The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sasai, M.
Right arrow Articles by Seya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sasai, M.
Right arrow Articles by Seya, T.
The Journal of Immunology, 2006, 177: 8676-8683.
Copyright © 2006 by The American Association of Immunologists, Inc.

NAK-Associated Protein 1 Participates in Both the TLR3 and the Cytoplasmic Pathways in Type I IFN Induction1

Miwa Sasai*,{dagger}, Masashi Shingai*, Kenji Funami*, Mitsutoshi Yoneyama{ddagger}, Takashi Fujita{ddagger}, Misako Matsumoto*,{dagger},§ and Tsukasa Seya2,*,§

* Department of Microbiology and Immunology, Hokkaido University Graduate School of Medicine, Kita-ku, Sapporo, Japan; {dagger} Department of Molecular Immunology, Nara Institute for Science and Technology, Ikoma, Nara, Japan; {ddagger} Department of Molecular Genetics, Institute for Virus Research, Kyoto University, Kyoto, Japan; and § Department of Immunology, Osaka Medical Center for Cancer, Higashinari-ku, Osaka, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
TLR3 and the cytoplasmic helicase family proteins (retinoic acid-inducible gene I (RIG-I) and melanoma differentiation-associated gene 5 (MDA5)) serve as dsRNA pattern-recognition receptors. In response to poly(I:C), a representative of dsRNA, and viral infection, they have been shown to activate the transcription factor IFN regulatory factor (IRF)-3, which in turn induces activation of the IFN-beta promoter. RIG-I/MDA5 recognizes dsRNA in the cytoplasm, whereas TLR3 resides in the cell surface membrane or endosomes to engage in extracytoplasmic recognition of dsRNA. Recent reports suggest that TLR3 induces cellular responses in epithelial cells in response to respiratory syncytial virus (RSV). The modus for TLR3 activation by RSV, however, remains unresolved. By small interference RNA gene-silencing technology and human cell transfectants, we have revealed that knockdown of NAK-associated protein 1 (NAP1) leads to the down-regulation of IFN-beta promoter activation >24 h after poly(I:C) or virus (RSV and vesicular stomatitis virus) treatment. NAP1 is located downstream of the adapter Toll-IL-1R homology domain-containing adapter molecule (TICAM)-1 (Toll/IL-1R domain-containing adapter-inducing IFN-beta) in the TLR3 pathway, but TICAM-1 and TLR3 did not participate in the IRF-3 and IFN-beta promoter activation by RSV infection. Virus-mediated activation of the IFN-beta promoter was largely abrogated by the gene silencing of IFN-beta promoter stimulator-1 (mitochondria antiviral signaling (MAVS), VISA, Cardif), the adapter of the RIG-I/MDA5 dsRNA-recognition proteins. In both the TLR and virus-mediated IFN-inducing pathways, I{kappa}B kinase-related kinase {epsilon} and TANK-binding kinase 1 participated in IFN-beta induction. Thus, RSV as well as other viruses induces replication-mediated activation of the IFN-beta promoter, which is intracellularly initiated by the RIG-I/MDA5 but not the TLR3 pathway. Both the cytoplasmic and TLR3-mediated dsRNA recognition pathways converge upon NAP1 for the activation of the IRF-3 and IFN-beta promoter.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The innate immune system serves as a primary defense against virus infection (1). It is accepted that retinoic acid-inducible gene I (RIG-I)3 recognizes dsRNA in the cytoplasm, whereas TLR3 resides in the cell membrane to engage in extracellular recognition of dsRNA (2). Human TLR3 is expressed in airway epithelial cells and macrophages/myeloid dendritic cells (mDCs), which induce cytokines, IFN type I, and chemokines in viral infection (3, 4, 5). In response to poly(I:C) or viral dsRNA, RIG-I/MDA5 (melanoma differentiation associated gene 5) as well as TLR3 have been shown to activate the transcription factor IFN regulatory factor (IRF)-3, in turn inducing the activation of the IFN-beta promoter (2). It remains unsettled whether TLR3 participates in viral infection-mediated IFN-beta induction by detecting the extrinsic dsRNA originating from infected cells. Some reports have suggested that influenza virus, respiratory syncytial virus (RSV), and other viruses induce TLR3-mediated cellular responses in bronchial epithelial cells (5). Cytokine/chemokine responses are reported in influenza virus and RSV infection (3, 4, 6). In particular, RSV has been reported to serve as an inefficient inducer of type I IFNs (7), thereby being in part resistant to host antiviral immunity. The identification of the two pathways initiated by TLR3 and RIG-I, which involve IRF-3 activation followed by production of IFN-beta, enabled an examination of the IFN response occurring in virus-infected cells (1).

TLR3 and RIG-I act as dsRNA-recognition pattern receptors, and are followed by adapter molecules named TICAM-1 (Toll-IL-1R homology domain-containing adapter molecule 1) (Toll/IL-1R domain-containing adapter-inducing IFN-beta; TRIF) and IFN-beta promoter stimulator (IPS)-1 (mitochondria antiviral signaling (MAVS)/VISA/Cardif), respectively, that indirectly link the common kinase complex I{kappa}B kinase-related kinase {epsilon} (IKK{epsilon}) and TANK-binding kinase 1 (TBK1) (8, 9, 10, 11, 12, 13, 14). These kinases in turn activate IRF-3 and then the IFN-beta promoter (15, 16). Thus, the two pathways must converge upstream of the kinase complex. However, the primary molecule responsible for connecting the two pathways to the kinases remains undetermined. The distinctive role of the IFN-inducing pathways in mDC also remains to be elucidated.

NAK-associated protein 1 (NAP1) is initially characterized as an activator of IKK-related kinases and suggested to be involved in protection of cells from TNF-{alpha}-induced apoptosis (17). According to the study, the virus-activated kinases IKK{epsilon} and TBK1 assemble in the regulatory subunit NAP1, and NAP1 facilitates activation of NF-{kappa}B by these kinases. In contrast, NAP1 coprecipitates with TICAM-1 by immunoprecipitation, suggesting the involvement of NAP1 in the TLR3-mediated IFN-inducing pathway (18). NAP1 forms a family with IKK{gamma} and TANK, which recruit kinases to relay the signal for cellular responses (19). We previously showed that NAP1 but not TANK interacts with TICAM-1 (18). Using the RNA interference (RNAi) technology, we have searched for a molecule linking the TLR3 TICAM-1 pathway and the virus-mediated IFN-inducing pathway by infecting HeLa or HEK293 cells with viruses (including RSV, which reportedly derives TLR3 responses; Ref. 20). The results showed the gene silencing of NAP1 and the downstream kinases, but not TLR3 or TICAM-1, led to a decrease in IFN-beta promoter activation. In the same system, exogenously added poly(I:C) required both TLR3 and TICAM-1 in addition to the NAP1-kinase complex for IFN-beta induction. From these studies, we conclude that NAP1 essentially participates in both the TLR3 and RIG-I/MDA5-mediated IRF-3 activation pathways.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Cell culture and HeLa cell sublines

HeLa (a human cervical carcinoma cell line) cells were cultured in MEM with 2 mM L-glutamine and 10% heat-inactivated FCS (JRH Biosciences), and its subline Hep-2 cells (Japanese Cell Resource Bank) were cultured in DMEM (Invitrogen Life Technologies) with 10% FCS and antibiotics, 100 U/ml penicillin, and 100 µg/ml streptomycin (Invitrogen Life Technologies). In some experiments, we used alternative HeLa lines with stable siNAP1 vector for NAP1 silencing or siGFP vector for control. HEK293 cells (RIKEN) were cultured in DMEM as described previously (9).

Plasmid constructs and Ab

Poly(I:C) and anti-IRF-3 Ab were purchased from Amersham Biosciences and IBL. Rabbit-polyclonal Ab (pAb) against Flag (Sigma-Aldrich), against myc (Santa Cruz Biotechnology), and mouse mAb against myc (NeoMarkers or Covance) were purchased from the indicated suppliers. A mouse mAb against human NAP1 and a rabbit pAb against human RIG-I were prepared as reported previously (2, 17). The p-125 luc reporter was a gift from Dr. T. Taniguchi (Tokyo University, Tokyo, Japan) and contained the human IFN-beta promoter region (–125 to +19). The Gal4-IRF-3, Gal4-DBD, and p55 UASG-Luc for IRF-3 activation, pEF-BOS-Flag-RIG-I, RIG-IN, MDA5, and MDA5N were described in Refs. 21 and 22). Expression vectors for NAP1-full, NAP1-DN, and del-NAP1 (NAP1 deleted of the TBK1 binding site; 158–270 aa) in pcDNA3.1 were prepared as described previously (17). Expression vector for IPS-1 (pEF-BOS-Flag-IPS1) was amplified by PCR using KIAA1271 (Kazusa DNA Research Institute) as a template. The dominant-negative form of Mal (Toll/IL-1R domain-containing adaptor protein; TIRAP) was prepared as described previously (23).

Immunoprecipitation

Methods for immunoprecipitation and immunoblotting were described previously (23). Briefly, HEK293 cells were transiently transfected with expression vectors in a 6-well plate using LipofectAMINE 2000 reagent (Invitrogen Life Technologies) and allowed to stand for 24 h. Cells were lysed and proteins were immunoprecipitated with anti-myc mAb (NeoMarkers). Immunoprecipitants were washed, resolved on SDS-PAGE (7.5 or 10% gel), and visualized by immunoblotting using the anti-Flag pAb or anti- myc pAb.

HeLa cells were used for detection of the endogenous NAP1-RIG-I interaction. Cells were cultured in DMEM/10% FCS with or without recombinant human IFN-beta (1000 IU/ml) for 24 h. Cell lysates were immunoprecipitated by anti-NAP1 mAb or anti-mouse IgG Ab. Coimmunoprecipitation was detected by anti-RIG-I pAb.

Reporter gene assay

Activation of the IFN-beta promoter was measured by reporter assay. HEK293 cells were transfected in 24-well plates using LipofectAMINE 2000 reagent with a p-125 luc (IFN-beta) reporter plasmid together with the RIG-I, RIG-IN, MDA5, MDA5N or IPS-1, and NAP1 158–270 (NAP1-DN) plasmids. The properties of RIG-IN and MDA5N were published in a previous study (22). Briefly, the caspase activation and recruitment domain (CARD) of RIG-I (aa 1–284) acted as a constitutive active nature in the IFN-beta induction. Luciferase activity was measured by the Dual-Luciferase assay kit (Promega). The luciferase activity of firefly was normalized to that of Renilla, and relative activation was determined. All experiments were performed in triplicate. Data were expressed as the means ± SD.

Assay for IRF-3 activation

Two methods, reporter assay (21) and native gel assay (24), were used to determine the degree of IRF-3 activation. In some experiments, cells were stimulated with medium alone, poly(I:C) (10 µg/ml), or vesicular stomatitis virus (VSV). In some experiments of reporter assay, cells were transfected with poly(I:C) using DEAE-dextran at 24 h posttransfection. Six hours later, cells were harvested to measure the expression of luciferase using the dual luciferase assay kit (Promega). Data were expressed as the means ± SD. In native assay, cells were lysed after 8 h VSV infection (multiplicity of infection (MOI) = 10). The protein level of each sample was measured by the Protein assay Kit (Bio-Rad) and normalized 20 µg/each lane. Extracts were separated on 7.5% native gel and immunoblotting with anti-IRF-3 Ab (24).

Confocal microscope analysis

HeLa cells (1.5 x 105 cells/well) were plated onto coverslips in a 24-well plate. After cells adhered onto coverslips, cells were transiently transfected with Flag-tagged IPS-1, myc-tagged NAP1, and/or myc-tagged TANK using LipofectAMINE reagent (Invitrogen Life Technologies). Twenty-four hours later, in a typical experiment, cells were treated with 250 nM Mito Tracker Red (Molecular Probes) for 1 h. Cells on coverslips were washed twice with PBS and fixed in 3% formaldehyde in PBS for 30 min. Cells were permeabilized with staining buffer (3% BSA in PBS) containing 0.5% saponin for 30 min at room temperature. After three washes with staining buffer, cells were incubated with primary Ab diluted in staining buffer for 1 h. Cells were extensively washed, and then were treated with Alexa Fluor 488 monoclonal or polyclonal, or Alexa Fluor 594 pAbs (Molecular Probes) as secondary Ab for 30 min. After three washes, coverslips with the cells were mounted onto slide glasses using 2.3% DABCO in PBS. Imaging of the cells was curried out using Olympus Fluoview laser scanning confocal microscopy (25).

Virus preparation and infection

Human RSV field-isolate strain (RSV2177) in subgroup B was propagated with Hep-2 cells (provided by Dr. K. Imai, Wakayama Prefectural Center, Wakayama, Japan) (26). The titer of RSV2177 was determined by 50% tissue culture infective dose using Hep-2 cells. This RSV strain derives type I IFN from Hep-2 cells >24 h postinfection (M. Shingai and T. Seya, unpublished observation). HeLa cells were infected with RSV for small interference RNA (siRNA) knockdown studies at MOI = 1 or 2.5.

VSV was propagated as described previously (27). In brief, VSV (Indiana strain) was propagated with L929 cells. The titration of VSV was determined by plaque assay using L929 cells. HeLa cells were infected with VSV at MOI = 10.

RNAi

RNAi knockdown by siRNA-containing vectors was performed regarding NAP1 as follows. A DsRed2 fragment derived from pDsRed2 (BD Clontech) was cloned into pBluescript II (Stratagene). To paste into the XhoI and SpeI site of the vector, the PstI site of DsRed2 was replaced with CTGCAA by site-directed mutagenesis. Internal ribosome entry site (IRES) and puromycin resistance gene (Puro) fragments were amplified with an Expand High Fidelity PCR system (Roche Diagnostics) by using the following primer sets: AAACTAGTGCCCCTCTCCCTCCC and CTCACCATGGTTGTGGCCATATTATCATCGTGTTTTTCAAA, and AAACTCGAGTCCACCATGGGCACCGAGTACAAGCCCACGGT and AAAACTAGTGCGGCCGCTCAGGCACCGGGCTTGCGGG, respectively. pME-Puro vector was generated by cloning of the XhoI-SpeI fragment of Puro and placing it between the XhoI and XbaI sites of the pME vector. The XhoI-SpeI fragment of DsRed2 and the SpeI-NcoI fragment of IRES were cloned into the pME-Puro vector. pH1' vector was a gift from Drs. H. Hasuwa and M. Okabe (Osaka, Japan) (28). pH1'-DsRed-IRES-Puro was constructed by subcloning of the HindIII-KpnI fragment of the pME-DsRed2-IRES-Puro vector into the pH1' vector. Oligonucleotides were cloned into pH1 vector to express small interference hairpin-loop (sih)GFP and sihNAP1 (two sites) hairpins downstream of the human H1 RNA promoter as described previously (18, 28). 5'-AAGCTAATAGCTCGATTTGAAGA-3' and 5'-AAGTGATAATATGCAGCATGCAT-3' were the sequences targeted for sihNAP1-A and sihNAP1-B, respectively. The target sequence for sihGFP has been described earlier (28).

HeLa cells were transfected with pH1-GFP, pH1-NAP1-A, or pH1-NAP1-B (100 nM/4 x 105 cells) using PolyFect (Qiagen). Bulk cell populations in 1 mg/ml puromycin were selected from which single colonies were picked up for further analysis. To determine the efficiency of gene silencing, total RNA from each clone was isolated with RNeasy (Qiagen) and mRNA was estimated by RT-PCR. The primers used for PCR were GAPDH primers, and NAP1-F and NAP1-R for NAP1 (18).

The method for gene silencing using siRNA oligonucleotides was described previously (23). The sequences of the siRNA for TICAM-1 (9), TBK1, IKK{epsilon} (15), RIG-I, and IPS-1 (MAVS) were reported previously (14). The target sequence for human MDA5 gene silencing is 5'- AAAUACCAUAAUGGAGCAAUA-3'. Knockdown was analyzed by RT-PCR.

Detection of human IFN-beta mRNA

RT-PCR and quantitative PCR (Q-PCR) were performed as described previously (23). Briefly, human cells were transfected with gene silencing or dominant-negative-expressing vectors (100 nM/4 x 105 cells) 24 h before infection. Cells were then infected with RSV (MOI = 1–2.5). Twenty-four hours later, total RNA was extracted from cells with RNeasy mini kit (Qiagen) and cDNA was generated by M-MLV-reverse transcriptase (Promega). cDNA was subjected to PCR using Ex-Taq DNA polymerase (Takara). For this study, previously described primer sets for IFN-beta, NAP1, and TICAM-1 for silencing, and GAPDH or beta-actin for internal control were used (9, 18, 23). Other primer sets for TBK1, IKK{epsilon}, RIG-I, MDA5, and IPS-1 were described in Table I. Q-PCR was performed with iQ SYBER Green Super mix and iCycler iQ real-time PCR analyzing system (Bio-Rad). The primers used for IFN-beta and beta-actin on the Q-PCR were described in Table I. The copy number of IFN-beta mRNA was normalized to beta-actin mRNA, and relative fold induction of the medium to control was determined.


View this table:
[in this window]
[in a new window]

 
Table I. Primer sets

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
NAP1 binds RIG-I and MDA5 in HEK293 transfectants

First, we tested whether RIG-I coprecipitates with NAP1 by immunoblotting using HEK293 cells. Cells were transfected with the indicated plasmids (Fig. 1A) and 24 h later solubilized with Nonidet P-40. NAP1 was immunoprecipitated with anti-myc Ab. Anti-Flag or anti-myc Ab was used as a probe for protein detection in immunoblotting. Flag-tagged RIG-I was shown to form a complex with myc-tagged NAP1 by analysis with SDS-PAGE followed by immunoblotting. RIG-I was identified together with NAP1 on the sheet, suggesting that RIG-I physically binds NAP1. Similar results were obtained with NAP1 and MDA5 (Fig. 1A). To confirm endogenous RIG-I physically binds NAP1, we used HeLa cells pretreated with IFN-beta (Fig. 1B). RIG-I was efficiently induced in HeLa cells 24 h after IFN treatment (inset of Fig. 1B) and pulled down with NAP1 by immunoprecipitation using the mAb against NAP1.


Figure 1
View larger version (41K):
[in this window]
[in a new window]

 
FIGURE 1. NAP1 interacts with RIG-I and MDA5. A and D, NAP1 associated with RIG-I and MDA5 in overexpression system. HEK293 cells were transiently transfected with expression vectors of NAP1 (A) or del-NAP1 (D) (myc-tagged), together with RIG-I or MDA5 (Flag-tagged) or empty vector, and allowed to stand for 24 h. Cells were then lysed and the lysates immunoprecipitated with anti-myc Ab. The precipitates were resolved on SDS-PAGE and transferred onto membrane. The blot was probed with anti-myc or anti-Flag Ab. Arrows indicate the positions of NAP1, RIG-I, and MDA5. Mr markers are shown to the left. B, Endogenous interaction between NAP1 and RIG-I. HeLa cells were pretreated with recombinant human IFN-beta for 24 h. Extracts from IFN-treated or nontreated HeLa cells were immunoprecipitated with indicated Ab. The blot was probed with anti-RIG-I pAb or anti-NAP1 mAb. *, Indicates the mouse Ig H chain and arrow indicates the NAP1 or RIG-I band. Data are representative of three (A and D) or two (B) independent experiments. C, A schematic diagram of NAP1. The region of NAP1 158 to 270 aa was directly associated with TBK1.

 
NAP1 (158–270) (NAP1 DN; NAP1 dominant negative) can directly bind TBK1 and serve as a dominant-negative form in TICAM-1-mediated IFN signaling (17, 18). We tested whether NAP1 deleted this region (158–270) (del-NAP1) (Fig. 1C) could still interact with RIG-I and MDA5. Del-NAP1 preserves the ability to bind RIG-I and MDA5. Both RIG-I and MDA5 coprecipitated with this NAP deletion mutant (Fig. 1D), suggesting that the RIG-I/MDA5 binding site is mapped outside the TBK1 binding site. Because the large amount of NAP1 present in human cells prevents overexpression analysis, NAP1 DN was used for the following experiments as a dominant negative for the IFN pathway.

RIG-I and MDA5 participate in the NAP1-mediated signaling

RIG-I and MDA5 contain two CARDs. The CARDs of RIG-I recruits a CARD-containing adapter IPS-1. The CARD domains of RIG-I (RIG-IN) and MDA5 (MDA5N) have been used in addition to RIG-I and MDA5 for signaling studies. IFN promoter was activated in cells expressing RIG-IN and to a lesser extent in cells with full-length RIG-I (Fig. 2A). In this context, MDA5 and MDA5N elicited comparable activities. When increasing doses of NAP1 DN were added to the cells with RIG-I, MDA5, or their mutants, IFN-beta promoter activation was prohibited by NAP1 DN in a dose-dependent manner (Fig. 2A). Using the Gal4-IRF-3 activation system, RIG-I- and MDA5-mediated IRF-3 activation was impaired in cells expressing NAP1 DN dose dependently (Fig. 2B). In the two systems, RIG-IN more potentially activated the promoters than intact RIG-I, whereas MDA5 and MDA5N exhibited similar tendencies (Fig. 2). Thus, the CARD domain of RIG-I induces activation of IRF-3 and IFN-beta promoter, both of which are regulated by NAP1. It is notable, although consistent with a previous report (22), that the full-length MDA5 that contains the helicase domain exhibited high IFN-inducing activity compared with the case of RIG-I. A functional link between RIG-I/MDA5 and NAP1 is confirmed by this analysis in addition to the physical linkage.


Figure 2
View larger version (29K):
[in this window]
[in a new window]

 
FIGURE 2. NAP1 participates in IRF-3, NF-{kappa}B, and IFN-beta promoter activation via RIG-I and MDA5. A, HEK293 cells were transfected with the dominant-negative form of NAP1 158–270 (NAP1 DN) and expression vector RIG-I, RIG-IN (left panel), MDA5 or MDA5N together with the IFN-beta promoter reporter plasmids. B, HEK293 cells were transiently transfected with p55-UASGLuc and pEF-GAL4/IRF-3, NAP1 DN, and empty vector, together with RIG-I, RIG-IN (left panel), MDA5 or MDA5N (right panel). After 24 h, luciferase reporter activity was measured and the relative firefly luciferase activity shown in normalized by Renilla luciferase activity. All data are representative of three independent experiments.

 
Physical association between NAP1 and IPS-1

We next examined the ability of NAP1 to recruit IPS-1 in HEK293 cell transfectants. By simple immunoprecipitation analysis, NAP1 managed to coprecipitate with IPS-1 (Fig. 3A). Because IPS-1 resides in the mitochondrial membrane (14), we homogenized the transfectants and collected the mitochondria-rich fraction. Similar blotting results were obtained using this fraction (data not shown). Because NAP1 is a cytoplasmic protein, we investigated the localization of NAP1 using myc-tagged NAP1 expressed in HeLa cells by confocal microscopy. NAP1 was distributed in cytoplasm, particularly located around mitochondria (Fig. 3B, upper panel). In contrast, TANK, which is a structural homologue of NAP1, barely merged with mitochondrial marker (Fig. 3B, lower panel). To test the localization of NAP1 and IPS-1, Flag-tagged IPS-1 and myc-tagged NAP1 were expressed in HeLa cells, and merging analysis by confocal microscopy was performed. We confirmed that IPS-1 is the mitochondrial protein using our construct (data not shown). IPS-1 recruited NAP1 in the vicinity of the membrane (Fig. 3C). The results indicate that NAP1, at least in part, forms a complex with IPS-1 to relay the IRF-3-activating signal, although the reason why IPS-1 and NAP1 marginally coprecipitate with each other on immunoblotting remains unknown (Fig. 3A).


Figure 3
View larger version (34K):
[in this window]
[in a new window]

 
FIGURE 3. NAP1 colocalizes with IPS-1 in mitochondria. A, Minute physical interaction between NAP1 and IPS-1. HEK293 cells were transfected with myc-tagged NAP1 and flag-tagged IPS-1. After 24 h of transfection, cell extracts were immunoprecipitated by anti-myc mAb. The precipitates were resolved on SDS-PAGE and transferred onto membrane. The blot was probed with anti-myc or anti-Flag Ab. Arrows indicate the positions of NAP1 and IPS-1. Mr markers are shown to the left. B, NAP1 partially located around mitochondria. HeLa cells onto coverslips were transfected with NAP1 or TANK (myc-tagged). Twenty-four hours after transfection, cells were incubated with Mito Tracker Red for 1 h. myc-tagged NAP1 or TANK were stained with anti-myc mAb and imaged by confocal microscopy. The yellow staining in the overlay indicates colocalization of NAP1 and Mito Tracker. C, NAP1 colocalized with IPS-1. HeLa cells onto coverslips were transfected with IPS-1 (Flag-tagged) and NAP1 (myc-tagged). Twenty-four hours after transfection, cells were stained with anti-myc mAb and anti-Flag pAb and imaged by confocal microscopy. Data are representative of four (A) or three (B) independent experiments.

 
Concomitant functional analysis suggested that NAP1 DN blocks the IPS-1-mediated IFN-beta promoter and IRF-3 activation (Fig. 4, A and B). Hence, there appear to be both physical and functional linkages between IPS-1 and NAP1. Thus, the results can be interpreted to most likely mean that the cytoplasmic (RIG-I/MDA5) and endosomal (TLR3) pathways converge on NAP1 to activate the IRF-3-activating kinases, leading to induction of IFN-beta.


Figure 4
View larger version (12K):
[in this window]
[in a new window]

 
FIGURE 4. NAP1 DN-interfered IFN-beta promoter and IRF-3 activation by IPS-1. A, HEK293 cells were transfected with the NAP1 DN and expression vector for IPS-1 together with the IFN-beta promoter reporter plasmids. Cells were analyzed 24 h after transfection for promoter activity by a reporter gene assay. B, HEK293 cells were transiently transfected with p55-UASGLuc and pEF-GAL4/IRF3 and NAP1 DN together with empty vector or expression vector for IPS-1. Twenty-four hours after transfection, cells were collected and the promoter activation was measured by reporter gene assay. All data are representative of three independent experiments.

 
NAP1 DN and NAP1 decrease mediated inhibition of IFN induction by viral infection

Virus-mediated IRF-3 activation was examined with poly(I:C), VSV (Figs. 5 and 6), and RSV (Fig. 7), which are reported to activate cytoplasmic RIG-I and extracytoplasmic TLR3, respectively, to induce IFN promoter activation. Poly(I:C) is a reagent that activates the cytoplasmic IFN-inducing pathway in human cells in the presence of DEAE-dextran (Fig. 5A). HEK293 cells transfected with poly(I:C) using DEAE-dextran barely activated the IFN-beta promoter in the reporter assay (left-side bars in Fig. 5A). When RIG-I and MDA5 were transfected into the cells before poly(I:C) stimulation, IFN-beta promoter was activated by transfected poly(I:C), and NAP1-DN blocked those IFN-beta promoter activation (Fig. 5A) and IRF-3 activation (data not shown). MDA5 prominently activated the IFN promoter compared with RIG-I, and this activity was efficiently impaired by cotransfection of NAP1 DN (Fig. 5A). Similar NAP1 DN-mediated suppression of IFN-beta promoter activation was observed in cells without poly(I:C) (Fig. 5A), although the magnitude of the promoter activation was far less. A pervious study (29) demonstrated that VSV activates RIG-I in infected cells. VSV was subjected to the HEK293 cells instead of poly(I:C), and IRF-3 activation was tested in the reporter (data not shown) and native gel analyses (Fig. 5B). Under the conditions where IRF-3 is activated in response to VSV, NAP1 DN inhibited VSV-mediated IRF-3 activation in a dose-dependent manner (Fig. 5B). Thus, the results infer that RIG-I/MDA5 interacts with NAP1 in the virus-derived IFN-inducing pathway.


Figure 5
View larger version (29K):
[in this window]
[in a new window]

 
FIGURE 5. NAP1 DN inhibits IRF-3 activation. A, HEK293 cells were transfected with IFN-beta promoter reporter plasmid together with the plasmids of RIG-I or MDA5 (100 ng) and NAP1 DN. Twenty-four hours after transfection, cells were transfected with dextran-only (nonstimulated) or poly(I:C)-mixed dextran for 6 h. B, HEK293 cells were transfected with NAP1 DN and cultured for 24 h. Cells were infected with VSV (MOI = 10) for 8 h. Extracts were subjected to native PAGE according to the reported method. Relative signal intensities of the dimer are shown below the lanes. These data are representative of three (A) or two (B) independent experiments.

 

Figure 6
View larger version (28K):
[in this window]
[in a new window]

 
FIGURE 6. Implication of NAP1 in VSV infection-mediated IFN-beta induction. A, NAP1 stable knockdown HeLa cells generate low levels of IFN-beta mRNA in VSV infection. HeLa clones with the stably silencing NAP1 gene (data shown for pH1-NAP-A clone-1) or empty vector (control) were infected with VSV (MOI = 10) for 12 h. Total RNA was prepared, and RT-PCR analysis was performed with specific primers for NAP1, IFN-beta, and GAPDH. B, NAP1-mediated IRF-3 activation in VSV infection. Stable NAP1-silenced HeLa cells (5.0 x 105 cells, pH1-NAP1-A clone-1) were infected with VSV (MOI = 10) for 8 h. Extracts were resolved by native gel electrophoresis. Dimerization of IRF-3 was detected by immunoblotting. C, VSV-mediated IFN-beta induction is suppressed by NAP1 gene silencing. HeLa clones stably depleting NAP1 (clone-1 and clone-2 for sih-NAP1-A and a clone for sih-NAP1-B) or expressing siRNA against GFP (sih-GFP clone-1 and clone-2) were infected with VSV (MOI = 10) for 12 h. The IFN-beta mRNA levels were determined with these cells by Q-PCR. Data are representative of two (B) or three (C) independent experiments.

 

Figure 7
View larger version (36K):
[in this window]
[in a new window]

 
FIGURE 7. NAP1 is involved in IFN-beta induction by RSV infection. A, HeLa cells were transfected with siRNA silencing for GFP, TICAM-1, IKK{epsilon}, or TBK1. The indicated mRNAs levels shown after gene silencing were analyzed by RT-PCR. Cells were treated with RSV (MOI = 1 for 48 h) or poly(I:C) (10 µg/ml). Cells were lysed and mRNA levels of IFN-beta were determined by Q-PCR. B, HeLa cells were transfected with siRNA silencing for GFP, RIG-I, MDA5, or IPS-1. The indicated mRNAs levels shown after gene silencing were analyzed by RT-PCR. Cells were treated with RSV (MOI = 2.5 for 48 h). C, HeLa stable clones of silencing NAP1 or GFP gene were infected with RSV (MOI = 1 for 48 h). The mRNAs levels of the cells are shown by RT-PCR. The mRNA levels of IFN-beta were determined after RSV infection by Q-PCR. {blacksquare}, GFP-silencing cells; {square}, NAP1-silencing cells. D, HEK293 cells were transiently transfected with the dominant-negative form of NAP1 or Mal/TIRAP. Twenty-four hours after transfection, cells were infected with RSV (MOI = 1 for 36 h). The mRNA levels of IFN-beta in infected transfectants were measured as per A. Data are representative of two (A–C) or three (D) independent experiments.

 
HeLa cell clones with stable gene silencing of NAP1 were established in an effort to confirm the essential role of NAP1 in virus-mediated IFN-beta induction (Fig. 6A). IRF-3 dimer formation by VSV was apparently reduced in the NAP1-deficient cells (Fig. 6B). Concomitantly, the level of IFN-beta mRNA was decreased in the NAP1-deficient cells (Fig. 6C). In this experiment, HeLa cell clones with the vector containing GFP siRNA were used as controls. Two NAP1-depleting clones of one target’s site (site-A) and one depleting clone of another target site (site-B) showed similar low responses to VSV in IFN-beta induction compared with the control (Fig. 6C), which excludes the possibility of artificial clonal effect. These results, together with the fact that VSV replication allows human cells to produce IFN-beta in a RIG-I-dependent manner (29), suggest that NAP1 is indispensable to RIG-I-mediated IFN induction.

RSV is known to induce TLR3 responses in epithelial cells. RSV was used instead of VSV to confirm the effect on virus-activated IFN-beta promoter activation in HeLa cells (Fig. 7). NAP1 as well as TICAM-1, IKK{epsilon}, and TBK1 were silenced with siRNA, and the IFN-beta mRNA levels were then measured in RSV-infected cells. Cells stimulated with poly(I:C) were used as control for the TICAM-1 pathway. As expected and consistent with previous reports, poly(I:C)-dependent IFN-beta mRNA was found to be dependent on TICAM-1, IKK{epsilon}, and TBK1 (Fig. 7A). Notably, TICAM-1 silencing had no down-regulation effect on the IFN-beta mRNA level, whereas IKK{epsilon} and TBK1 were associated with RSV-mediated IFN induction (Fig. 7A). The IFN-beta mRNA levels were evaluated 48 h after RSV infection in cells silencing of RIG-I, MDA5, or IPS-1. The IFN-beta mRNA induction was most prominently impaired in cells depleted of RIG-I or IPS-1 (Fig. 7B). When NAP1 was silenced, 40% of the IFN-beta mRNA level was reduced in the cells stimulated with poly(I:C) within 6 h (cells die during long-term incubation with poly(I:C)) (data not shown). In this system, RSV infection resulted in a 50% decrease of the NAP1-mediated IFN-beta induction (Fig. 7C). To further confirm the involvement of NAP1 in the virus-mediated IFN-beta-inducing pathway, we used the dominant-negative transfectants (Fig. 7D). No reduction of the IFN-beta mRNA level was observed with the Mal/TIRAP dominant-negative-expressing HEK cells, whereas the IFN-beta mRNA level was significantly decreased in cells expressing the NAP1 DN. Thus, RSV induces IFN-beta independent of TICAM-1 but dependent on RIG-I, IPS-1, virus-activated kinases, and NAP1.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In this study, we demonstrated that the CARD-helicase pattern-recognition receptors activate IRF-3 and the IFN promoter through NAP1, the regulatory subunit of the kinase complex IKK{epsilon} and TBK1. The kinases IKK{epsilon} and TBK1 are known to be virus-activated kinases (16) and are located downstream of TICAM-1 (also known as TRIF) (15). A previous study (18) revealed that NAP1 is also involved in a molecular complex containing TICAM-1. The N-terminal region out of the TIR domain of TICAM-1 participates in NAP1 recruitment. Thus, NAP1 works in the two different pathways for dsRNA-mediated IFN-beta induction, TLR3/TLR4 followed by the TICAM-1 pathway and RIG-I/MDA5 followed by the IPS-1 pathway.

The results were consolidated with virus infection studies. RSV as well as VSV induces IFN-beta in infected cells, and these viral IFN-inducing activities were blocked by NAP1 DN or siRNA, suggesting that NAP1 participates in virus-activated IRF-3 and IFN-beta induction. NAP1 is implicated in the intracytoplasmic IFN-beta-inducing signal in physical proximity to the molecular complex containing RIG-I and MDA5. Hence, NAP1 connects RNA sensor proteins (TLR3, RIG-I, and MDA5) and kinases to activate IRF-3. This scenario would be suitable to the findings of previous studies on IFN-beta induction by cells with exogenously added poly(I:C) (18) and with replicated viruses (29).

NAP1 assembles IKK{epsilon} and TBK1 to form a kinase complex (17). This kinase complex participates in activation of not only IRF-3 but also NF-{kappa}B. Actually, we have evidence that overexpression of RIG-I (particularly RIG-IN) or MDA5 in HEK cells results in activation of NF-{kappa}B and, under this situation, NAP1 DN blocks the NF-{kappa}B activation through RIG-I/MDA5 (data not shown). NF-{kappa}B activation through TNF-{alpha} receptors, however, revealed to involve two additional kinases, IKK{alpha} and IKKbeta (30). Furthermore, two additional subunits, TANK and IKK{gamma}, may affect the level of NF-{kappa}B activation (31). TLR4 as well as other TLRs principally activate NF-{kappa}B through IKK{gamma} and a kinase complex with IKK{alpha} and IKKbeta (32). In activation of NF-{kappa}B via NAP1, what combinations of the four kinases preferentially join the NAP1 protein complex still remains undetermined. Accordingly, molecular configuration of the kinase complex for activation of NF-{kappa}B remains to be defined downstream of IPS-1.

Using two species of viruses, VSV and RSV, RIG-I/MDA5 is evidently responsible for sensing viral infection to induce IFN-beta. Previous reports have indicated that VSV stimulates the RIG-I pathway (33) and RSV induces TLR3 up-regulation and responses including cytokine/chemokine secretion in airway epithelial cells (4, 5, 20) Our gene silencing studies using siRNA (Fig. 7) and the RSV strain (an IFN-inducible strain) suggest that RIG-I is a key molecule in RSV-mediated IFN-beta induction in HeLa cells. MDA5 or TLR3 minimally participates in RSV sensing, if any, in this in vitro study. VSV, a representative of the RIG-I-activating virus, confers a similar IFN-inducing profile to the RSV strain.

Hence, the involvement of TLR3 in the induction of type I IFN by RSV may reflect a secondary response resulting from TLR3 up-regulation by the initial production of IFN-beta in virtue of RIG-I. We previously showed that NAP1 but not TANK interacts with TICAM-1 in the TLR3 pathway (18). Preferential recognition of RSV replication by RIG-I with no involvement of TLR3 and TICAM-1 appears to be additional evidence that NAP1 plays a major role downstream of RIG-I and outcome of viral infection. Because the results were obtained with HeLa and HEK293 cells in an acute-phase infection, this result should be confirmed with a cell line of bronchial epithelial cells and in vivo animal models.

However, it remains in question why IPS-1 only marginally coprecipitates with NAP1 in this study. According to the confocal analysis, NAP1 merges with IPS-1 on mitochondria. The discrepancy may be explained by the activation-induced mobility of IPS-1. IPS-1 overexpression leads to activation of the IFN-beta promoter (Fig. 4A; Refs. 12, 13) and shows a merging profile with NAP1. A previous study (14) suggests that IPS-1 moves from a detergent-soluble to detergent-insoluble fraction in mitochondria following virus infection. The transposition of IPS-1 on the mitochondrial membrane may affect the dynamics of the cytoplasmic protein NAP1. So far, we have not yet established the system to see the molecular interaction between endogenous NAP1 and IPS-1. Maybe, the question lies in the artificial overexpression system. We favor the idea that IPS-1 forms a complex with NAP1, but the complex is fragile depending on the conditions where IPS-1 is disposed or solubilized from the mitochondrial membrane. Alternatively, NAP1 may only temporally bind IPS-1 on the mitochondrial membrane in initiating the pathway that activates IRF-3 in human cells. In this context, it is of interest to see the effect of viral infection on the molecular association between NAP1 and IPS-1.

Two further points remain to be discussed. First, our previous immunoprecipitation studies suggested that TICAM-1 forms a complex with NAP1 (18), whereas IPS-1 barely joins the complex containing TICAM-1 (data not shown). NAP1 coprecipitates with TICAM-1 irrespective of poly(I:C) activation of TLR3 (18). However, NAP1 does not merge with intrinsic TICAM-1 (data not shown), but with IPS-1 (Fig. 3C) largely around the mitochondria as shown by confocal analysis. The localization pattern of NAP1 is mysterious but may reflect the differential properties between TICAM-1 and IPS-1. Human cells mostly have a low level of TICAM-1 and a high level of IPS-1, and the level of TICAM-1 protein expression is usually suppressed because of its apoptosis-inducing properties (34). TICAM-1 undergoes protein modifications in response to poly(I:C) stimulation (M. Sasai and T. Seya, unpublished data), which may be a prerequisite for the recruitment of NAP1.

Secondly, RIG-I and MDA5 have been shown to be responsible for intracellular viral dsRNA recognition (33). They are cytoplasmic proteins of the CARD-helicase-containing family (22). RIG-I without a helicase domain (RIG-IN) acts as a constitutively active IFN inducer in transfected cells, whereas MDA5 expresses full IFN-inducing activity regardless of its helicase domain. The manner of ligand recognition may be somewhat different in each. Why RIG-I mainly participated in recognition of VSV/RSV infection is unknown. After completing this study, a report (29) was published showing that MDA5 preferentially recognizes poly(I:C) and the replicated RNAs of picornaviruses, whereas RIG-I recognizes transcribed dsRNAs of many RNA viruses. Although the report did not mention the natural ligand of MDA5, it offers evidence that MDA5 and RIG-I discriminate between the dsRNA structures (29). Because RSV is a negative-strand RNA virus, it may hold a RNA structural motif inducing activation of RIG-I common to other negative-strand RNA viruses (35).

Pattern recognition molecules besides TLR3 and the CARD-helicase proteins are engaged in foreign RNA sensing in human cells. For example, TLR7 and TLR8 are expressed in human plasmacytoid DCs and mDCs, respectively (36). PKR is a receptor for dsRNA recognition (37). Generation of dsRNA may link to the pathway for inducing RNAi even in human cells. Why the host provides a variety of RNA pattern-recognition receptors and nonself RNA responses will be the issue to be clarified. Another point is that viral factors other than RNA have some host-immune-modulating functions. Measles nucleoproteins may modulate a Fc{gamma} receptor-mediated immune response (38) and IRF-3 activation (39), which clearly occur independent of dsRNA or RNA replication. A recent report (40) suggests that negative-strand RNA viruses produce only undetectable amounts of dsRNA in infected cells. Although RIG-I is a key molecule in host protection against a number of RNA virus infections, other molecules and systems may be involved in host strategies against virus infection.


    Acknowledgments
 
We are grateful to Drs. A. Ishii, T. Ebihara, and A. Matsuo in our laboratory for their critical discussions. Thanks are also due to Dr. K. Imai (Wakayama Prefectural Center, Wakayama, Japan) for providing us with RSV and to Drs. T. Fujita (Kyoto University, Kyoto, Japan), K. Miyake (Tokyo University, Tokyo, Japan), M. Nakanishi (the Nagoya City University, Nagoya, Japan), and T. Maniatis (Harvard Univeresity, Boston, MA) for providing their plasmids. Dr. Boru (Pacific Edit) reviewed this manuscript before submission.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by Core Research for Engineering, Science, and Technology, Japan Science and Technology Corporation, by Grants-in-Aid from the Ministry of Education, Science, and Culture (Specified Project for Advanced Research) and the Hepatitis C Virus project in National Institutes of Health of Japan, and by the Naito Memorial Foundation, Uehara Memorial Foundation, Mitsubishi Foundation, and Osaka Community Foundation. M.Sa. is supported by fellowships from the Japanese Society for the Promotion of Science. Back

2 Address correspondence and reprint requests to Dr. Tsukasa Seya, Department of Microbiology and Immunology, Graduate School of Medicine, Hokkaido University, Kita-ku, Sapporo 060-8638, Japan. E-mail address: seya-tu{at}pop.med.hokudai.ac.jp Back

3 Abbreviations used in this paper: RIG-I, retinoic acid-inducible gene I; mDC, myeloid dendritic cell; MDA5, melanoma differentiation-associated gene 5; IRF, IFN regulatory factor; RSV, respiratory syncytial virus; TICAM-1, Toll-IL-1R homology domain-containing adapter molecule 1; TRIF, Toll/IL-1R domain-containing adapter-inducing IFN-beta; IPS-1, IFN-beta promoter stimulator 1; MAVS, mitochondria antiviral signaling; IKK{epsilon}, I{kappa}B kinase-related kinase {epsilon}; TBK1, TANK-binding kinase 1; NAP1, NAK-associated protein 1; RNAi, RNA interference; pAb, polyclonal Ab; TIRAP, Toll/IL-1R domain-containing adaptor protein; CARD, caspase activation and recruitment domain; VSV, vesicular stomatitis virus; MOI, multiplicity of infection; siRNA, small interference RNA; IRES, internal ribosome entry site; sih, small interference hairpin-loop; Q-PCR, quantitative PCR; NAP1 DN, NAP1 dominant negative. Back

Received for publication May 3, 2006. Accepted for publication September 20, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Akira, S., S. Uematsu, O. Takeuchi. 2006. Pathogen recognition and innate immunity. Cell 124: 783-801. [Medline]
  2. Yoneyama, M., M. Kikuchi, T. Natsukawa, N. Shinobu, T. Imaizumi, M. Miyagishi, K. Taira, S. Akira, T. Fujita. 2004. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat. Immunol. 5: 730-737. [Medline]
  3. Matsumoto, M., K. Funami, M. Tanabe, H. Oshiumi, M. Shingai, Y. Seto, A. Yamamoto, T. Seya. 2003. Subcellular localization of Toll-like receptor 3 in human dendritic cells. J. Immunol. 171: 3154-3162. [Abstract/Free Full Text]
  4. Rudd, B. D., J. J. Smit, R. A. Flavell, L. Alexopoulou, M. A. Schaller, A. Gruber, A. A. Berlin, N. W. Lukacs. 2006. Deletion of TLR3 alters the pulmonary immune environment and mucus production during respiratory syncytial virus infection. J. Immunol. 176: 1937-1942. [Abstract/Free Full Text]
  5. Groskreutz, D. J., M. M. Monick, L. S. Powers, T. O. Yarovinsky, D. C. Look, G. W. Hunninghake. 2006. Respiratory syncytial virus induces TLR3 protein and protein kinase R, leading to increased double-stranded RNA responsiveness in airway epithelial cells. J. Immunol. 176: 1733-1740. [Abstract/Free Full Text]
  6. Guillot, L., R. Le Goffic, S. Bloch, N. Escriou, S. Akira, M. Chignard, M. Si-Tahar. 2005. Involvement of Toll-like receptor 3 in the immune response of lung epithelial cells to double-stranded RNA and influenza A virus. J. Biol. Chem. 280: 5571-5580. [Abstract/Free Full Text]
  7. Hall, C. B., K. R. Powell, N. E. MacDonald, C. L. Gala, M. E. Menegus, S. C. Suffin, H. J. Cohen. 1986. Respiratory syncytial viral infection in children with compromised immune function. N. Engl. J. Med. 315: 77-81. [Abstract]
  8. Yamamoto, M., S. Sato, H. Hemmi, K. Hoshino, T. Kaisho, H. Sanjo, O. Takeuchi, M. Sugiyama, M. Okabe, K. Takeda, S. Akira. 2003. Role of adaptor TRIF in the MyD88-independent Toll-like receptor signaling pathway. Science 301: 640-643. [Abstract/Free Full Text]
  9. Oshiumi, H., M. Matsumoto, K. Funami, T. Akazawa, T. Seya. 2003. TICAM-1, an adaptor molecule that participates in Toll-like receptor 3-mediated interferon-beta induction. Nat. Immunol. 4: 161-167. [Medline]
  10. McWhirter, S. M., B. R. Tenoever, T. Maniatis. 2005. Connecting mitochondria and innate immunity. Cell 122: 645-647. [Medline]
  11. Meylan, E., J. Curran, K. Hofmann, D. Moradpour, M. Binder, R. Bartenschlager, J. Tschopp. 2005. Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus. Nature 437: 1167-1172. [Medline]
  12. Kawai, T., K. Takahashi, S. Sato, C. Coban, H. Kumar, H. Kato, K. J. Ishii, O. Takeuchi, S. Akira. 2005. IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction. Nat. Immunol. 6: 981-988. [Medline]
  13. Xu, L. G., Y. Y. Wang, K. J. Han, L. Y. Li, Z. Zhai, H. B. Shu. 2005. VISA is an adapter protein required for virus-triggered IFN-beta signaling. Mol. Cell 19: 727-740. [Medline]
  14. Seth, R. B., L. Sun, C. K. Ea, Z. J. Chen. 2005. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-{kappa}B and IRF 3. Cell 122: 669-682. [Medline]
  15. Fitzgerald, K. A., S. M. McWhirter, K. L. Faia, D. C. Rowe, E. Latz, D. T. Golenbock, A. J. Coyle, S. M. Liao, T. Maniatis. 2003. IKK{epsilon} and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 4: 491-496. [Medline]
  16. Sharma, S., B. R. tenOever, N. Grandvaux, G. P. Zhou, R. Lin, J. Hiscott. 2003. Triggering the interferon antiviral response through an IKK-related pathway. Science 300: 1148-1151. [Abstract/Free Full Text]
  17. Fujita, F., Y. Taniguchi, T. Kato, Y. Narita, A. Furuya, T. Ogawa, H. Sakurai, T. Joh, M. Itoh, M. Delhase, et al 2003. Identification of NAP1, a regulatory subunit of I{kappa}B kinase-related kinases that potentiates NF-{kappa}B signaling. Mol. Cell. Biol. 23: 7780-7793. [Abstract/Free Full Text]
  18. Sasai, M., H. Oshiumi, M. Matsumoto, N. Inoue, F. Fujita, M. Nakanishi, T. Seya. 2005. Cutting Edge: NF-{kappa}B-activating kinase-associated protein 1 participates in TLR3/Toll-IL-1 homology domain-containing adapter molecule-1-mediated IFN regulatory factor 3 activation. J. Immunol. 174: 27-30. [Abstract/Free Full Text]
  19. Sasai, M., M. Matsumoto, T. Seya. 2006. The kinase complex responsible for IRF-3-mediated IFN-beta production in myeloid dendritic cells (mDC). J. Biochem. 139: 171-175. [Abstract/Free Full Text]
  20. Rudd, B. D., E. Burstein, C. S. Duckett, X. Li, N. W. Lukacs. 2005. Differential role for TLR3 in respiratory syncytial virus-induced chemokine expression. J. Virol. 79: 3350-3357. [Abstract/Free Full Text]
  21. Yoneyama, M., W. Suhara, Y. Fukuhara, M. Fukuda, E. Nishida, T. Fujita. 1998. Direct triggering of the type I interferon system by virus infection: activation of a transcription factor complex containing IRF-3 and CBP/p300. EMBO J. 17: 1087-1095. [Medline]
  22. Yoneyama, M., M. Kikuchi, K. Matsumoto, T. Imaizumi, M. Miyagishi, K. Taira, E. Foy, Y. M. Loo, M. Gale, Jr, S. Akira, et al 2005. Shared and unique functions of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity. J. Immunol. 175: 2851-2858. [Abstract/Free Full Text]
  23. Oshiumi, H., M. Sasai, K. Shida, T. Fujita, M. Matsumoto, T. Seya. 2003. TIR-containing adapter molecule (TICAM)-2, a bridging adapter recruiting to Toll-like receptor 4 TICAM-1 that induces interferon-beta. J. Biol. Chem. 278: 49751-49762. [Abstract/Free Full Text]
  24. Iwamura, T., M. Yoneyama, K. Yamaguchi, W. Suhara, W. Mori, K. Shiota, Y. Okabe, H. Namiki, T. Fujita. 2001. Induction of IRF-3/-7 kinase and NF-{kappa}B in response to double-stranded RNA and virus infection: common and unique pathways. Genes Cells 6: 375-388. [Abstract]
  25. Funami, K., M. Matsumoto, H. Oshiumi, T. Akazawa, A. Yamamoto, T. Seya. 2004. The cytoplasmic ‘linker region’ in Toll-like receptor 3 controls receptor localization and signaling. Int. Immunol. 16: 1143-1154. [Abstract/Free Full Text]
  26. Murabayashi, N., M. Kurita-Taniguchi, M. Ayata, M. Matsumoto, H. Ogura, T. Seya. 2002. Susceptibility of human dendritic cells (DCs) to measles virus (MV) depends on their activation stages in conjunction with the level of CDw150: role of Toll stimulators in DC maturation and MV amplification. Microbes Infect. 4: 785-794. [Medline]
  27. Spielhofer, P., T. Bachi, T. Fehr, G. Christiansen, R. Cattaneo, K. Kaelin, M. A. Billeter, H. Y. Naim. 1998. Chimeric measles viruses with a foreign envelope. J. Virol. 72: 2150-2159. [Abstract/Free Full Text]
  28. Hasuwa, H., K. Kaseda, T. Einarsdottir, M. Okabe. 2002. Small interfering RNA and gene silencing in transgenic mice and rats. FEBS Lett. 532: 227-230. [Medline]
  29. Kato, H., O. Takeuchi, S. Sato, M. Yoneyama, M. Yamamoto, K. Matsui, S. Uematsu, A. Jung, T. Kawai, K. J. Ishii, et al 2006. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441: 101-105. [Medline]
  30. Peters, R. T., T. Maniatis. 2001. A new family of IKK-related kinases may function as I{kappa}B kinase kinases. Biochim. Biophys. Acta 1471: M57-M62. [Medline]
  31. Rothe, M., J. Xiong, H. B. Shu, K. Williamson, A. Goddard, D. V. Goeddel. 1996. I-TRAF is a novel TRAF-interacting protein that regulates TRAF-mediated signal transduction. Proc. Natl. Acad. Sci. USA 93: 8241-8246. [Abstract/Free Full Text]
  32. Akira, S., K. Takeda, T. Kaisho. 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2: 675-680. [Medline]
  33. Kawai, T., S. Akira. 2006. Innate immune recognition of viral infection. Nat. Immunol. 7: 131-137. [Medline]
  34. Han, K. J., X. Su, L. G. Xu, L. H. Bin, J. Zhang, H. B. Shu. 2004. Mechanisms of TRIF-induced ISRE and NF-{kappa}B activation and apoptosis pathways. J. Biol. Chem. 279: 15652-15661. [Abstract/Free Full Text]
  35. Melchjorsen, J., S. B. Jensen, L. Malmgaard, S. B. Rasmussen, F. Weber, A. G. Bowie, S. Matikainen, S. R. Paludan. 2005. Activation of innate defense against a paramyxovirus is mediated by RIG-I and TLR7 and TLR8 in a cell-type-specific manner. J. Virol. 79: 12944-12951. [Abstract/Free Full Text]
  36. Iwasaki, A., R. Medzhitov. 2004. Toll-like receptor control of the adaptive immune responses. Nat. Immunol. 5: 987-995. [Medline]
  37. Mogensen, T. H., S. R. Paludan. 2005. Reading the viral signature by Toll-like receptors and other pattern recognition receptors. J. Mol. Med. 83: 180-192. [Medline]
  38. Marie, J. C., F. Saltel, J. M. Escola, P. Jurdic, T. F. Wild, B. Horvat. 2004. Cell surface delivery of the measles virus nucleoprotein: a viral strategy to induce immunosuppression. J. Virol. 78: 11952-11961. [Abstract/Free Full Text]
  39. tenOever, B. R., M. J. Servant, N. Grandvaux, R. Lin, J. Hiscott. 2002. Recognition of the measles virus nucleocapsid as a mechanism of IRF-3 activation. J. Virol. 76: 3659-3669. [Abstract/Free Full Text]
  40. Weber, F., V. Wagner, S. B. Rasmussen, R. Hartmann, S. R. Paludan. 2006. Double-stranded RNA is produced by positive-strand RNA viruses and DNA viruses but not in detectable amounts by negative-strand RNA viruses. J. Virol. 80: 5059-5064. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. S. Mikkelsen, S. B. Jensen, S. Chiliveru, J. Melchjorsen, I. Julkunen, M. Gaestel, J. S. C. Arthur, R. A. Flavell, S. Ghosh, and S. R. Paludan
RIG-I-mediated Activation of p38 MAPK Is Essential for Viral Induction of Interferon and Activation of Dendritic Cells: DEPENDENCE ON TRAF2 AND TAK1
J. Biol. Chem., April 17, 2009; 284(16): 10774 - 10782.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Oshiumi, M. Matsumoto, S. Hatakeyama, and T. Seya
Riplet/RNF135, a RING Finger Protein, Ubiquitinates RIG-I to Promote Interferon-{beta} Induction during the Early Phase of Viral Infection
J. Biol. Chem., January 9, 2009; 284(2): 807 - 817.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Tamassia, V. Le Moigne, M. Rossato, M. Donini, S. McCartney, F. Calzetti, M. Colonna, F. Bazzoni, and M. A. Cassatella
Activation of an Immunoregulatory and Antiviral Gene Expression Program in Poly(I:C)-Transfected Human Neutrophils
J. Immunol., November 1, 2008; 181(9): 6563 - 6573.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Matsuo, H. Oshiumi, T. Tsujita, H. Mitani, H. Kasai, M. Yoshimizu, M. Matsumoto, and T. Seya
Teleost TLR22 Recognizes RNA Duplex to Induce IFN and Protect Cells from Birnaviruses
J. Immunol., September 1, 2008; 181(5): 3474 - 3485.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. Shingai, M. Azuma, T. Ebihara, M. Sasai, K. Funami, M. Ayata, H. Ogura, H. Tsutsumi, M. Matsumoto, and T. Seya
Soluble G protein of respiratory syncytial virus inhibits Toll-like receptor 3/4-mediated IFN-beta induction
Int. Immunol., September 1, 2008; 20(9): 1169 - 1180.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Funami, M. Sasai, H. Oshiumi, T. Seya, and M. Matsumoto
Homo-oligomerization Is Essential for Toll/Interleukin-1 Receptor Domain-containing Adaptor Molecule-1-mediated NF-{kappa}B and Interferon Regulatory Factor-3 Activation
J. Biol. Chem., June 27, 2008; 283(26): 18283 - 18291.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Zhang, Y. K. Chan, B. Lu, M. S. Diamond, and R. S. Klein
CXCR3 Mediates Region-Specific Antiviral T Cell Trafficking within the Central Nervous System during West Nile Virus Encephalitis
J. Immunol., February 15, 2008; 180(4): 2641 - 2649.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
R. E. Randall and S. Goodbourn
Interferons and viruses: an interplay between induction, signalling, antiviral responses and virus countermeasures
J. Gen. Virol., January 1, 2008; 89(1): 1 - 47.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Shingai, T. Ebihara, N. A. Begum, A. Kato, T. Honma, K. Matsumoto, H. Saito, H. Ogura, M. Matsumoto, and T. Seya
Differential Type I IFN-Inducing Abilities of Wild-Type versus Vaccine Strains of Measles Virus
J. Immunol., November 1, 2007; 179(9): 6123 - 6133.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Matsumiya, S. M. Prescott, and D. M. Stafforini
IFN-{epsilon} Mediates TNF-{alpha}-Induced STAT1 Phosphorylation and Induction of Retinoic Acid-Inducible Gene-I in Human Cervical Cancer Cells
J. Immunol., October 1, 2007; 179(7): 4542 - 4549.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
T. Ebihara, H. Masuda, T. Akazawa, M. Shingai, H. Kikuta, T. Ariga, M. Matsumoto, and T. Seya
Induction of NKG2D ligands on human dendritic cells by TLR ligand stimulation and RNA virus infection
Int. Immunol., October 1, 2007; 19(10): 1145 - 1155.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sasai, M.
Right arrow Articles by Seya, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sasai, M.
Right arrow Articles by Seya, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS