsis triggered by bacterial infection (14, 18, 22, 72). In the present study, we found that: 1) LzMPC up-regulated the expression of CRAMP in macrophages; 2) LzMPC preserved CRAMP expression in tissues, which was correlated to the protective effect of LzMPC on sepsis; and 3) anti-CRAMP Ab attenuated LzMPC protection against CLP-induced death in rats. Collectively, these findings suggest that the protective effect of LzMPC in sepsis is related to increase of cathelicidin-associated innate immunity of macrophages and is mediated by CRAMP. It is likely that LzMPC targets cellular effectors such as macrophages, thereby enhancing CRAMP-related protective innate immune capacity of macrophages and protecting against sepsis.


    Acknowledgments
 
We thank Dr. Shane Greenstein for advice on statistic analysis and Marianne Reed for preparation of the manuscript.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by Excellence in Academic Medicine Award from Illinois Department of Public Aid (to X.-D.T.), Grant R01DK064240 (to X.-D.T.) from National Institutes of Health, and Eloise and Warren Batts Investigator Chair (to X.-D.T.). X.-L.Z. is a visiting scholar supported by Department of Gastroenterology, Qilu Hospital, Medical College of Shandong University, Jinan, Shandong, People’s Republic of China. Back

2 Address correspondence and reprint requests to Dr. Xiao-Di Tan, Molecular and Cellular Pathobiology Program, Children’s Memorial Research Center, Children’s Memorial Hospital, 2300 Children’s Plaza, Box 217, Chicago, IL 60614. E-mail address: xtan{at}northwestern.edu Back

3 Abbreviations used in this paper: PMN, polymorphonuclear leukocyte; CRAMP, cathelicidin-related antimicrobial peptide; CLP, cecal ligation and puncture; DAPI, 4',6'-diamidino-2-phenylindole; LzMEcC, lysozyme-modified E. coli component; LzMPC, lysozyme-modified probiotic component; pAb, polyclonal Ab. Back

Received for publication March 27, 2006. Accepted for publication October 4, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Angus, D. C., W. T. Linde-Zwirble, J. Lidicker, G. Clermont, J. Carcillo, M. R. Pinsky. 2001. Epidemiology of severe sepsis in the United States: analysis of incidence, outcome, and associated costs of care. Crit. Care Med. 29: 1303-1310. [Medline]
  2. Angus, D. C., A. A. Musthafa, G. Clermont, M. F. Griffin, W. T. Linde-Zwirble, T. T. Dremsizov, M. R. Pinsky. 2001. Quality-adjusted survival in the first year after the acute respiratory distress syndrome. Am. J. Respir. Crit. Care Med. 163: 1389-1394. [Abstract/Free Full Text]
  3. Annane, D., E. Bellissant, J. M. Cavaillon. 2005. Septic shock. Lancet 365: 63-78. [Medline]
  4. Beutler, B., K. Hoebe, X. Du, R. J. Ulevitch. 2003. How we detect microbes and respond to them: the Toll-like receptors and their transducers. J. Leukocyte Biol. 74: 479-485. [Abstract/Free Full Text]
  5. Hotchkiss, R. S., I. E. Karl. 2003. The pathophysiology and treatment of sepsis. N. Engl. J. Med. 348: 138-150. [Free Full Text]
  6. Bone, R. C., C. L. Sprung, W. J. Sibbald. 1992. Definitions for sepsis and organ failure. Crit. Care Med. 20: 724-726. [Medline]
  7. Iwata, A., V. M. Stevenson, A. Minard, M. Tasch, J. Tupper, E. Lagasse, I. Weissman, J. M. Harlan, R. K. Winn. 2003. Over-expression of Bcl-2 provides protection in septic mice by a trans effect. J. Immunol. 171: 3136-3141. [Abstract/Free Full Text]
  8. Yan, J. J., J. S. Jung, J. E. Lee, J. Lee, S. O. Huh, H. S. Kim, K. C. Jung, J. Y. Cho, J. S. Nam, H. W. Suh, et al 2004. Therapeutic effects of lysophosphatidylcholine in experimental sepsis. Nat. Med. 10: 161-167. [Medline]
  9. Weighardt, H., C. Feterowski, M. Veit, M. Rump, H. Wagner, B. Holzmann. 2000. Increased resistance against acute polymicrobial sepsis in mice challenged with immunostimulatory CpG oligodeoxynucleotides is related to an enhanced innate effector cell response. J. Immunol. 165: 4537-4543. [Abstract/Free Full Text]
  10. Stephens, D. P., D. A. Fisher, B. J. Currie. 2002. An audit of the use of granulocyte colony-stimulating factor in septic shock. Intern. Med. J. 32: 143-148. [Medline]
  11. Docke, W. D., F. Randow, U. Syrbe, D. Krausch, K. Asadullah, P. Reinke, H. D. Volk, W. Kox. 1997. Monocyte deactivation in septic patients: restoration by IFN-{gamma} treatment. Nat. Med. 3: 678-681. [Medline]
  12. Chung, C. S., G. Y. Song, J. Lomas, H. H. Simms, I. H. Chaudry, A. Ayala. 2003. Inhibition of Fas/Fas ligand signaling improves septic survival: differential effects on macrophage apoptotic and functional capacity. J. Leukocyte Biol. 74: 344-351. [Abstract/Free Full Text]
  13. Zanetti, M., R. Gennaro, D. Romeo. 1995. Cathelicidins: a novel protein family with a common proregion and a variable C-terminal antimicrobial domain. FEBS Lett. 374: 1-5. [Medline]
  14. Larrick, J. W., M. Hirata, R. F. Balint, J. Lee, J. Zhong, S. C. Wright. 1995. Human CAP18: a novel antimicrobial lipopolysaccharide-binding protein. Infect. Immun. 63: 1291-1297. [Abstract]
  15. Zanetti, M.. 2004. Cathelicidins, multifunctional peptides of the innate immunity. J. Leukocyte Biol. 75: 39-48. [Abstract/Free Full Text]
  16. Turner, J., Y. Cho, N. N. Dinh, A. J. Waring, R. I. Lehrer. 1998. Activities of LL-37, a cathelin-associated antimicrobial peptide of human neutrophils. Antimicrob. Agents Chemother. 42: 2206-2214. [Abstract/Free Full Text]
  17. Gallo, R. L., K. J. Kim, M. Bernfield, C. A. Kozak, M. Zanetti, L. Merluzzi, R. Gennaro. 1997. Identification of CRAMP, a cathelin-related antimicrobial peptide expressed in the embryonic and adult mouse. J. Biol. Chem. 272: 13088-13093. [Abstract/Free Full Text]
  18. Ciornei, C. D., T. Sigurdardottir, A. Schmidtchen, M. Bodelsson. 2005. Antimicrobial and chemoattractant activity, lipopolysaccharide neutralization, cytotoxicity, and inhibition by serum of analogs of human cathelicidin LL-37. Antimicrob. Agents Chemother. 49: 2845-2850. [Abstract/Free Full Text]
  19. Travis, S. M., N. N. Anderson, W. R. Forsyth, C. Espiritu, B. D. Conway, E. P. Greenberg, P. B. McCray, Jr, R. I. Lehrer, M. J. Welsh, B. F. Tack. 2000. Bactericidal activity of mammalian cathelicidin-derived peptides. Infect. Immun. 68: 2748-2755. [Abstract/Free Full Text]
  20. Rosenberger, C. M., R. L. Gallo, B. B. Finlay. 2004. Interplay between antibacterial effectors: a macrophage antimicrobial peptide impairs intracellular Salmonella replication. Proc. Natl. Acad. Sci. USA 101: 2422-2427. [Abstract/Free Full Text]
  21. Nizet, V., T. Ohtake, X. Lauth, J. Trowbridge, J. Rudisill, R. A. Dorschner, V. Pestonjamasp, J. Piraino, K. Huttner, R. L. Gallo. 2001. Innate antimicrobial peptide protects the skin from invasive bacterial infection. Nature 414: 454-457. [Medline]
  22. Fukumoto, K., I. Nagaoka, A. Yamataka, H. Kobayashi, T. Yanai, Y. Kato, T. Miyano. 2005. Effect of antibacterial cathelicidin peptide CAP18/LL-37 on sepsis in neonatal rats. Pediatr. Surg. Int. 21: 20-24. [Medline]
  23. Isolauri, E., P. V. Kirjavainen, S. Salminen. 2002. Probiotics: a role in the treatment of intestinal infection and inflammation?. Gut 50: (Suppl. 3):III54-III59. [Medline]
  24. Cong, Y., A. Konrad, N. Iqbal, C. O. Elson. 2003. Probiotics and immune regulation of inflammatory bowel diseases. Curr. Drug Targets Inflamm. Allergy 2: 145-154. [Medline]
  25. Caplan, M. S., R. Miller-Catchpole, S. Kaup, T. Russell, M. Lickerman, M. Amer, Y. Xiao, R. Thomson, Jr. 1999. Bifidobacterial supplementation reduces the incidence of necrotizing enterocolitis in a neonatal rat model. Gastroenterology 117: 577-583. [Medline]
  26. Paton, A. W., M. P. Jennings, R. Morona, H. Wang, A. Focareta, L. F. Roddam, J. C. Paton. 2005. Recombinant probiotics for treatment and prevention of enterotoxigenic Escherichia coli diarrhea. Gastroenterology 128: 1219-1228. [Medline]
  27. Akyol, S., M. R. Mas, B. Comert, U. Ateskan, M. Yasar, H. Aydogan, S. Deveci, C. Akay, N. Mas, N. Yener, I. H. Kocar. 2003. The effect of antibiotic and probiotic combination therapy on secondary pancreatic infections and oxidative stress parameters in experimental acute necrotizing pancreatitis. Pancreas 26: 363-367. [Medline]
  28. Gill, H. S., K. J. Rutherfurd, J. Prasad, P. K. Gopal. 2000. Enhancement of natural and acquired immunity by Lactobacillus rhamnosus (HN001), Lactobacillus acidophilus (HN017) and Bifidobacterium lactis (HN019). Br. J. Nutr. 83: 167-176. [Medline]
  29. Macfarlane, G. T., J. H. Cummings. 2002. Probiotics, infection, and immunity. Curr. Opin. Infect. Dis. 15: 501-506. [Medline]
  30. Gill, H. S., K. J. Rutherfurd. 2001. Viability and dose-response studies on the effects of the immunoenhancing lactic acid bacterium Lactobacillus rhamnosus in mice. Br. J. Nutr. 86: 285-289. [Medline]
  31. Davidkova, G., P. Popova, G. Guencheva, A. Bogdanov, E. Pacelli, A. Auteri, V. Mincheva. 1992. Endogenous production of tumor necrosis factor in normal mice orally treated with Deodan: a preparation from Lactobacillus bulgaricus"LB51.". Int. J. Immunopharmacol. 14: 1355-1362. [Medline]
  32. Sasaki, T., S. Fukami, S. Namioka. 1994. Enhancement of cytotoxic activity of lymphocytes in mice by oral administration of peptidoglycan (PG) derived from Bifidobacterium thermophilum. J. Vet. Med. Sci. 56: 1129-1133. [Medline]
  33. Salminen, S., C. Bouley, M. C. Boutron-Ruault, J. H. Cummings, A. Franck, G. R. Gibson, E. Isolauri, M. C. Moreau, M. Roberfroid, I. Rowland. 1998. Functional food science and gastrointestinal physiology and function. Br. J. Nutr. 80: (Suppl. 1):S147-S171. [Medline]
  34. Salminen, S., A. von Wright, L. Morelli, P. Marteau, D. Brassart, W. M. de Vos, R. Fonden, M. Saxelin, K. Collins, G. Mogensen, et al 1998. Demonstration of safety of probiotics: a review. Int. J. Food Microbiol. 44: 93-106. [Medline]
  35. Salminen, S., A. von Wright. 1998. Current probiotics: safety assured?. Microb. Ecol. Health Dis. 10: 68-72.
  36. Ebong, S., D. Call, J. Nemzek, G. Bolgos, D. Newcomb, D. Remick. 1999. Immunopathologic alterations in murine models of sepsis of increasing severity. Infect. Immun. 67: 6603-6610. [Abstract/Free Full Text]
  37. Singleton, K. D., P. E. Wischmeyer. 2003. Distance of cecum ligated influences mortality, tumor necrosis factor-{alpha} and interleukin-6 expression following cecal ligation and puncture in the rat. Eur. Surg. Res. 35: 486-491. [Medline]
  38. Davies, J. Q., S. Gordon. 2005. Isolation and culture of murine macrophages. Methods Mol. Biol. 290: 91-103. [Medline]
  39. De Plaen, I. G., X. W. Qu, H. Wang, X. D. Tan, L. Wang, X. B. Han, R. A. Rozenfeld, W. Hsueh. 2002. Endotoxin, but not platelet-activating factor, activates nuclear factor-{kappa}B and increases I{kappa}B{alpha} and I{kappa}Bbeta turnover in enterocytes. Immunology 106: 577-583. [Medline]
  40. Hamrick, T. S., E. A. Havell, J. R. Horton, P. E. Orndorff. 2000. Host and bacterial factors involved in the innate ability of mouse macrophages to eliminate internalized unopsonized Escherichia coli. Infect. Immun. 68: 125-132. [Abstract/Free Full Text]
  41. Zhu, Y. Q., X. D. Tan. 2005. TFF3 modulates NF-{kappa}B and a novel negative regulatory molecule of NF-{kappa}B in intestinal epithelial cells via a mechanism distinct from TNF-{alpha}. Am. J. Physiol. 289: C1085-C1093.
  42. Zhu, Y. Q., Y. Lu, X. D. Tan. 2003. Monochloramine induces reorganization of nuclear speckles and phosphorylation of SRp30 in human colonic epithelial cells: role of protein kinase C. Am. J. Physiol. 285: C1294-C1303.
  43. Tan, X. D., Y. Chen, Q. Liu, F. Gonzalez-Crussi, X. Liu. 2000. Prostanoids mediate the protective effect of trefoil factor 3 in oxidant-induced intestinal epithelial cell injury: role of cyclooxygenase-2. J. Cell Sci. 113: 2149-2155. [Abstract]
  44. Wichterman, K. A., A. E. Baue, I. H. Chaudry. 1980. Sepsis and septic shock: a review of laboratory models and a proposal. J. Surg. Res. 29: 189-201. [Medline]
  45. Fink, M. P., S. O. Heard. 1990. Laboratory models of sepsis and septic shock. J. Surg. Res. 49: 186-196. [Medline]
  46. Buras, J. A., B. Holzmann, M. Sitkovsky. 2005. Animal models of sepsis: setting the stage. Nat. Rev. Drug Discov. 4: 854-865. [Medline]
  47. Ashare, A., L. S. Powers, N. S. Butler, K. C. Doerschug, M. M. Monick, G. W. Hunninghake. 2005. Anti-inflammatory response is associated with mortality and severity of infection in sepsis. Am. J. Physiol. 288: L633-L640.
  48. Astiz, M. E., D. C. Saha, K. Brooks, C. M. Carpati, E. C. Rackow. 1993. Comparison of the induction of endotoxin tolerance in endotoxemia and peritonitis by monophosphoryl lipid A and lipopolysaccharide. Circ. Shock 39: 194-198. [Medline]
  49. Angus, D. C., R. S. Wax. 2001. Epidemiology of sepsis: an update. Crit. Care Med. 29: S109-S116. [Medline]
  50. Riedemann, N. C., P. A. Ward. 2003. Anti-inflammatory strategies for the treatment of sepsis. Exp. Opin. Biol. Ther. 3: 339-350.
  51. Riedemann, N. C., R. F. Guo, P. A. Ward. 2003. Novel strategies for the treatment of sepsis. Nat. Med. 9: 517-524. [Medline]
  52. Abraham, E., P. F. Laterre, J. Garbino, S. Pingleton, T. Butler, T. Dugernier, B. Margolis, K. Kudsk, W. Zimmerli, P. Anderson, et al 2001. Lenercept (p55 tumor necrosis factor receptor fusion protein) in severe sepsis and early septic shock: a randomized, double-blind, placebo-controlled, multicenter phase III trial with 1,342 patients. Crit. Care Med. 29: 503-510. [Medline]
  53. Abraham, E., A. Anzueto, G. Gutierrez, S. Tessler, P. G. San, R. Wunderink, N. A. Dal, S. Nasraway, S. Berman,