The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aublin, A.
Right arrow Articles by Maryanski, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aublin, A.
Right arrow Articles by Maryanski, J. L.
The Journal of Immunology, 2006, 177: 8587-8594.
Copyright © 2006 by The American Association of Immunologists, Inc.

A Natural Structural Variant of the Mouse TCR beta-Chain Displays Intrinsic Receptor Function and Antigen Specificity1

Anne Aublin*,{dagger}, Maria Ciofani{ddagger}, Nancy Willkomm*,{dagger}, Abdelbasset Hamrouni2,*,§, Andrea L. Szymczak-Workman, Tomio Takahashi*,§, Yongoua Sandjeu*,{dagger}, Philippe Guillaume||, Dario A. A. Vignali, Olivier Michielin||, Juan Carlos Zúñiga-Pflücker{ddagger} and Janet L. Maryanski3,*,{dagger}

* Institut National de la Santé et de la Recherche Médicale Unité 503, Lyon, France; {dagger} Université Claude Bernard Lyon I, Lyon, France; {ddagger} Department of Immunology, University of Toronto, Sunnybrook Research Institute, Toronto, Ontario, Canada; § Ecole Normale Supérieure de Lyon, Lyon, France; Department of Immunology, St. Jude Children’s Research Hospital, Memphis, TN 38105; and || Ludwig Institute for Cancer Research, Lausanne Branch, University of Lausanne, Epalinges, Switzerland


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The Cbeta0 alternate cassette exon is located between the Jbeta1 and Cbeta1 genes in the mouse TCR beta-locus. In T cells with a VDJbeta1 rearrangement, the Cbeta0 exon may be included in TCRbeta transcripts (herein called TCRbeta-Cbeta0 transcripts), potentially inserting an additional 24 aa between the V and C domains of the TCR beta-chain. These TCRbeta splice isoforms may be differentially regulated after Ag activation, because we detected TCRbeta-Cbeta0 transcripts in a high proportion (>60%) of immature and mature T cells having VDJbeta1 rearrangements but found a substantially reduced frequency (<35%) of TCRbeta-Cbeta0 expression among CD8 T cells selected by Ag in vivo. To study the potential activity of the TCRbeta-Cbeta0 splice variant, we cloned full-length TCR cDNAs by single-cell RT-PCR into retroviral expression vectors. We found that the TCRbeta-Cbeta0 splice isoform can function during an early stage of T cell development normally dependent on TCR beta-chain expression. We also demonstrate that T hybridoma-derived cells expressing a TCRbeta-Cbeta0 isoform together with the clonally associated TCR {alpha}-chain recognize the same cognate peptide-MHC ligand as the corresponding normal {alpha}betaTCR. This maintenance of receptor function and specificity upon insertion of the Cbeta0 peptide cassette signifies a remarkable adaptability for the TCR beta-chain, and our findings open the possibility that this splice isoform may function in vivo.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Alternative splicing of pre-mRNA transcripts is a major mechanism for the structural and functional diversification of mammalian genes, and proteins encoded by splice variants control multiple processes of lymphocyte development, activation, and effector function (1). T lymphocytes recognize Ags as complexes of foreign peptides presented by MHC molecules (pMHC)4 via clonally distributed, heterodimeric {alpha}beta TCRs (2, 3, 4). The paired TCR {alpha}- and beta-chains have very short cytoplasmic tails lacking signal transduction capacity, and receptor function requires association of the {alpha}betaTCR with CD3{epsilon}, {delta}, {gamma}, and {zeta} signal transduction proteins (5, 6). Specific pMHC ligand recognition occurs at the molecular surface formed by the CDR loops encoded by rearranged TCR VJ{alpha} and VDJbeta genes. After transcription, the rearranged VJ{alpha} and VDJbeta sequences are spliced to the first exons of their respective C{alpha} or Cbeta genes to form mature mRNAs encoding TCR {alpha}- and -beta-chains. Two D-J-Cbeta gene clusters are located in the Tcrb locus, and in mice an alternate exon termed "Cbeta0" is located in the intervening sequence that separates the Jbeta1 genes from the Cbeta1 gene (7). In cells having a V-D-Jbeta1 rearrangement, the Cbeta0 exon can be alternatively spliced in between the rearranged VDJbeta1 sequence and the first exon of the Cbeta1 gene, potentially adding a 24-aa-long peptide cassette between the V and C domains of the TCR beta-chain. However, it is not known whether such transcripts (hereafter called TCRbeta-Cbeta0) are translated into protein nor whether they are functional (7, 8).

We investigate the potential regulation of TCRbeta splice isoform expression by single/oligo cell RT-PCR analysis of TCRbeta-Cbeta0 expression at various stages of T cell development and after Ag activation in vivo. We cloned full-length TCR cDNAs by single cell RT-PCR and show that the TCRbeta-Cbeta0 transcript can be translated into protein and can function at the critical beta-selection checkpoint of early T cell development. We also demonstrate that T hybridoma-derived cells doubly transduced with clonally derived, paired TCR{alpha}- and TCRbeta-Cbeta0 constructs express cell surface TCRs and can be stimulated by cognate pMHC for IL-2 secretion. This maintenance of TCR function and specificity upon insertion of the Cbeta0 cassette peptide opens the intriguing possibility that a new receptor function may have coevolved with the Cbeta0 exon in mice.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice and cell lines

DBA/2 and RAG-2-deficient (9) mice were maintained at our animal facilities under procedures approved by our institutional animal care committees. The derivation and culture of OP9-DL1 cells and P815 cells (clone P1) are described elsewhere (10, 11). The 293-derived (EcoPack2; BD Biosciences) and GP+E86 (from P. Ohashi, Ontario Cancer Institute, Toronto, Canada) retroviral packaging cell lines and the NIH-3T3 fibroblasts (from J. Baguet, Institut National de la Santé et de la Recherche Médicale Unite 503, Lyon, France) were cultured in DMEM with added glutamine (2 mM), HEPES (10 mM), gentamicin (40 µg/ml) (final concentrations, all from Life Technologies), and 10% FCS (Dominique Dutscher). The TCRCD8{alpha}beta+ mouse T hybridoma-derived cell line 58CD8 (12) (from E. Palmer, University Hospital, Basel, Switzerland) was cultured in the above medium with 5% FCS and 2-ME (50 µM; Invitrogen Life Technologies).

Flow cytometry

Purified or biotinylated mAbs, FITC-, PE-, or PE-Cy5-conjugated mAbs, and streptavidin-allophycocyanin were purchased from BD Biosciences with the exception of the CTVB10b-PE (anti-Vbeta10b), CTVA8-biotin (anti-V{alpha}8), and anti-CD8{alpha}-PE-Cy5 conjugates, which purchased from Caltag Laboratories. Previously described procedures (13, 14, 15) for cell preparation and staining were used, and after staining, the cells were analyzed or sorted using FACSCalibur or Vantage instruments (BD Biosciences).

RT-PCR amplification of partial TCR sequences

Sorting conditions for single-cell RT-PCR were as described (13) except that for double-negative (DN) and double-positive (DP) thymocytes, 3–10 cells (instead of one) were sorted per microtube to compensate for the reduced frequency of cells expected to have TCRbeta transcripts using a particular Vbeta gene. Conditions for two-step nested RT-PCR amplification, gel migration, and sequencing of TCRbeta sequences from sorted cells were as described (13). Primers for the first PCR were Vb1-217 (ggaatgtgagcaacatctgg) or Vb10-136 (aaactctgggccacgatact) for Vbeta1 or Vbeta10, respectively, and Cb-523 (ctcagctccacgtggtca) for Cbeta. Primers for the second PCR were Vb1-279 (cgccagagctcatgtttctc) or Vb10-218 (gcaactcattgtaaacgaaaca) and Cb-480 (cgagggtagccttttgtttg). Amplified PCR products were directly sequenced to determine Jbeta usage as described (13) by using primers specific for Vbeta1 (Vb1-333; tgcccagtcgttttatacctg) or Vbeta10 (Vb10-seq; aggcgcttctcacctcagtcttca). To detect the expression of alternate splice VDJbeta1-Cbeta0-Cbeta1 transcripts from cells expressing a VDJbeta1 transcript, an additional nested second PCR was performed (from the first PCR) using Vbeta10- or Vbeta1-specific primers (Vb1-279 or Vb10-218) together with a Cbeta0-specific primer, Cb0–439 (tgagatgtaagagagctgtggtg).

Single-cell RT-PCR amplification and cloning of full-length TCR cDNAs

Frozen samples of single CD8 T cells specific for the pCW3/Kd ligand previously sorted from mouse M-33 under RT-PCR conditions (13) were used to amplify cDNAs corresponding to full-length TCR{alpha} and TCRbeta transcripts. The first PCR was performed in a final volume of 50 µl containing 1 U of Taq polymerase in the manufacturer’s 1x reaction buffer (Roche), 2.85 mM MgCl2 (Roche), 200 µM each dNTP (Promega), and 100 nM each primer. Primers for the first PCRs were L-Vb10-279 (cttatttgccctgccttgac), Cb1-1855 (aggcattttccaggtcacaa), Cb2-1174 (tttagtctgtttcagagtcaaggtg), L-Va8-178 (actcaaggaccaagtgtcatttc), and 1163-Ca-IVS (gattgtgaatcagggccaac). The first PCR program begins at 95°C for 2 min, continues with 35 cycles of 10 s at 95°C, 45 s at 59°C, and 1 min 30 s at 72°C, and ends with 5 min at 72°C.

Separate second "diagnostic" PCRs were performed using internal primers to determine which samples were positive for TCRbeta or TCR{alpha}. For the diagnostic PCRs, a 0.5-µl aliquot of the first PCR was added to a final volume of 50 µl containing 0.5 U of Taq polymerase with the recommended 1 x reaction buffer (Roche), 1.75 mM MgCl2 (Roche), 200 µM each dNTP (Promega), and 100 nM each primer. Primers for TCRbeta were Vb10-218 (gcaactcattgtaaacgaaaca) and Cb-480 (cgagggtagccttttgtttg), and the primers for TCR{alpha} were L-Va8-178 (actcaaggaccaagtgtcatttc) and Ca-533 (aacgttccagattccatggtt). The positive PCR products were sequenced directly using a BigDye sequencing kit (Applied Biosystems) with the Vb10-seq primer (aggcgcttctcacctcagtcttca) for TCRbeta and theVa8-rev-493 (aggagctgctgctcttatgg) and Ca-516 (ggttttcggcacattgattt) primers for TCR{alpha}. Sequences were analyzed on an ABI PRISM 3100 genetic analyzer (Applied Biosystems).

To amplify TCR sequences for cloning, separate second "cloning" PCRs were performed in quadruplicate by amplification of 3 µl of the selected first PCR using the BamHI-LVb10 (cgcccaggatccactatgggctgtaggctcctaagctgtgtgg) and Cb1-TGA-XhoI (ccgcgcctcgagtcatgaattctttcttttgaccatagc) primers for the full-length TCRbeta and the BamHI-Va8-M33–235 (cgcccaggatcccttctatgaacatgcgtcctg) and XhoI-Ca-TGA (ccgcgcctcgagtcaactggaccacagcctc) primers for the full-length TCR{alpha}. The forward primers incorporate a BamHI restriction site and the ATG codon that initiates the Vbeta10 or V{alpha}8 leader sequences, and the reverse primers incorporate an XhoI site and the TGA termination codon for the Cbeta1 or C{alpha} sequences. The PCR conditions were as described above for the diagnostic PCR, except that the polymerase used was the Expand High Fidelity Taq (Roche). The second cloning PCR program begins at 95°C for 2 min and 72°C for 5 s, continues with 35 cycles of 10 s at 95°C, 1 min at 61°C, and 1 min 30 s at 72°C, and ends with 5 min at 72°C.

The pMIG2 and pMIY2 plasmids were derived from bicistronic murine stem cell virus-based retroviral vectors that encode GFP or yellow fluorescent protein (YFP), respectively, by introducing a new multiple cloning site (sequence gaa ttc aga tct tac gta gct agc gga tcc caa ttg ctc gag) into the EcoRI/XhoI site 5' of the internal ribosome entry site sequence (16). Cloning was performed after BamHI/XhoI digestion of the vector and the gel-purified PCR products. After an initial screening by PCR amplification and sequencing, selected colonies were subcloned and the plasmids were purified (EndoFree plasmid maxi kit; Qiagen) for transfection and for sequencing of the complete inserts. The cloned TCR sequences are available under GenBank accession numbers DQ126340 (TCRbeta), DQ126341 (TCRbeta-Cbeta0), and DQ186679 (TCR{alpha}).

Transduction of 3T3 fibroblasts or 58CD8 cells and cell sorting

Supernatants (SNs) containing viral particles for transduction were produced by transient or stable transfection of the 293-derived (EcoPack2; BD Biosciences) or GP+E86 retroviral packaging cell lines, respectively, as described (16, 17). Transduction of NIH-3T3 fibroblasts was performed with a retroviral SN in the presence of Polybrene (Pb; Sigma-Aldrich, catalog no. H9268) as described (16).

A protocol involving virus-copolymer complex formation and centrifugation (18) was adapted for the transduction of 58CD8 cells. Frozen viral SNs in 2-ml Eppendorf tubes were rapidly thawed (37°C) and mixed first with Pb and then with chondroitin sulfate C (CSC; Sigma-Aldrich, catalog no. C4384), with vigorous mixing after each addition. Stock solutions of each polymer were 20 mg/ml, and the final concentration of each was 80 µg/ml. After a 20-min incubation at 37°C, the virus-Pb/CSC mixtures were centrifuged 5 min in a tabletop Heraeus Biofuge Pico centrifuge at 10,000 x g, and the pellets containing virus-Pb/CSC complexes were resuspended in culture medium in a volume 10-fold reduced as compared with the original viral SN. Medium from the wells of flat-bottom 96-well plates plated the previous day at 5000 58CD8 cells per well was removed and replaced with the virus-Pb/CSC mixture. After 24 h of incubation with the viral complexes, the cells were transferred into 24-well plates.

The 58CD8 cells were first transduced with the TCR{alpha}-MIY2 construct. Seven days later, 58CD8-YFP+ cells were sorted as YFPlow or YFPhigh populations and, 5 days after sorting, the 58CD8-YFPlow, 58CD8-YFPhigh, and 58CD8 cells were separately transduced with MIG2, TCRbeta-MIG2, or TCRbeta-Cbeta0-MIG2 viruses. Five weeks later, the 58CD8-TCR{alpha}high/TCRbeta and 58CD8-TCR{alpha}high/TCRbeta-Cbeta0 groups were labeled with 2C11-biotin/streptavidin-allophycocyanin and sorted as surface CD3{epsilon}+ cells.

OP9-DL1 cocultures

RAG-deficient hemopoietic progenitor cells from day 14 fetal liver were cultured on OP9-DL1 monolayers in the presence of 1 ng/ml IL-7 and 5 ng/ml Flt-3L, after which the cells were infected by overnight culture on MIG2, TCRbeta-MIG2, or TCRbeta-Cbeta0-MIG2 viral producer monolayers as described (10, 14). The following day, GFP+/CD44CD25+ (DN3) cells were sorted and cocultured on OP9-DL1 monolayers for a further 6 days.

Stimulation of 58CD8-TCR transductants and IL-2 assay

58CD8-TCR transductants (60,000 cells/well) were incubated in 96-well plates (Falcon Plastics) with Kd+ P815 cells (50,000 cells/well) in the presence of pCW3170–179 and pA24170–179 (19) or in wells precoated overnight with the 2C11 mAb (BD Biosciences). Supernatants were collected after 48 h of culture. IL-2 concentrations were measured with a CBA mouse IL-2 flex set using a FACSCalibur and FCAP Array software (all BD Biosciences).

Searching for conformational space accessible to Cbeta0 loops in a model {alpha}betaTCR

A homology model of the TCR{alpha}/TCRbeta heterodimer was built based on the 2C TCR template (Protein Data Bank code identifier 1TCR) by satisfaction of spatial restraints using the Modeler program (20); the {alpha}- and beta-chains were aligned separately using a dynamic programming method implemented in the Modeler program. The sequence identity was 73 and 69% for the {alpha}- and beta-chains, respectively. The alignment was compared with prealigned TCR sequences (21) to insure that all conserved sequence motifs were correctly assigned. The 2C TCR template was chosen because its combined {alpha} and beta sequence identity was the highest among all of the crystallized TCR structures. The heterodimer complex was subsequently obtained by simultaneous global optimization of alignment-derived restraints for both the {alpha}- and beta-chains. Similarly, a model for the TCR{alpha}/TCRbeta-Cbeta0 heterodimer was produced by realigning the Cbeta0-containing TCRbeta sequence (TCRbeta-Cbeta0) with that of the 2C TCR beta-chain. Cbeta0 insertion resulted in a unique 24-residue gap opening at the Vbeta and Cbeta domain junction (data not shown). In the resulting TCR model, Cbeta0 forms a loop that was subsequently refined using an ab initio approach implemented in the loop refinement routine of the MODELLER program for which default parameters were used; the conformational space of the loop was searched using 1000 simulated annealing cycles involving the entire Cbeta0 loop, with the rest of the TCR being kept rigid during the dynamics.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
TCRbeta-Cbeta0 transcript expression during T cell development and after Ag stimulation in vivo

Earlier studies detected TCRbeta-Cbeta0 transcripts in peripheral T cells and in unseparated fetal and adult thymocytes (7, 8). Most thymocytes are CD4+CD8+ DP cells already expressing {alpha}betaTCRs, and <5% represent cells of the less mature CD4CD8 DN stage in which the TCR beta-chain is associated with the pre-TCR {alpha}-chain in a CD3-associated pre-TCR complex (22, 23). The pre-TCR controls the beta-selection checkpoint that allows proliferation and differentiation to the DP stage (23). To analyze the frequency of TCRbeta-Cbeta0 transcript expression at different stages of T cell development, we performed RT-PCR on various subpopulations of thymocytes and peripheral T cells sorted under single- or oligo-cell (1–10 cells per tube) conditions. We amplified Vbeta1- or Vbeta10-TCRbeta cDNAs and sequenced the PCR products to assign Jbeta1 or Jbeta2 gene usage. Our analysis shows that the majority of VDJbeta1 transcript-positive cells, from DN thymocytes (>66%) to mature peripheral T cells (60%), coexpress the TCRbeta-Cbeta0 isoform (Table I).


View this table:
[in this window]
[in a new window]

 
Table I. Expression of TCRbeta-Cbeta0 transcripts by immature and mature T cellsa

 
To find out whether the TCRbeta-Cbeta0 isoform might be differentially expressed after T cell activation, we analyzed its expression ex vivo among Ag-selected CD8 T cells. DBA/2 mice immunized with P815-CW3 cells undergo a high magnitude CD8 T cell response focused mainly on a ligand defined by pCW3170–179 presented by the H-2Kd MHC class I molecule (pCW3/Kd) (13, 24, 25, 26). The TCRbeta-Cbeta0 isoform can only be expressed in cells with VDJbeta1 rearrangements (7), and Jbeta1 gene usage is preferential among the Vbeta10-TCRs that characterize the pCW3/Kd-specific repertoire (13, 19, 27). By single-cell RT-PCR and sequencing, we compared TCRbeta-Cbeta0 transcript expression among pCW3/Kd-specific CD8 T cells sorted at the peak of the response with that of Vbeta10+ CD8 cells from normal DBA/2 mice. This analysis revealed that the proportion of Vbeta10DJbeta1+ cells with detectable TCRbeta-Cbeta0 transcripts was reduced by half (to 28.5%) among pCW3/Kd-specific CD8 T cells as compared with controls (60%) (Table I). Further investigation will be required to determine whether reduced TCRbeta-Cbeta0 expression after Ag activation results from a differential regulation of TCRbeta isoform splicing or from a selective loss of TCRbeta-Cbeta0-expressing T cells.

Single-cell RT-PCR amplification and cloning of full-length TCR cDNAs

We developed a protocol to amplify full-length TCR cDNAs from single cells and used frozen samples of FACS-sorted pCW3/Kd-specific CD8 T cells from a mouse (M-33) with a previously characterized TCR repertoire (13). To amplify beta-chain sequences, a first PCR was performed with primers corresponding to sequences 5' of the Vbeta10-leader (primer L-Vb10–279) and 3' of the Cb1 gene (primer Cb1-1855). Of 24 tubes that each contained a single sorted Vbeta10+ pCW3/Kd-specific CD8 T cell, 11 were positive according to the second diagnostic PCR performed with internal Vbeta10- and Cbeta-specific primers, and sequence analysis confirmed that all of these corresponded to Vbeta10DJbeta1 rearrangements (data not shown). Because only two-thirds of the Vbeta10 TCRs in the repertoire of this mouse (M-33) had been found to be rearranged to a Jbeta1 segment (13), this represents an estimated efficiency for the amplification of full-length sequences of 69% (11 of 16). In one cell sample, we amplified TCRbeta and TCRbeta-Cbeta0 cDNAs with identical Vbeta10DJbeta1.3 rearrangements, corresponding to a TCR previously identified (code Vbeta10-1.3-1b) from this mouse (13). A second cloning PCR was performed on this sample for cloning into the pMIG2 vector. As expected, colonies corresponding to either the TCRbeta (LVDJC) or TCRbeta-Cbeta0 (LVDJCbeta0C) cDNAs were obtained from a single cloning reaction.

We next attempted to coamplify full-length TCR{alpha} and TCRbeta sequences from sorted single pCW3/Kd-specific T cells from the same mouse (M-33). For this purpose, the first PCR included a mixture of primers specific for Vbeta10, Cbeta1, and Cbeta2 and for V{alpha}8 and C{alpha}. From a series of 24 sorted single cells, we amplified 11 Vbeta10-TCRbeta (including eight Vbeta10DJbeta1 and three Vbeta10DJbeta2) and three V{alpha}8-TCR{alpha} sequences. From two cell samples, sequences corresponding to TCR{alpha}, TCRbeta, and TCRbeta-Cbeta0 were amplified. These correspond to {alpha}betaTCRs expressed by two different clones that we had previously identified (codes Vbeta10-1.2-9c/V{alpha}8P29-20c and Vbeta10–1.3b/V{alpha}8P28–21c) (13). The TCR{alpha} from the latter was cloned into the pMIY2 vector because it is the clonal partner for the TCRbeta (and TCRbeta-Cbeta0) cloned above. To our knowledge, this represents the first successful direct cloning of full-length TCR cDNAs from single cells.

TCRbeta-Cbeta0 alternate splice transcripts encode protein

We first transduced 3T3 fibroblasts because they are efficient hosts for retroviral vectors, and we performed intracellular (i.c.) staining to detect TCR expression in these nonlymphoid cells. The TCRbeta-Cbeta0 isoform was apparently translated into protein, because 3T3 cells transduced with the TCRbeta-Cbeta0 vector (3T3-Cbeta0 cells) were positive when stained with the Cbeta-specific mAb, H57 (Fig. 1). However, neither of the two different Vbeta10b-specific mAbs that stained the control 3T3-TCRbeta cells recognized the TCRbeta-Cbeta0 isoform, indicating that some Vbeta10 epitopes may be altered or masked by insertion of the Cbeta0 peptide.


Figure 1
View larger version (35K):
[in this window]
[in a new window]

 
FIGURE 1. Detection of TCRbeta and TCRbeta-Cbeta0 proteins in 3T3 transductants. Because the treatment for i.c. staining results in loss of GFP, its expression (FL1) was assessed on nonpermeabilized cells. 3T3 cells and 3T3 cells transduced with TCRbeta-MIG2 or TCRbeta-Cbeta0-MIG2 viral particles were analyzed directly for FL1 (GFP) fluorescence (A) or were stained i.c. with the indicated mAb- conjugates and analyzed for FL3 (PE-Cy5) or FL2 (PE) fluorescence (B). Gray histograms represent controls without mAb. The percentage of positive cells in the region defined by the marker is indicated for each histogram, as is the mean fluorescence intensity of the positive cells.

 
The TCRbeta-Cbeta0 isoform can function at the beta-selection checkpoint

TCR gene rearrangement requires functional recombinase activating genes (Rag1 and Rag2), and T cell development in RAG-deficient mice is blocked at the DN3 stage due to the absence of a functional pre-TCR (9, 28, 29). We previously showed that retroviral expression of a TCRbeta transcript in OP9-DL1 coculture-derived, RAG-deficient DN3 cells allows their development to the DP stage (14). We now demonstrate that the TCRbeta-Cbeta0 isoform can also promote the differentiation of RAG-deficient DN3 cells, albeit somewhat less efficiently than its normal TCRbeta counterpart in terms of the percentage of DP cells and their total numbers in the cultures (Fig. 2). These findings indicate that the TCRbeta-Cbeta0 isoform clearly retains potential receptor function for immature T cells.


Figure 2
View larger version (49K):
[in this window]
[in a new window]

 
FIGURE 2. The cloned TCRbeta-Cbeta0 isoform drives the differentiation of RAG-deficient immature T cells to the DP stage. Day 14 fetal liver hemopoietic progenitor cells from RAG-deficient mice were cocultured 7 days with OP9-DL1 cells, after which time the nonadherent (mostly DN3) cells were infected by overnight coculture on MIG2, TCRbeta, or TCRbeta-Cbeta0 producer cell monolayers. Sorted GFP+/CD44CD25+ cells were cultured on OP9-DL1 monolayers (day 0). At the indicated times, nonadherent cells were recovered and stained with CD45 mAb (to exclude CD45 OP9-DL1-GFP cells) and CD4 and CD8 mAbs for FACS analysis. The CD4/CD8 profiles are displayed, and the numbers in the quadrants represent the percent of gated GFP+/CD45+ cells. In an independent experiment (not shown) analyzed on day 4, we observed 0.4, 54, and 22% DP and 0.3-, 187-, and 5.6-fold cell recovery, for MIG2, TCRbeta, TCRbeta-Cbeta0, and groups, respectively.

 
Functional recognition of pMHC by TCR{alpha}/TCRbeta-Cbeta0 surface receptors

To study the potential of the TCRbeta-Cbeta0 isoform in a mature receptor, we coexpressed the TCR{alpha} cloned from pCW3/Kd-specific T cells with its clonally related TCRbeta or TCRbeta-Cbeta0 isoforms in the TCRCD8{alpha}beta+ 58CD8 T hybridoma-derived cell line (12). The 58CD8 cells were first transduced with the TCR{alpha}-YFP virus and sorted into populations expressing two different levels of YFP (TCR{alpha}low and TCR{alpha}high), and the sorted TCR{alpha}+ cells were then retransduced with either TCRbeta or TCRbeta-Cbeta0. Analysis with various TCR-specific mAbs clearly indicated that the 58CD8-TCR{alpha}/TCRbeta-Cbeta0 transductants, as well as the 58CD8-TCR{alpha}/TCRbeta controls, expressed cell surface TCRs (Fig. 3 and data not shown). Both were positive when stained with V{alpha}8-, Cbeta-, or CD3{epsilon}-specific mAbs, but only the 58CD8-TCR{alpha}/TCRbeta cells were positive when stained with anti-Vbeta10 mAbs. This corresponds with our finding that Vbeta10-specific mAbs fail to detect the TCRbeta-Cbeta0 isoform after i.c. staining of 3T3-Cbeta0 transductants (Fig. 1). To enrich for surface TCR+ cells, the 58CD8-TCR{alpha}high/TCRbeta and 58CD8-TCR{alpha}high/TCRbeta-Cbeta0 groups were FACS-sorted as CD3{epsilon}+ cells. The 58CD8-TCR{alpha}/TCRbeta and 58CD8-TCR{alpha}/TCRbeta-Cbeta0 cells displayed a diagonal pattern after double staining with anti-V{alpha}8 and anti-Cbeta or anti-CD3{epsilon} mAbs (Figs. 3 and 4). These staining patterns suggest that both 58CD8-TCR{alpha}/TCRbeta and 58CD8-TCR{alpha}/TCRbeta-Cbeta0 cells express CD3-associated heterodimeric cell surface TCR complexes, but confirmation awaits a detailed biochemical analysis.


Figure 3
View larger version (41K):
[in this window]
[in a new window]

 
FIGURE 3. Surface TCR expression of 58CD8 cells doubly transduced with TCR{alpha} and TCRbeta-Cbeta0. Sorted 58CD8-TCR{alpha}high cells that had been retransduced with TCRbeta, TCRbeta-Cbeta0, or (empty) MIG2 viral particles were surface stained with mAbs specific for V{alpha}8 (21.14-PE) and biotinylated mAbs specific for Vbeta10 (B21.5), TCR-Cbeta (H57), or CD3{epsilon} (2C11), together with streptavidin-allophycocyanin, and analyzed by flow cytometry. Numbers indicate the percentage of cells in the respective quadrants. Sorted 58CD8-TCR{alpha}low cells retransduced with TCRbeta, TCRbeta-Cbeta0, or (empty) MIG2 viral particles showed similar patterns when separately stained with these mAbs (data not shown).

 

Figure 4
View larger version (31K):
[in this window]
[in a new window]

 
FIGURE 4. Correlated surface expression of TCR{alpha} and TCRbeta-Cbeta0 on 58CD8 transductants. Eighteen days after being sorted as surface CD3{epsilon}+ cells, the 58CD8-TCR{alpha}high/TCRbeta and 58CD8-TCR{alpha}high/TCRbeta-Cbeta0 transductants were double-stained with anti-V{alpha}8 (B21.14-PE) and biotinylated mAbs specific for either Vbeta10 (B21.5), Cbeta (H57), or CD3{epsilon} (2C11), together with streptavidin-allophycocyanin, and analyzed by flow cytometry. Numbers indicate the percentage of cells in the respective quadrants.

 
Both 58CD8-TCR{alpha}/TCRbeta and 58CD8-TCR{alpha}/TCRbeta-Cbeta0 cells produced IL-2 in response to pCW3 or anti-CD3 stimulation (Figs. 5, 6B, and7, and data not shown). Our previous work showed that many pCW3/Kd-specific clones recognize not only pCW3170–179 but also the homologous peptide pA24170–179 (19, 24). It appears that 58CD8-TCR{alpha}/TCRbeta cells can recognize pA24, but only marginally, and recognition of pA24 by 58CD8-TCR{alpha}/TCRbeta-Cbeta0 cells is even lower but is still detectable compared with controls (Fig. 5A and data not shown).


Figure 5
View larger version (23K):
[in this window]
[in a new window]

 
FIGURE 5. 58CD8-TCR{alpha} /TCRbeta-Cbeta0 double transductants can be specifically stimulated by pMHC ligands. A, Sorted CD3{epsilon}+ 58CD8-TCR{alpha}/TCRbeta (squares) and 58CD8-TCR{alpha}/TCRbeta-Cbeta0 (circles) transductants, as well as control TCR 58CD8 cells (triangles) were cultured in the presence of P815 cells and the indicated concentrations of pCW3170–179 (solid lines) or pA24170–179 (dashed lines). Triplicate cultures were prepared at each peptide concentration for each cell type, and one culture each was prepared for controls without peptides. Supernatants were collected after 48 h for measurements of IL-2. Data for titrations are presented as the mean ± SD of the triplicate SNs, with some error bars hidden by the symbols. The differences in IL-2 release from 58CD8-TCR{alpha}/TCRbeta and 58CD8-TCR{alpha}/TCRbeta-Cbeta0 cells were significant (p ≤ 0.001; one-tailed t test for independent samples) at individual peptide concentrations from 10–4 to 10–7 M for pCW3 and 10–4 M to 10–5 M for pA24. B, The IL-2 release values for each pCW3 concentration from 10–4 to 10–7 M were analyzed by linear regression to obtain the displayed best fit line. In a second experiment (not shown) where pCW3 was titrated from 10–5 to 10–8 M, the calculated regression was y = 2.9652x + 17.321; R2 = 0.999.

 

Figure 6
View larger version (15K):
[in this window]
[in a new window]

 
FIGURE 6. Relative levels of surface TCR expression and IL-2 responses upon pMHC or anti-CD3 stimulation for 58CD8-TCR{alpha}/TCRbeta and 58CD8-TCR{alpha}/TCRbeta-Cbeta0 transductants. A, Sorted CD3{epsilon}+ 58CD8-TCR{alpha}/TCRbeta and 58CD8-TCR{alpha}/TCRbeta-Cbeta0 transductants (see Fig. 4) were surface stained with mAbs specific for Cbeta (H57; n = 4), V{alpha}8 (CTVA8, n = 4; or B21.14, n = 4), CD3{epsilon} (2C11, n = 5), or CD8{alpha} (n = 1), where n represents the number of experiments. The mean fluorescence intensity (MFI) for live cells gated as FL1+ was determined, and ratios of the net MFI (MFI with mAb – MFI without mAb) for 58CD8-TCR{alpha}/TCRbeta cells divided by the net MFI for 58CD8-TCR{alpha}/TCRbeta-Cbeta0 cells were calculated. The bars represent the mean ± SD. The MFI ratios for groups with n > 1 were compared by a two-tailed t test for independent samples, and only that of H57 was significantly different from the others (p < 0.0001). B, The same cells as in A were cultured for 48 h with pCW3 (10 µM) and P815 cells or on 2C11-coated (20 µg/ml) wells. The ratios of IL-2 measured in SNs from 58CD8-TCR{alpha}/TCRbeta cells divided by that from 58CD8-TCR{alpha}/TCRbeta-Cbeta0 cells were calculated for each experiment (n = 5 for pCW3; n = 3 for 2C11) and are represented as the mean ± SD, where n represents the number of experiments.

 

Figure 7
View larger version (17K):
[in this window]
[in a new window]

 
FIGURE 7. IL-2 responses of 58CD8-TCR{alpha}/TCRbeta and 58CD8-TCR{alpha}/TCRbeta-Cbeta0 transductants after stimulation with titrated 2C11 mAb. Sorted CD3{epsilon}+ 58CD8-TCR{alpha}/TCRbeta (squares) and 58CD8-TCR{alpha}/TCRbeta-Cbeta0 (circles) transductants (see Fig. 4), as well as control TCR 58CD8 cells (triangles), were cultured in wells preincubated with the indicated concentrations of anti-CD3{epsilon} mAb (2C11) for 48 h before collecting SNs (one for each data point) for the measurement of IL-2 release.

 
The amount of IL-2 produced by 58CD8-TCR{alpha}/TCRbeta-Cbeta0 cells was consistently severalfold lower than that of control cells expressing the normal {alpha}betaTCR (Figs. 5B and 6B and data not shown), but this may have been due to apparent differences in surface TCR density. Surface expression after staining with anti-CD3 (2C11) or with two different anti-V{alpha}8 mAbs was 2- to 3-fold lower on 58CD8-TCR{alpha}/TCRbeta-Cbeta0 cells as compared with the 58CD8-TCR{alpha}/TCRbeta controls, and the relative level of H57 staining on the 58CD8-TCR{alpha}/TCRbeta-Cbeta0 cells was even lower (7–8-fold) (Fig. 6A). To investigate this parameter further, the previously sorted CD3+ 58CD8-TCR{alpha}/TCRbeta and 58CD8-TCR{alpha}/TCRbeta-Cbeta0 transductants were again labeled with anti-CD3 mAb, and each was sorted for the expression of two different levels of surface CD3. After a further 9–11 days in culture, the cells were analyzed for surface TCR expression and for stimulation by pCW3. For both 58CD8-TCR{alpha}/TCRbeta and 58CD8-TCR{alpha}/TCRbeta-Cbeta0 transductants, IL-2 responses were clearly correlated with relative surface TCR expression (Fig. 8). Moreover, 58CD8-TCR{alpha}/TCRbeta and 58CD8-TCR{alpha}/TCRbeta-Cbeta0 transductants with more similar levels of surface TCR expression showed similar IL-2 responses after pCW3 stimulation.


Figure 8
View larger version (20K):
[in this window]
[in a new window]

 
FIGURE 8. IL-2 responses of 58CD8-TCR transductants vary with relative levels of surface TCR expression. The sorted CD3+ 58CD8-TCR{alpha}high/TCRbeta and 58CD8-TCR{alpha}high/TCRbeta-Cbeta0 transductants shown in Fig. 4 were again stained with anti-CD3{epsilon} (2C11) mAb, and each was sorted into two populations displaying different levels of surface CD3 (R1 and R2 define regions of lower and higher mean fluorescence intensity (MFI), respectively). A, Nine days later, the sorted cells were stained with anti-CD3{epsilon} (2C11) and analyzed by flow cytometry. Background MFI (without mAb) ranged from 3.99 to 4.11. Relative MFI levels after staining the cells with anti-V{alpha}8 (B21.14) were similar to those shown for anti-CD3 (data not shown). B, Eleven days after sorting, the cells were stimulated with the indicated concentrations of pCW3 in the presence of P815 cells. Two cultures were prepared at each concentration for each cell type. The SNs were collected after 48 h to measure IL-2 release. IL-2 was undetectable (<5pg/ml) in SNs from control cultures prepared without pCW3. Data are presented as the mean ± SD (two SNs tested at each point from the duplicate cultures) with some error bars hidden by the symbols.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The alternately spliced TCRbeta-Cbeta0 transcript was discovered in mice long ago but a physiological role for this isoform was considered remote, partly because no human sequence homologue was identified and the rat homologue was found to lack functional splice sites (7, 8). It is now commonly accepted that many aspects controlling T cell development and function have evolved differently in otherwise closely related mammals (30). Moreover, a recent genome-wide analysis comparing the splice patterns of human vs mouse (or rat) orthologous proteins concluded that most (>70%) alternate cassette exons (i.e., those not included in constitutive transcripts) represent relatively recent evolutionary events (31). Many proteins controlling T cell development, differentiation, or function are coordinately regulated at the level of alternative splicing (1). This may involve the combinatorial expression of spliceosome proteins and associated regulatory proteins, as well as the coordinated interaction of splice factors with transcription factors (1, 32). Our comparison of pCW3/Kd-selected and normal T cells by single-cell RT-PCR suggests that TCR beta-chain splice isoform expression may likewise be differentially regulated after Ag stimulation. Further work will be required to understand the physiological role, if any, of the TCRbeta-Cbeta0 isoform in the mouse immune system, but several possibilities can be considered. The TCRbeta-Cbeta0 isoform might compete with or replace the normal TCR beta-chain in receptor assembly and thus modulate the activation, function, or differentiation of immature or mature T cells. In humans and mice, the {alpha}betaT lineage includes a subset of CD1-restricted NKT cells that are characterized by the expression of semi-invariant TCR {alpha}-chains (33). Expression of the TCRbeta-Cbeta0 isoform might likewise drive the development or selection of a new subclass of specialized {alpha}betaT cells.

Differential recognition of the TCRbeta-Cbeta0 isoform by Abs specific for the normal TCR beta-chain may provide useful clues about its structure. The TCRbeta-Cbeta0 isoform was clearly recognized by the Cbeta-specific mAb H57 but not by Vbeta10-specific mAbs. FACS analysis indicated that H57 recognizes the TCRbeta-Cbeta0 protein not only on 58CD8 cells, apparently as part of a TCR/CD3 complex, but also in fibroblasts as an i.c. protein not associated with other TCR or CD3 proteins. The H57 mAb apparently binds to the C domain FG loop on normal TCR beta-chains (34). Our finding that the relative level of H57 staining was consistently lower for cells expressing the TCRbeta-Cbeta0 isoform as compared with those with a normal TCRbeta (Fig. 6A) may result from an alteration or partial masking of the H57 epitope by the Cbeta0 peptide cassette. TCR CDR3-loops can apparently adapt multiple conformations (35, 36, 37, 38, 39, 40). The much longer Cbeta0 peptide may represent an intrinsically disordered loop commonly found inserted in eukaryotic proteins (41). With this in mind, we performed molecular modeling and dynamic simulations and were able to define a large number of potential Cbeta0 loop conformations in the context of an otherwise normal {alpha}betaTCR structure (Fig. 9). Consistent with our functional studies showing cognate pMHC-induced IL-2 release by 58CD8-TCR{alpha}/TCRbeta-Cbeta0 cells, the overall space defined by the derived Cbeta0 loop conformations is clearly compatible with TCR{alpha}/TCRbeta-Cbeta0 pairing, and none of the loops reaches the CDR-defined interface for pMHC ligand binding.


Figure 9
View larger version (68K):
[in this window]
[in a new window]

 
FIGURE 9. Conformational space accessible to Cbeta0 loops within the context of an {alpha}betaTCR. A–C, Three different views of the TCR models are represented, with the {alpha}- and beta-chains depicted as gray and blue ribbons, respectively, and with the V domains at the top. A random selection of 50 Cbeta0 loop conformers resulting from the simulated annealing runs is shown in green. The Cbeta-FG loop is highlighted in red for reference. D–F, For clarity, only four Cbeta0 conformations are shown. These four loops represent the conformers for which the distance between a residue of the loop and the loop’s anchor points is the greatest. As such, they define the outer limits of the accessible conformational space of Cbeta0.

 
The functional engagement of {alpha}betaTCRs with pMHC ligands depends not only on TCR structure, CD3 subunit composition, and CD4 or CD8 coengagement, but also on the dynamic formation and flow of signaling microclusters in cell membranes (3, 4, 6, 42, 43). The molecular composition and structure of the pre-TCR complex and its function as a receptor for immature T cells is not yet completely understood (23, 44), but a recent study supports a model whereby critical charged amino acid residues on the extracellular domain of the pre-TCR {alpha}-chain mediate spontaneous pre-TCR oligomerization that, in turn, initiates cell-autonomous signaling (45). It will be interesting to investigate whether the replacement or coexpression of TCRbeta with its TCRbeta-Cbeta0 isoform might interfere, modulate, or even facilitate these dynamic processes required for {alpha}betaTCR or pre-TCR signaling.

Our present findings documenting the intrinsic receptor function and specificity of the TCRbeta-Cbeta0 isoform reveal an intriguing paradox concerning {alpha}betaTCRs whose function depends critically on structure, not only for specific pMHC recognition but also for proper association with CD3 signaling dimers (3, 4, 6, 46). TCR genes appear to have evolved in parallel with MHC genes encoding the peptide-presenting ligands (47). It thus seems remarkable that these highly conserved receptors can accommodate the insertion of the 24-aa-long Cbeta0 cassette without loss of function. The challenge now will be to determine whether a new TCR function has evolved together with this natural structural variant of the mouse TCR beta-chain.


    Acknowledgments
 
We thank K. Vignali and A. Burton for construction of the pMIG2 and pMIY2 cloning vectors, C. Bella for cell sorting, and A. Cottalorda for help with IL-2 assays. We are grateful to our colleagues for gifts of cell lines, to A. Wilson and N. Bonnefoy-Bérard for discussions, and to R. Lowry for the VassarStats website (http://faculty.vassar.edu/lowry/VassarStats.html).


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 M.C. is supported by a Canadian Institutes of Health Research Doctoral Research Award. D.A.A.V. and A.L.S.-W. are supported by the National Institutes of Health and the American Lebanese Syrian Associated Charities, J.C.Z.-P. is supported by a Canada Research Chair in Developmental Immunology, and the J.L.M. laboratory is supported by Institut National de la Santé et de la Recherche Médicale and La Ligue Contre le Cancer (Rhône Département, France). Back

2 Current address: Institut National de la Santé et de la Recherche Médicale Unité 817, Institut de Recherche sur le Cancer de Lille, Lille, France. Back

3 Address correspondence and reprint requests to Dr. Janet L. Maryanski at the current address: Institut National de la Santé et de la Recherche Médicale Unité 576, Hopital de l’Archet, 151 Route de Saint-Antoine de Ginestière, Boîte Postale 3079, 06202 Nice Cedex 3, France. E-mail address: maryanski{at}cervi-lyon.inserm.fr or maryanski{at}unice.fr Back

4 Abbreviations used in this paper: pMHC, peptides presented by MHC molecules; CSC, chondroitin sulfate c; DN, double negative; DP, double positive; i.c., intracellular; SN, supernatant; Pb, Polybrene; SP, single positive; YFP, yellow fluorescent protein. Back

Received for publication June 14, 2006. Accepted for publication September 29, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Lynch, K. W.. 2004. Consequences of regulated pre-mRNA splicing in the immune system. Nat. Rev. Immunol. 4: 931-940. [Medline]
  2. Davis, M. M., P. J. Bjorkman. 1988. T-cell antigen receptor genes and T-cell recognition. Nature 334: 395-402. [Medline]
  3. Rudolph, M. G., R. L. Stanfield, I. A. Wilson. 2006. How TCRs bind MHCs, peptides, and coreceptors. Annu. Rev. Immunol. 24: 419-466. [Medline]
  4. Kuhns, M. S., M. M. Davis, K. C. Garcia. 2006. Deconstructing the form and function of the TCR/CD3 complex. Immunity 24: 133-139. [Medline]
  5. Malissen, B., M. Malissen. 1996. Functions of TCR and pre-TCR subunits: lessons from gene ablation. Curr. Opin. Immunol. 8: 383-393. [Medline]
  6. Call, M. E., K. W. Wucherpfennig. 2005. The T cell receptor: critical role of the membrane environment in receptor assembly and function. Annu. Rev. Immunol. 23: 101-125. [Medline]
  7. Behlke, M. A., D. Y. Loh. 1986. Alternative splicing of murine T-cell receptor beta-chain transcripts. Nature 322: 379-382. [Medline]
  8. Dent, A. L., P. J. Fink, S. M. Hedrick. 1989. Characterization of an alternative exon of the murine T cell receptor beta-chain. Pattern of expression and evolutionary conservation. J. Immunol. 143: 322-328. [Abstract]
  9. Shinkai, Y., G. Rathbun, K. P. Lam, E. M. Oltz, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A. M. Stall, et al 1992. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68: 855-867. [Medline]
  10. Schmitt, T. M., J. C. Zuniga-Pflucker. 2002. Induction of T cell development from hematopoietic progenitor cells by {delta}-like-1 in vitro. Immunity 17: 749-756. [Medline]
  11. Uyttenhove, C., J. Van Snick, T. Boon. 1980. Immunogenic variants obtained by mutagenesis of mouse mastocytoma P815. I. Rejection by syngeneic mice. J. Exp. Med. 152: 1175-1183. [Abstract/Free Full Text]
  12. Stotz, S. H., L. Bolliger, F. R. Carbone, E. Palmer. 1999. T cell receptor (TCR) antagonism without a negative signal: evidence from T cell hybridomas expressing two independent TCRs. J. Exp. Med. 189: 253-264. [Abstract/Free Full Text]
  13. Hamrouni, A., A. Aublin, P. Guillaume, J. L. Maryanski. 2003. T cell receptor gene rearrangement lineage analysis reveals clues for the origin of highly restricted antigen-specific repertoires. J. Exp. Med. 197: 601-614. [Abstract/Free Full Text]
  14. Ciofani, M., T. M. Schmitt, A. Ciofani, A. M. Michie, N. Çuburu, A. Aublin, J. L. Maryanski, J. C. Zúñiga-Pflücker. 2004. Obligatory role for cooperative signaling by pre-TCR and Notch during thymocyte differentiation. J. Immunol. 172: 5230-5239. [Abstract/Free Full Text]
  15. Wilson, A., C. Marechal, H. R. MacDonald. 2001. Biased Vbeta usage in immature thymocytes is independent of DJbeta proximity and pT{alpha} pairing. J. Immunol. 166: 51-57. [Abstract/Free Full Text]
  16. Szymczak, A. L., C. J. Workman, Y. Wang, K. M. Vignali, S. Dilioglou, E. F. Vanin, D. A. Vignali. 2004. Correction of multi-gene deficiency in vivo using a single ‘self-cleaving’ 2A peptide-based retroviral vector. Nat. Biotechnol. 22: 589-594. [Medline]
  17. Trop, S., M. Rhodes, D. L. Wiest, P. Hugo, J. C. Zuniga-Pflucker. 2000. Competitive displacement of pT{alpha} by TCR-{alpha} during TCR assembly prevents surface coexpression of pre-TCR and {alpha}beta TCR. J. Immunol. 165: 5566-5572. [Abstract/Free Full Text]
  18. Le Doux, J. M., N. Landazuri, M. L. Yarmush, J. R. Morgan. 2001. Complexation of retrovirus with cationic and anionic polymers increases the efficiency of gene transfer. Hum. Gene Ther. 12: 1611-1621. [Medline]
  19. Casanova, J. L., F. Martinon, H. Gournier, C. Barra, C. Pannetier, A. Regnault, P. Kourilsky, J. C. Cerottini, J. L. Maryanski. 1993. T cell receptor selection by and recognition of two class I major histocompatibility complex-restricted antigenic peptides that differ at a single position. J. Exp. Med. 177: 811-820. [Abstract/Free Full Text]
  20. Sali, A., T. L. Blundell. 1993. Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234: 779-815. [Medline]
  21. Lefranc, M. P., V. Giudicelli, C. Ginestoux, J. Bodmer, W. Muller, R. Bontrop, M. Lemaitre, A. Malik, V. Barbie, D. Chaume. 1999. IMGT, the international ImMunoGeneTics database. Nucleic Acids Res. 27: 209-212. [Abstract/Free Full Text]
  22. Saint-Ruf, C., K. Ungewiss, M. Groettrup, L. Bruno, H. J. Fehling, H. von Boehmer. 1994. Analysis and expression of a cloned pre-T cell receptor gene. Science 266: 1208-1212. [Abstract/Free Full Text]
  23. von Boehmer, H., I. Aifantis, J. Feinberg, O. Lechner, C. Saint-Ruf, U. Walter, J. Buer, O. Azogui. 1999. Pleiotropic changes controlled by the pre-T-cell receptor. Curr. Opin. Immunol. 11: 135-142. [Medline]
  24. Maryanski, J. L., R. S. Accolla, B. Jordan. 1986. H2-restricted recognition of cloned HLA class I gene products expressed in mouse cells. J. Immunol. 136: 4340-4347. [Abstract]
  25. Maryanski, J. L., P. Pala, G. Corradin, B. R. Jordan, J. C. Cerottini. 1986. H-2-restricted cytolytic T cells specific for HLA can recognize a synthetic HLA peptide. Nature 324: 578-579. [Medline]
  26. MacDonald, H. R., J. L. Casanova, J. L. Maryanski, J. C. Cerottini. 1993. Oligoclonal expansion of major histocompatibility complex class I-restricted cytolytic T lymphocytes during a primary immune response in vivo: direct monitoring by flow cytometry and polymerase chain reaction. J. Exp. Med. 177: 1487-1492. [Abstract/Free Full Text]
  27. Casanova, J. L., J. C. Cerottini, M. Matthes, A. Necker, H. Gournier, C. Barra, C. Widmann, H. R. MacDonald, F. Lemonnier, B. Malissen, J. L. Maryanski. 1992. H-2-restricted cytolytic T lymphocytes specific for HLA display T cell receptors of limited diversity. J. Exp. Med. 176: 439-447. [Abstract/Free Full Text]
  28. Mombaerts, P., J. Iacomini, R. S. Johnson, K. Herrup, S. Tonegawa, V. E. Papaioannou. 1992. RAG-1-deficient mice have no mature B and T lymphocytes. Cell 68: 869-877. [Medline]
  29. Shinkai, Y., S. Koyasu, K. Nakayama, K. M. Murphy, D. Y. Loh, E. L. Reinherz, F. W. Alt. 1993. Restoration of T cell development in RAG-2-deficient mice by functional TCR transgenes. Science 259: 822-825. [Abstract/Free Full Text]
  30. Mestas, J., C. C. Hughes. 2004. Of mice and not men: differences between mouse and human immunology. J. Immunol. 172: 2731-2738. [Abstract/Free Full Text]
  31. Modrek, B., C. J. Lee. 2003. Alternative splicing in the human, mouse and rat genomes is associated with an increased frequency of exon creation and/or loss. Nat. Genet. 34: 177-180. [Medline]
  32. Heyd, F., G. ten Dam, T. Moroy. 2006. Auxiliary splice factor U2AF26 and transcription factor Gfi1 cooperate directly in regulating CD45 alternative splicing. Nat. Immunol. 7: 859-867. [Medline]
  33. Lantz, O., A. Bendelac. 1994. An invariant T cell receptor {alpha} chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD48 T cells in mice and humans. J. Exp. Med. 180: 1097-1106. [Abstract/Free Full Text]
  34. Wang, J., K. Lim, A. Smolyar, M. Teng, J. Liu, A. G. Tse, R. E. Hussey, Y. Chishti, C. T. Thomson, R. M. Sweet, et al 1998. Atomic structure of an {alpha}beta T cell receptor (TCR) heterodimer in complex with an anti-TCR fab fragment derived from a mitogenic antibody. EMBO J. 17: 10-26. [Medline]
  35. Garcia, K. C., M. Degano, L. R. Pease, M. Huang, P. A. Peterson, L. Teyton, I. A. Wilson. 1998. Structural basis of plasticity in T cell receptor recognition of a self peptide-MHC antigen. Science 279: 1166-1172. [Abstract/Free Full Text]
  36. Ding, Y. H., B. M. Baker, D. N. Garboczi, W. E. Biddison, D. C. Wiley. 1999. Four A6-TCR/peptide/HLA-A2 structures that generate very different T cell signals are nearly identical. Immunity 11: 45-56. [Medline]
  37. Degano, M., K. C. Garcia, V. Apostolopoulos, M. G. Rudolph, L. Teyton, I. A. Wilson. 2000. A functional hot spot for antigen recognition in a superagonist TCR/MHC complex. Immunity 12: 251-261. [Medline]
  38. Reiser, J. B., C. Gregoire, C. Darnault, T. Mosser, A. Guimezanes, A. M. Schmitt-Verhulst, J. C. Fontecilla-Camps, G. Mazza, B. Malissen, D. Housset. 2002. A T cell receptor CDR3beta loop undergoes conformational changes of unprecedented magnitude upon binding to a peptide/MHC class I complex. Immunity 16: 345-354. [Medline]
  39. Kjer-Nielsen, L., C. S. Clements, A. W. Purcell, A. G. Brooks, J. C. Whisstock, S. R. Burrows, J. McCluskey, J. Rossjohn. 2003. A structural basis for the selection of dominant {alpha}beta T cell receptors in antiviral immunity. Immunity 18: 53-64. [Medline]
  40. Reiser, J. B., C. Darnault, C. Gregoire, T. Mosser, G. Mazza, A. Kearney, P. A. van der Merwe, J. C. Fontecilla-Camps, D. Housset, B. Malissen. 2003. CDR3 loop flexibility contributes to the degeneracy of TCR recognition. Nat. Immunol. 4: 241-247. [Medline]
  41. Fukuchi, S., K. Homma, Y. Minezaki, K. Nishikawa. 2006. Intrinsically disordered loops inserted into the structural domains of human proteins. J. Mol. Biol. 355: 845-857. [Medline]
  42. Krogsgaard, M., M. M. Davis. 2005. How T cells ‘see’ antigen. Nat. Immunol. 6: 239-245. [Medline]
  43. Yokosuka, T., K. Sakata-Sogawa, W. Kobayashi, M. Hiroshima, A. Hashimoto-Tane, M. Tokunaga, M. L. Dustin, T. Saito. 2005. Newly generated T cell receptor microclusters initiate and sustain T cell activation by recruitment of Zap70 and SLP-76. Nat. Immunol. 6: 1253-1262. [Medline]
  44. Berger, M. A., V. Dave, M. R. Rhodes, G. C. Bosma, M. J. Bosma, D. J. Kappes, D. L. Wiest. 1997. Subunit composition of pre-T cell receptor complexes expressed by primary thymocytes: CD3{delta} is physically associated but not functionally required. J. Exp. Med. 186: 1461-1467. [Abstract/Free Full Text]
  45. Yamasaki, S., E. Ishikawa, M. Sakuma, K. Ogata, K. Sakata-Sogawa, M. Hiroshima, D. L. Wiest, M. Tokunaga, T. Saito. 2006. Mechanistic basis of pre-T cell receptor-mediated autonomous signaling critical for thymocyte development. Nat. Immunol. 7: 67-75. [Medline]
  46. Backstrom, B. T., E. Milia, A. Peter, B. Jaureguiberry, C. T. Baldari, E. Palmer. 1996. A motif within the T cell receptor {alpha} chain constant region connecting peptide domain controls antigen responsiveness. Immunity 5: 437-447. [Medline]
  47. Litman, G. W., J. P. Cannon, L. J. Dishaw. 2005. Reconstructing immune phylogeny: new perspectives. Nat. Rev. Immunol. 5: 866-879. [Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aublin, A.
Right arrow Articles by Maryanski, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aublin, A.
Right arrow Articles by Maryanski, J. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS