|
|
||||||||










,
,
,
,¶
* Functional Genomics Laboratory,
Arizona Respiratory Center, and Departments of
Pediatrics,
Pharmacology, and
¶ Cell Biology, College of Medicine, University of Arizona, Tucson, AZ 85724
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Analysis of genetic variation across the IL13 locus in European ancestry subjects identified a block of common single nucleotide polymorphisms (SNPs)6 in complete linkage disequilibrium (LD) extending from IL13-1923C>T in the third intron to IL13-2749C>T in the 3' untranslated region (12). This block includes IL13-2044G>A, a coding SNP resulting in the expression of a gain-of-function variant (IL-13 R130Q; Ref. 13) strongly associated with allergic inflammation in several ethnically distinct populations (14). This polymorphism is also in high, albeit not complete, LD with two promoter polymorphisms, IL13-1512A>C and IL13-1112C>T (rs1800925, also referred to as 1055 and 1111) (12). The IL13-1112TT genotype was more prevalent in individuals with asthma and atopic dermatitis and has been associated with increased risk of sensitization to food and outdoor allergens in several studies (15, 16, 17, 18). Associations between the IL13-1112T allele and allergic phenotypes, such as high IgE serum levels, bronchial hyperresponsiveness and positive skin tests, have also been demonstrated (12, 15, 18).
Although these results strongly suggest that genetic dysregulation of IL13 expression and/or function may be a critical determinant of susceptibility to allergy and asthma, the extensive LD at the IL13 locus prevents the tools of genetic epidemiology from deciphering the contribution of individual polymorphisms to increased disease risk. Stratified analysis of IL13 haplotypes in a large Caucasian population did suggest an effect of IL13-1112C>T on IgE levels independent of IL13-2044G>A (19), but functional studies are required to characterize the impact of IL13-1112C>T on the regulation of IL13 expression.
To this purpose, we used a combination of in vivo, in vitro, and in silico approaches. We show herein that IL13-1112C>T is a functional polymorphism that results in increased IL13 transcription in primary Th2 cells through Yin-Yang 1 (YY1)-dependent attenuation of STAT6-mediated promoter repression. Analyses in a large population confirmed that IL-13 secretion was increased in IL13-1112TT homozygotes, suggesting that increased expression of the IL13-1112T allele may underlie its association with increased susceptibility to allergic inflammation.
| Materials and Methods |
|---|
|
|
|---|
The IL13 promoter was sequenced in genomic DNA samples (Coriell Cell Repository) from 12 primate species consisting of hominoids, Old World and New World monkeys. PCR primers for amplifying the primate promoters were designed based on the human IL13 sequence (GenBank accession No. AC004041 and L42080). Phylogenetic shadowing (20) was conducted using a multiple sequence alignment of human and primate sequences by Clustal W, and conservation plots were generated with eShadow (www.eshadow.dcode.org) (21). Settings were a 25-bp sliding window, 800-bp layer, default Hidden Markov Model Islands (0.85/0.77/0.1), and a divergence threshold (DT) of 15% variation within a minimum length of 70 bp (DT 15/70).
T cell isolation and culture
Human naive cord blood CD45ROCD4+ T cells were obtained by negative selection and depletion of memory T cells using Ab against CD45RO (Miltenyi Biotec). Purity was typically
95%. All cytokines and mAbs were from R&D Systems, unless otherwise specified. Cells were primed for 4 days with plate-bound anti-CD3 mAb (UCHT1, 2 µg/ml) and soluble anti-CD28 mAb (1 µg/ml) under Th2 polarizing conditions (recombinant human (rh) IL-2, 5 ng/ml; rhIL-4, 4 ng/ml; neutralizing Abs to IL-12, 2 µg/ml; and IFN-
, 2 µg/ml). Cells were rested for 3 days in rhIL-2 (5 ng/ml), rhIL-4 (4 ng/ml), and anti-IL-12 mAb (1 µg/ml). For subsequent weeks, cells were restimulated for 4 days on anti-CD3-coated plates with IL-4 (20 ng/ml) and anti-IL-12 mAb. Experiments were performed on day 16 or 21. Th2 cell polarization was assessed by intracellular cytokine staining.
Jurkat T cells (clone E6-1) and murine D10.G4.1 cells were obtained from American Type Culture Collection. The D10.G4.1 Th2 clone was cultured in RPMI 1640 (Cellgro) supplemented with 10% FBS, 10 mM HEPES, 1 mM sodium pyruvate, 1.5 g/L sodium bicarbonate, 4.5 g/L glucose, 0.05 mM 2-ME, 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM L-glutamine, and murine rIL-2 (5 U/ml). Cells were restimulated with 100 µg/ml conalbumin (Sigma-Aldrich) and irradiated syngeneic AKR/J splenocytes every 3 wk. Experiments were conducted 612 days after restimulation.
Vector construction and transient transfections
A 2666-bp IL13 promoter construct (1112/Luc; numbering relative to the IL13 ATG) was generated using genomic DNA obtained from an IL13-1112C homozygote as PCR template and cloned into the pGL3 Basic luciferase reporter vector (Promega). QuickChange site-directed mutagenesis (Stratagene) was performed to create a construct with a T at position 1112 (1112T/Luc), to represent the minor allele, as well as the 1112C STATmut/Luc and 1112T STATmut/Luc constructs that contained a 3-bp mutation (TTC/gca, 1123/1121) abolishing the STAT motif. Fidelity of PCR reactions was confirmed by sequencing.
Th2 cells (2 x 104/µl) were transiently nucleofected with the 1112/Luc reporter constructs (1 µg) and pRL-TK (Promega: 50 ng) using program T23 (Amaxa). Efficiencies
45% were achieved, as determined by flow cytometric analysis of cells transfected with pCMV-GFP (eGFP_C1; BD Clontech). Freshly isolated CD4+ T cells (1.25 x 104 cells/µl) were transiently nucleofected with the 1112/Luc reporter constructs (5 µg) and pRL-TK (5 ng) using program U14 (Amaxa) and achieving
75% transfection efficiency. Jurkat T cells (5 x 106) were transiently cotransfected with the 1112/Luc reporter construct (10 µg), STAT6 (TPU-388, 110 µg) or STAT1 (a gift from Dr. P. Rothman, Columbia University, New York, NY; 10 µg) expression vectors and pRL-TK (10 ng) by square wave electroporation using one pulse of 50 ms, 240 V (BTX, ECM 830, Genetronics). These conditions resulted in transfection efficiency
40%. In all experiments, cells were stimulated with PMA (20 ng/ml) and ionomycin (1 µM) immediately after transfection. IL-4 (10 ng/ml) was added to the STAT6/STAT1 cotransfections. Luciferase activity was assessed after 1618 h incubation using the Dual Luciferase Assay (Promega) according to the manufacturers instructions. Protein concentration was determined with the bicinchoninic acid protein assay kit (Pierce). Results were normalized for transfection efficiency (as determined by Renilla luciferase activity) and protein concentrations, and expressed as relative luciferase activity (RLA; luciferase counts per microgram of protein).
Murine D10.G4.1 cells (2 x 106 cells/sample) were nucleofected with IL13-1112/Luc reporter constructs or pGL3 Basic (2 µg) and pRL-TK (50 ng) using program T01 (Amaxa). When indicated, a neutralizing anti-murine IL-4 mAb or an IgG1 isotype control (10 µg; BD Pharmingen) were added during the culture. Luciferase activity was assessed 1618 h after nucleofection. Results were expressed as fold increase in the RLA detected in unstimulated cells transfected with IL13 reporter constructs relative to cells transfected with pGL3 Basic.
EMSA
To prepare nuclear extracts, cells (10 x 106) were pelleted, washed in cold 1x PBS and resuspended in cold buffer A (10 mM HEPES, 1.2 mM MgCl2, 10 mM KCl, 0.5 mM DTT, 1 mM PMSF, 5 mM
-glycerophosphate, 1 mM benzamidine, 1 mM orthosodium vanadate, 1 mM sodium fluoride, 10 µg/ml antipain, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 10 µg/ml pepstatin; 120 µl). Cell lysis was monitored by trypan blue, and once swollen, cells were centrifuged at 14,000 rpm for 30 s at 4°C. Nuclear pellets were resuspended in an appropriate volume of ice-cold buffer C (420 mM NaCl, 20 mM HEPES, 25% glycerol, 1.5 mM MgCl2, 10 mM EDTA, 0.5 mM DTT, 1 mM PMSF, 5 mM
-glycerophosphate, 1 mM benzamidine, 1 mM orthosodium vanadate, 1 mM sodium fluoride, 10 µg/ml antipain, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 10 µg/ml pepstatin), incubated on ice for 20 min, and centrifuged at 14,000 rpm for 25 min at 4°C. Supernatants containing nuclear proteins were recovered, and aliquots were frozen immediately and stored at 80°C.
Gel shift assays were performed using a 31-bp oligonucleotide probe (5'-GGACTTCTAGGAAAACGAGGGAAGAGCAGGA, position 1127/1097 of the IL13 5'-flanking region) with either a C or a T at position 1112 (underlined). Double-stranded oligonucleotides were 5'-end-labeled with [
-32P]ATP. The binding reaction included nuclear extract (5 µg), 100 mM NaCl, 10% glycerol, 50 ng/µl poly(deoxyinosinate-deoxycytidylate) (Pierce Chemical Co.), 1x binding buffer (10 mM Tris, 0.5 mM MgCl2, 1 mM EDTA, and 1 mM DTT), and 1 µl of probe (0.51 ng), and was incubated for 30 min on ice. Competition or supershift were performed by preincubating nuclear proteins with unlabeled oligonucleotides (50- to 100-fold molar excess) or transcription factor-specific Abs (4 µg) for 30 min before addition of the probe. The following oligonucleotides were used as competitors: STAT3N, AGAGTTTCCCAGAAGGATG (889/910 of the IL13 promoter); STATmut, GGACGCATAGGAAAACGAGGGAAGAGCAGGA; Oct-1, TGTCGAATGCAAATCACTAGAA; NFAT IL2, CGGAGGAAAAACTGTTTCATACAGAAGGCGTG. Abs against STAT1 (E-23 or M-22), STAT6 (S-20), YY1 (C-20), STAT2 (C-20), STAT3 (H-190), STAT4 (H-119), STAT5a (L-20), and STAT5b (N-20) were obtained from Santa Cruz Biotechnology. Reactions were loaded onto 5% nondenaturing polyacrylamide gels and run for 56 h at 1819 mA with 0.5x Tris-buffered EDTA at 4°C.
Chromatin immunoprecipitation (ChIP)
Human naive peripheral blood CD4+ T cells, differentiated for 2 wk under Th2 conditions, were cultured in the presence or absence of PMA (20 ng/ml) and ionomycin (1 µM) for 3 h. Cells (5 x 107 per sample) were fixed for 10 min at 37°C with 1% formaldehyde. After incubation, glycine was added to a final concentration of 125 mM. Cells were washed twice with ice cold PBS and resuspended at 5 x 107/ml in ChIP lysis buffer (Upstate Biotechnology) supplemented with 1x EDTA-free protease inhibitor mixture (Roche) and 1 mM PMSF. Chromatin was sheared by sonication to an average length of 600 bp (six pulses for 10 s each at 30% maximum output; Microson XL200) and diluted 2-fold in ChIP dilution buffer (Upstate Biotechnology) supplemented with protease inhibitors as above. One-twentieth of the total sample was removed to be used as input DNA. Before immunoprecipitation, samples were precleared with salmon sperm DNA/protein A agarose slurry (Upstate Biotechnology) for 30 min. Soluble chromatin was immunoprecipitated overnight at 4°C with 10 µg of anti-STAT6 (sc-621) or anti-YY1 (sc-281) (both from Santa Cruz Biotechnology) or control mouse IgG1 (M5284; Sigma-Aldrich). Chromatin-Ab complexes were collected with salmon sperm DNA-protein A agarose beads and washed sequentially with low salt, high salt, LiCl, and Tris-EDTA (ChIP Assay Kit; Upstate Biotechnology). Complexes were then eluted (1% SDS and 0.1 M NaHCO3), incubated at 65°C overnight to reverse cross-links, and deproteinated with proteinase K. DNA samples were purified by phenol-chloroform extraction followed by ethanol precipitation in the presence of glycogen (20 µg) and resuspended in 20 µl of nuclease-free water. PCR amplification of a 202-bp amplicon encompassing position 1112 of IL13 was performed with primers 1112ChiPF (5'-GGGTAGGGGAGAAATCTTGACATC) and 1112ChIPR (5'-ATCAACCCCTGCCGTCTGG). Amplification of CNS-1 was performed using primers CNS1ChIPF (5'-CACAGCGTCGTTCAGAAACAC) and CNS1ChIPR (5'-CAGCCCCCGCACAGTTG) to yield a 152-bp amplicon. PCR was performed under the following conditions: 95°C for 15 min followed by 30 cycles at 95°C for 30 s, 57°C for 30 s, and 72°C for 45 s, ending with a final extension at 72°C for 5 min.
Analysis of IL-13 secretion by IL13-1112 genotype
Peripheral blood samples were obtained from women at the time of their enrollment in the Infant Immune Study (22), at about the eighth month of pregnancy. PBMC (2 x 106 cells/ml) were incubated in the presence or absence of Con A (10 µg/ml) and PMA (10 ng/ml: Sigma-Aldrich). After 1824 h, supernatants were harvested and stored at 70°C. IL-13 levels were assayed using a commercially available ELISA kit (Diaclone Research). Genotyping for IL13-1112C>T and IL132044G>A was performed as previously described (12).
Statistical analysis
The relationship between IL13-1112 genotypes and IL-13 production was assessed by one-way ANOVA, whereas the differences in IL-13 levels between individual genotypes were assessed with a Bonferroni multiple comparison test. Statistical significance of differences in fold induction between transfected vectors was determined using the Wilcoxon two-sample test.
Human subjects
Cord blood was obtained from anonymous cesarean deliveries. Peripheral blood was drawn from healthy nonallergic subjects after written informed consent was obtained. All protocols were approved by the Institutional Review Board of the University of Arizona.
| Results |
|---|
|
|
|---|
To investigate the functional relevance of IL13-1112C>T to IL13 regulation, we initially relied on comparative genomic analysis. Genomic segments strongly conserved during evolution frequently exhibit regulatory properties (20), implying that SNPs located in such regions are more likely to be functional. A human/mouse sequence alignment revealed poor conservation of the region containing IL13-1112C>T (Fig. 1). However, comparisons among distant species, although effective for the identification of highly constrained elements, invariably miss more recent changes in DNA sequence, such as those accounting for biological traits unique to primates (23). Therefore, we turned to phylogenetic shadowing, an approach that was recently developed to analyze sequence conservation profiles among closely related species (20) and accurately predicted primate-specific exons and regulatory elements arisen after divergence from the mouse lineage (21).
|
80 bp and predicts the existence of a primate-specific cis-regulatory element (Fig. 1, top). This element maps to the vicinity of a region that exhibits constitutive DNA hypomethylation and hypersensitivity to DNase I digestion in human naive, Th1 and Th2 CD4+ T cells (R. B. Webster, Y. Rodriguez, W. Klimecki, and D. Vercelli, in press), suggesting this region may be endowed with regulatory properties. These findings provide indirect but suggestive evidence for a potential role of IL13-1112C>T in the regulation of IL13 expression. All 12 nonhuman primate species had a T at position 1112 (Fig. 1, bottom). Therefore, the disease-associated IL13-1112T allele is the ancestral allele. Transcription of the IL13-1112T allele is enhanced in primary CD4+ Th2 cells, but not in nonpolarized CD4+ T cells
Because IL13-1112C>T disrupts a CpG site (Fig. 1), we explored the possibility that loss of the C at 1112 may alter DNA methylation patterns throughout the region, rendering the minor promoter variant more accessible to the transcriptional machinery. Bisulfite sequencing analysis revealed virtually identical CpG methylation profiles in CD4+ T cells of distinct IL13-1112 genotypes (data not shown), ruling out this possibility.
To examine more directly whether IL13-1112C>T affects IL13 transcription, we generated luciferase reporter constructs driven by a 2.7-kb IL13 promoter fragment carrying either the major (C) or minor (T) allele at position 1112. Initially, the 1112/Luc reporter constructs were transfected into the Jurkat T cell line, a well-established model to study transcriptional regulation of cytokine genes. Fig. 2 (left) shows that 1112C/Luc activity was up-regulated 22-fold in response to T cell activation. In contrast, the 1112T/Luc construct was induced only 15-fold (n = 26; p = 0.006). Thus, IL13-1112T was significantly less active than the major allele in Jurkat T cells.
|
80-fold for Jurkat cells and
140-fold for primary T cells, as assessed by real time RT-PCR), but only
3% of these cells expressed detectable levels of intracellular IL-13 protein (data not shown). Thus, the majority of luciferase activity in nonpolarized CD4+ T cells was likely generated from a nuclear environment inadequate to promote optimal IL13 expression.
Because IL13 is typically expressed by polarized CD4+ Th2 cells and these cells play a critical effector role in human and experimental allergic inflammation, the transcriptional effect of IL13-1112C>T was examined in two independent, primary Th2 cell models. In one set of experiments, human neonatal naive CD45ROCD4+ T cells were differentiated in vitro under Th2-polarizing conditions. After 23 wk of culture, cells acquired a highly polarized Th2 phenotype, as demonstrated by elevated levels of intracellular IL-13 and virtually absent IFN-
(data not shown). Nucleofection of primary human Th2 cells with IL13-1112C and T reporter constructs led to significantly higher transcriptional induction of the 1112T allele in response to T cell activation (Fig. 2, left). Likewise, the 1112T variant was significantly more active in the murine D10.G4.1 Th2 clone, a well-established model of Th2 cell polarization (24) (Fig. 2, right). Our results demonstrate that the nuclear environment can dictate the transcriptional outcome of genetic variation. In the context of a Th2 milieu that drives high IL13 expression, but not within nonpolarized CD4+ T cells, the 1112T allele conferred higher activity to the IL13 promoter, consistent with the reported association between this allele and increased susceptibility to allergic inflammation (1).
IL13-1112 allele- and cell type-specific patterns of transcription factor binding parallel profiles of transcriptional activity
To identify the mechanisms underlying higher transcription of IL13-1112T in Th2 cells, we initially used EMSA analysis to compare and contrast patterns of DNA-protein interactions occurring at the IL13 1112 promoter variants in distinct T cell nuclear environments. We reasoned that such comparisons could provide an indirect but powerful tool to tease out the interactions involved in increased transcription of the 1112T allele.
Using oligonucleotides corresponding to the C or T allelic variants of the 1127/1097 IL13 promoter region (Fig. 3A, top), we demonstrated that nuclear extracts from activated primary Th2 cells (in which the 1112T allele was transcriptionally more active) contained two specific, slowly migrating complexes that bound both the C and the T allele (Fig. 3A, lanes 2 and 8) and were cross-competed by cold C and T 1127/-1097 IL13 oligonucleotides (Fig. 3A, lanes 3, 4, 9, and 10). The upper complex contained STAT6, because formation of the complex was abrogated by a STAT3N (lanes 6 and 12), but not an NFAT competitor (lanes 5 and 11). Furthermore, the band was supershifted by an anti-STAT6 (lanes 14 and 18), but not an anti-STAT1 (Fig. 3A, lanes 15 and 19) or an anti-C/EBP
(Fig. 3A, lane 16) Ab. Conversely, the lower complex was formed by STAT1, because it was fully competed by a STAT3N oligonucleotide (Fig. 3A, lanes 6 and 12) and selectively supershifted by an Ab against this STAT family member (Fig. 3A, lanes 15 and 19). No other STAT proteins were found to participate in complex formation, as assessed by supershifting with Abs specific for individual family members (data not shown). The 1112T but not the C probe bound an additional fast-migrating complex that was competed by a cold 1112T, but not 1112C, oligonucleotide (Fig. 3A, lanes 9 and 10). The complex contained YY1 because it was supershifted by an anti-YY1 Ab (Fig. 3A, lane 20), but not by Abs to STAT6 or STAT1 (Fig. 3A, lanes 18 and 19). Comparison of nuclear extracts from resting and activated Th2 cells revealed that the YY1 complex bound constitutively to the 1112T allele (Fig. 3A, lane 23), whereas formation of the STAT6- and STAT1-containing complexes was dependent on T cell activation (Fig. 3A, lanes 22 and 24). Increased activity of IL13-1112T in Th2 cells was therefore paralleled by allele-specific binding of the transcription factor YY1.
|
(Fig. 3B, lane 12). Moreover, pretreatment of PMA-ionomycin-stimulated CD4+ T cells with cyclosporine A (50 µg/ml) selectively prevented complex formation (data not shown), further supporting the identification of NFAT as a main complex constituent.
Finally, EMSA analysis of nuclear extracts from Jurkat T cells (which, like fresh CD4+ T cells, supported weaker transcription of the 1112T allele) showed strong specific binding of STAT1 to both alleles (Fig. 3C, lanes 3, 4, 8, and 9) and selective binding of YY1 to 1112T (Fig. 3C, lanes 11 and 13). However, no STAT6-containing complex was detected, consistent with deficient STAT6 activity in Jurkat T cells (25). A slowly migrating complex supershifted by an anti-Oct-1 Ab (Fig. 3C, lane 12), but not by Abs to YY1 (Fig. 3C, lane 13), C/EBP
(Fig. 3C, lane 14), or Oct-2 (data not shown), was also detected in Jurkat T cell extracts using a 1112T allele probe. The same complex was selectively competed by a bona fide Oct consensus oligonucleotide (data not shown), and thus contained Oct-1.
These results show that the higher activity of the IL13-1112T allele in Th2 cells correlated with a unique pattern of DNA-protein interactions marked by the combination of STAT6/STAT1 and YY1, and provide a molecular rationale for the differential transcription of the 1112 alleles in distinct T cell nuclear environments.
IL13-1112T attenuates STAT6-mediated repression of IL13 transcription
YY1 is a ubiquitously expressed nuclear protein that can either activate or repress transcription (26). Because the sequences flanking the YY1 core motif (TCAT) can be quite variable, many promoters contain YY1 sites that overlap those for other transcriptional regulators (26). This topology fosters interactions between YY1 and other factors, the outcome of which depends on the function of the proteins involved. In silico analysis of the IL13 promoter sequence and mutational EMSA analysis by nucleotide transversions (data not shown) demonstrated that the YY1 motif created by 1112T overlaps the 3' end of a STAT palindrome that is present on both alleles and binds STAT6 or STAT1 in Th2 cells (Fig. 3A, top). In view of the dual role of YY1 in transcriptional regulation, two models may explain the role of YY1 in the increased activity of the IL13-1112T allele in Th2 cells. Both YY1 and STAT proteins may act cooperatively as transcriptional activators, as reported for YY1 and STAT5b binding to the serine protease inhibitor 2.1 gene (27). Alternatively, STAT binding to the IL13-1112 region may repress transcription, as reported for the human IL4 promoter (25), and YY1 may relieve STAT-mediated repression by displacing STATs or recruiting STAT corepressors.
We reasoned that understanding the role played by YY1 in the increased activity of the IL13-1112T allele required the functional characterization of the 1123/-1115 STAT motif overlapping the YY1 site. Therefore, the IL13-1112C and T reporter vectors were mutated in the 5' half of the STAT motif. EMSA analysis confirmed that the mutation disrupted binding of STAT1/STAT6, but not YY1 (data not shown). Fig. 4 (left) shows that the 1112C STAT mutant construct was markedly more active than either allelic variant when nucleofected into primary human Th2 cells. In contrast, the activity of the minor 1112T allele was only marginally altered by the STAT site mutation. These results demonstrate that the STAT motif upstream of the polymorphism plays a strong negative regulatory role in the context of the 1112C IL13 promoter and indicate that YY1 binding to its newly created site is virtually sufficient to relieve STAT-dependent promoter repression. Strong independent support for both these conclusions was provided by the experiments shown in Fig. 4 (center). Inhibition of STAT6 activation by neutralization of endogenous IL-4 significantly up-regulated transcription of the common 1112C promoter variant in D10.G4.1 Th2 cells, raising the activity of the 1112C allele to the levels achieved by the 1112T allele. In contrast, IL-4 blockade did not affect the activity of the 1112T promoter.
|
STAT6 and YY1 bind at the IL13-1112 region in vivo
To confirm the role of STAT6 and YY1 as critical determinants of IL13 transcription in vivo, the ability of these factors to bind the endogenous IL13-1112 promoter region in primary human Th2 cells was assessed by ChIP. Fig. 5 (top) shows that the region of interest was readily immunoprecipitated by anti-STAT6 and anti-YY1 Abs but not control IgG, demonstrating STAT6 and YY1 interact with the IL13 promoter in chromatin. STAT6-anti-STAT6 interactions were specific, because the anti-STAT6 Ab failed to immunoprecipitate CNS-1 (Fig. 5, bottom), a regulatory element located in the IL13/IL4 intergenic region, that does not encompass bona fide STAT6 motifs. A weak YY1 signal was detected in CNS-1, in line with the presence of several predicted YY1 sites (J. M. Strempel and D. Vercelli, unpublished observations). Detection of DNA-bound STAT6 in resting Th2 cells, although at variance with our EMSA findings, may reflect the continuous presence of IL-4 in Th2 cell cultures and the sensitivity of ChIP to modifications in chromatin architecture.
|
Increased IL-13 secretion in IL13-1112TT homozygotes
The IL13-1112T allele resulted in increased IL13 transcription, (Figs. 2 and 4) and was associated with allergic phenotypes in multiple studies (14), but the existence of a direct correlation between IL13-1112 genotypes and levels of IL-13 production was never tested in a large population. We assessed IL-13 secretion in subjects enrolled in the Tucson Infant Immune Study, a large prospective study of the development of immunological markers of asthma risk (22). We focused on 174 women at the third trimester of pregnancy, unselected for atopy and asthma. Fig. 6 shows that mitogen-activated PBMC from IL13-1112TT homozygotes secreted significantly higher levels of IL-13 compared with 1112CC and CT individuals (ANOVA, p = 0.015). The effect was strengthened after adjusting for ethnicity and IL13-2044 genotype in a multivariate linear regression (1112TT vs CC, p = 0.007; 1112TT vs CT, p = 0.003). The latter adjustment was required because IL13-2044G>A, a common coding SNP in strong LD with IL13-1112C>T in the Tucson population (12), results in the expression of an IL-13 variant (IL-13 R130Q) with increased biological activity and altered antigenic properties that decrease its ELISA-based detection by a factor of 25.7% (13). Therefore, the data shown in Fig. 6, if anything, would represent under detection of IL-13 in carriers of IL13-2044A. Although the complex patterns of LD in the IL13 locus warrant caution in the interpretation of these data, our findings strongly support the possibility that IL13-1112C>T may contribute to increased IL13 expression in vivo. The low IL-13 levels detected in 1112CT heterozygotes may result from monoallelic IL13 expression, a pattern well documented in mouse strains (28), and preferential expression of the C allele.
|
| Discussion |
|---|
|
|
|---|
Gene-environment interactions in the nucleus are a phenomenon we previously observed for CD14-159C>T, a SNP which results in different patterns of CD14 promoter activity in monocytes and hepatocytes depending on the Sp1:Sp3 ratio (29). However, our current data are more remarkable in that differential IL13 expression was observed not in distinct cell types but in distinct CD4+ Th cell phenotypes and that they correlated with distinct patterns of transcription factor binding to the IL13 promoter. That the gain-of-function associated with the IL13-1112T allele emerged only in differentiated Th2 cells eloquently shows how subtle the functional impact of genetic variation can be and how essential it is to choose experimental models able to capture it. Furthermore, these results suggest that IL13-1112C>T is likely to influence risk of allergy and/or asthma in the context of an established Th2 response. Thus, this polymorphism may contribute to the maintenance and/or exacerbation of allergic inflammation more than to its inception.
Gene-environment interactions in the nucleus may also offer a rationale for the common but disquieting finding that many published associations could not be replicated (30, 31, 32). If the functional outcome of genetic variation contributing to disease risk is determined not only by the genetic but also by the biological context, as our data indicate, the conditions under which biological samples are collected for phenotyping may become critically important, and failing to account for gene-environment interactions in the nucleus may hamper detection of susceptibility loci. Interestingly, there are now many examples of established associations with different functional variants within the same gene or with opposite alleles at the same SNP in different populations (1). For example, IgE levels are associated with IL13-1112C>T in some populations (33, 34) and with IL13-2044G>A (12, 33, 35) or IL13-1512A>C (36) in others. Protection from allergy and/or asthma is associated with both the T (9) and the C (37) allele of CD14-159. It is tempting to speculate that these seemingly contradictory results may often represent an outcome of gene-environment interactions in the nucleus.
Increased transcription of IL13-1112T was associated with the creation of a binding site for YY1 that overlapped a STAT motif and attenuated STAT6-mediated repression. Although necessary for Th2 cell differentiation and expression of Th2 cytokine genes, including IL13 (38), STAT6 can also act as a negative transcriptional regulator. STAT6 overexpression was shown to suppress the activity of an IL4 reporter construct in both Jurkat (25) and polarized murine Th2 (39) cells. Furthermore, comparative mRNA profiling of IL-4-stimulated B cells from wild-type and STAT6/ mice demonstrated that more than one-half of STAT6-controlled genes were down-regulated by this transcription factor in vivo (40). Last but not least, STAT6 inhibited IL4 promoter activity in differentiated D10.G4.1 murine Th2 cells (39). Our work further extended these findings by showing that STAT6 negatively affects IL13 expression in Th2 cells, and furthermore identified the STAT site adjacent to 1112C>T as being critical for STAT6-dependent suppression of IL13 transcription. Indeed, the replacement of 1112C with a T, and the concomitant creation of a YY1 site overlapping the STAT motif, was sufficient to fully counteract STAT6-dependent promoter inhibition. STAT6 may be part of a complex feedback circuit, acting initially as a permissive factor essential for Th2 cytokine locus remodeling (24) leading to IL4 and IL13 expression in Th2 cells. Partnering with a different set of factors, STAT6 may then become an inhibitor that fine tunes or even limits IL13 expression in fully differentiated Th2 effector cells. Our data suggest that the dynamic transcription factor context of differentiating Th2 cells plays a major role in modulating the regulatory effects of IL13-1112C>T. Whereas STAT6 and YY1 docking on the 1112T allele was detected in both nonpolarized CD4+ T cells (in which the T allele was less active) and Th2 cells (in which the T allele was more active), other factors (NFAT, Oct-1) were available for binding only in nonpolarized cells. In view of the topology of the relevant binding sites in the polymorphic IL13 promoter region, the latter factors may impair the ability of YY1 to interfere with STAT6-mediated promoter repression (Fig. 7). The molecular interactions underlying these effects remain to be determined.
|
promoters (29, 42). Because the functional effects of individual polymorphisms may be small, risk for complex diseases is substantially increased by synergism between multiple SNPs arrayed along a single regulatory pathway. Indeed, asthma risk was 5-fold higher in carriers of IL13-1112T and IL4RA 478Ser (43), compared with individuals with both nonrisk genotypes, and the effects of the IL13-1112TT genotype on risk for food sensitization were modified by IL4RA S478P and IL4RA Q155R (17). Risk for high IgE and asthma was increased even further by the combination of IL13-1112C>T, IL4-589C>T, IL4RA-148A>G and STAT6 IL4RA-2892C>T (44). Comparative analysis of the IL13 promoter showed the IL13-1112T allele that increases risk for allergic disease is the ancestral allele, whereas the derived 1112C allele is protective. Furthermore, this analysis revealed the topology of STAT6 and YY1 motifs resulting in increased IL13 promoter activity has been fully conserved through at least 30 million years of evolutionary history, and all the replacements found in the STAT motif in Old World and New World monkeys occurred within the 3N spacer, not in the TTC/GAA palindrome critical for DNA-protein interactions (Fig. 1, bottom). These findings and their relevance to common diseases are best interpreted in the framework of the ancestral susceptibility model (45), according to which ancestral alleles reflect ancient adaptations to the lifestyle of ancient human populations. In that context, derived alleles were deleterious. With the shift in environment and lifestyle that has occurred in modern populations, ancestral alleles can increase the risk of common diseases, as exemplified by variants involved in energy metabolism and sodium homeostasis (45). An equivalent role of IL13-1112C>T among immunity genes is suggested by its current associations with allergy and asthma susceptibility in Western environments (1) in the face of strong associations between IL13-1112T and protection from Schistosoma hematobium in Africa (46) and severe malaria in Thailand (47). Although it is unclear why IL13-1112C rose abruptly in frequency to become the common allele in most human populations, the IL13 locus shows signatures of a recent selective sweep in the Caucasian and Chinese populations (48). We speculate that a genetically determined propensity for high IL13 expression may have become detrimental through deleterious effects on reproduction. Indeed, endometriosis, which increases the risk of infertility, has been associated with elevated IL13 mRNA and protein expression within the ectopic endometrium (49). IL13 may therefore be the first immunity gene that conforms to the ancestral susceptibility model.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grants HL66391 (to D.V.) and AI42268 (to A.L.W.), a fellowship from the Canadian Institutes of Health Research (to L.C.), and an Interest Section Award from the American Academy of Allergy, Asthma and Immunology (to L.C.). ![]()
2 Current address: Pulmonary Research Group, Department of Medicine, University of Alberta, Edmonton, Alberta, Canada. ![]()
3 R.B.W., J.M.S., and P.K. contributed equally to this work. ![]()
4 Current address: University Childrens Hospital, Ludwig Maximilians University, Munich, Germany. ![]()
5 Address correspondence and reprint requests to Dr. Donata Vercelli, Arizona Respiratory Center, Arizona Health Sciences Center, Room 2349, 1501 North Campbell Avenue, Tucson, AZ 85724. E-mail address: donata{at}arc.arizona.edu ![]()
6 Abbreviations used in this paper: SNP, single nucleotide polymorphism; ChIP, chromatin immunoprecipitation; LD, linkage disequilibrium; RLA, relative luciferase activity; YY1, Yin Yang 1; DT, divergence threshold; rh, recombinant human. ![]()
Received for publication May 24, 2006. Accepted for publication September 26, 2006.
| References |
|---|
|
|
|---|
secretion in human monocytes. J. Immunol. 155: 3145-3151. [Abstract]
in human milk is associated with wheeze in infancy. J. Allergy Clin. Immunol. 112: 723-728. [Medline]
gene confers susceptibility to asthma and atopy in ethnically diverse populations. Am. J. Hum. Genet. 66: 517-526. [Medline]
1 promoter polymorphism C509T is associated with asthma. Am. J. Respir. Crit. Care Med. 169: 214-219. This article has been cited by other articles:
![]() |
A. Sadeghnejad, D. A. Meyers, M. Bottai, D. A. Sterling, E. R. Bleecker, and J. A. Ohar IL13 Promoter Polymorphism 1112C/T Modulates the Adverse Effect of Tobacco Smoking on Lung Function Am. J. Respir. Crit. Care Med., October 15, 2007; 176(8): 748 - 752. [Abstract] [Full Text] [PDF] |
||||