HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Aublin, A. Articles by Maryanski, J. L. Search for Related Content PubMed PubMed Citation Articles by Aublin, A. Articles by Maryanski, J. L.

A Natural Structural Variant of the Mouse TCR -Chain Displays Intrinsic Receptor Function and Antigen Specificity¹

Anne Aublin^*,, Maria Ciofani, Nancy Willkomm^*,, Abdelbasset Hamrouni^2,*,, Andrea L. Szymczak-Workman^¶, Tomio Takahashi^*,, Yongoua Sandjeu^*,, Philippe Guillaume^||, Dario A. A. Vignali^¶, Olivier Michielin^||, Juan Carlos Zúñiga-Pflücker and Janet L. Maryanski^3,*,

^* Institut National de la Santé et de la Recherche Médicale Unité 503, Lyon, France; Université Claude Bernard Lyon I, Lyon, France; Department of Immunology, University of Toronto, Sunnybrook Research Institute, Toronto, Ontario, Canada; Ecole Normale Supérieure de Lyon, Lyon, France; ^¶ Department of Immunology, St. Jude Children’s Research Hospital, Memphis, TN 38105; and ^|| Ludwig Institute for Cancer Research, Lausanne Branch, University of Lausanne, Epalinges, Switzerland

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The C0 alternate cassette exon is located between the J1 and C1 genes in the mouse TCR -locus. In T cells with a VDJ1 rearrangement, the C0 exon may be included in TCR transcripts (herein called TCR-C0 transcripts), potentially inserting an additional 24 aa between the V and C domains of the TCR -chain. These TCR splice isoforms may be differentially regulated after Ag activation, because we detected TCR-C0 transcripts in a high proportion (>60%) of immature and mature T cells having VDJ1 rearrangements but found a substantially reduced frequency (<35%) of TCR-C0 expression among CD8 T cells selected by Ag in vivo. To study the potential activity of the TCR-C0 splice variant, we cloned full-length TCR cDNAs by single-cell RT-PCR into retroviral expression vectors. We found that the TCR-C0 splice isoform can function during an early stage of T cell development normally dependent on TCR -chain expression. We also demonstrate that T hybridoma-derived cells expressing a TCR-C0 isoform together with the clonally associated TCR -chain recognize the same cognate peptide-MHC ligand as the corresponding normal TCR. This maintenance of receptor function and specificity upon insertion of the C0 peptide cassette signifies a remarkable adaptability for the TCR -chain, and our findings open the possibility that this splice isoform may function in vivo.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Alternative splicing of pre-mRNA transcripts is a major mechanism for the structural and functional diversification of mammalian genes, and proteins encoded by splice variants control multiple processes of lymphocyte development, activation, and effector function (1). T lymphocytes recognize Ags as complexes of foreign peptides presented by MHC molecules (pMHC)⁴ via clonally distributed, heterodimeric TCRs (2, 3, 4). The paired TCR - and -chains have very short cytoplasmic tails lacking signal transduction capacity, and receptor function requires association of the TCR with CD3, , , and signal transduction proteins (5, 6). Specific pMHC ligand recognition occurs at the molecular surface formed by the CDR loops encoded by rearranged TCR VJ and VDJ genes. After transcription, the rearranged VJ and VDJ sequences are spliced to the first exons of their respective C or C genes to form mature mRNAs encoding TCR - and --chains. Two D-J-C gene clusters are located in the Tcrb locus, and in mice an alternate exon termed "C0" is located in the intervening sequence that separates the J1 genes from the C1 gene (7). In cells having a V-D-J1 rearrangement, the C0 exon can be alternatively spliced in between the rearranged VDJ1 sequence and the first exon of the C1 gene, potentially adding a 24-aa-long peptide cassette between the V and C domains of the TCR -chain. However, it is not known whether such transcripts (hereafter called TCR-C0) are translated into protein nor whether they are functional (7, 8).

We investigate the potential regulation of TCR splice isoform expression by single/oligo cell RT-PCR analysis of TCR-C0 expression at various stages of T cell development and after Ag activation in vivo. We cloned full-length TCR cDNAs by single cell RT-PCR and show that the TCR-C0 transcript can be translated into protein and can function at the critical -selection checkpoint of early T cell development. We also demonstrate that T hybridoma-derived cells doubly transduced with clonally derived, paired TCR- and TCR-C0 constructs express cell surface TCRs and can be stimulated by cognate pMHC for IL-2 secretion. This maintenance of TCR function and specificity upon insertion of the C0 cassette peptide opens the intriguing possibility that a new receptor function may have coevolved with the C0 exon in mice.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Mice and cell lines

DBA/2 and RAG-2-deficient (9) mice were maintained at our animal facilities under procedures approved by our institutional animal care committees. The derivation and culture of OP9-DL1 cells and P815 cells (clone P1) are described elsewhere (10, 11). The 293-derived (EcoPack2; BD Biosciences) and GP+E86 (from P. Ohashi, Ontario Cancer Institute, Toronto, Canada) retroviral packaging cell lines and the NIH-3T3 fibroblasts (from J. Baguet, Institut National de la Santé et de la Recherche Médicale Unite 503, Lyon, France) were cultured in DMEM with added glutamine (2 mM), HEPES (10 mM), gentamicin (40 µg/ml) (final concentrations, all from Life Technologies), and 10% FCS (Dominique Dutscher). The TCR^–CD8⁺ mouse T hybridoma-derived cell line 58CD8 (12) (from E. Palmer, University Hospital, Basel, Switzerland) was cultured in the above medium with 5% FCS and 2-ME (50 µM; Invitrogen Life Technologies).

Flow cytometry

Purified or biotinylated mAbs, FITC-, PE-, or PE-Cy5-conjugated mAbs, and streptavidin-allophycocyanin were purchased from BD Biosciences with the exception of the CTVB10b-PE (anti-V10^b), CTVA8-biotin (anti-V8), and anti-CD8-PE-Cy5 conjugates, which purchased from Caltag Laboratories. Previously described procedures (13, 14, 15) for cell preparation and staining were used, and after staining, the cells were analyzed or sorted using FACSCalibur or Vantage instruments (BD Biosciences).

RT-PCR amplification of partial TCR sequences

Sorting conditions for single-cell RT-PCR were as described (13) except that for double-negative (DN) and double-positive (DP) thymocytes, 3–10 cells (instead of one) were sorted per microtube to compensate for the reduced frequency of cells expected to have TCR transcripts using a particular V gene. Conditions for two-step nested RT-PCR amplification, gel migration, and sequencing of TCR sequences from sorted cells were as described (13). Primers for the first PCR were Vb1-217 (ggaatgtgagcaacatctgg) or Vb10-136 (aaactctgggccacgatact) for V1 or V10, respectively, and Cb-523 (ctcagctccacgtggtca) for C. Primers for the second PCR were Vb1-279 (cgccagagctcatgtttctc) or Vb10-218 (gcaactcattgtaaacgaaaca) and Cb-480 (cgagggtagccttttgtttg). Amplified PCR products were directly sequenced to determine J usage as described (13) by using primers specific for V1 (Vb1-333; tgcccagtcgttttatacctg) or V10 (Vb10-seq; aggcgcttctcacctcagtcttca). To detect the expression of alternate splice VDJ1-C0-C1 transcripts from cells expressing a VDJ1 transcript, an additional nested second PCR was performed (from the first PCR) using V10- or V1-specific primers (Vb1-279 or Vb10-218) together with a C0-specific primer, Cb0–439 (tgagatgtaagagagctgtggtg).

Single-cell RT-PCR amplification and cloning of full-length TCR cDNAs

Frozen samples of single CD8 T cells specific for the pCW3/K^d ligand previously sorted from mouse M-33 under RT-PCR conditions (13) were used to amplify cDNAs corresponding to full-length TCR and TCR transcripts. The first PCR was performed in a final volume of 50 µl containing 1 U of Taq polymerase in the manufacturer’s 1x reaction buffer (Roche), 2.85 mM MgCl₂ (Roche), 200 µM each dNTP (Promega), and 100 nM each primer. Primers for the first PCRs were L-Vb10-279 (cttatttgccctgccttgac), Cb1-1855 (aggcattttccaggtcacaa), Cb2-1174 (tttagtctgtttcagagtcaaggtg), L-Va8-178 (actcaaggaccaagtgtcatttc), and 1163-Ca-IVS (gattgtgaatcagggccaac). The first PCR program begins at 95°C for 2 min, continues with 35 cycles of 10 s at 95°C, 45 s at 59°C, and 1 min 30 s at 72°C, and ends with 5 min at 72°C.

Separate second "diagnostic" PCRs were performed using internal primers to determine which samples were positive for TCR or TCR. For the diagnostic PCRs, a 0.5-µl aliquot of the first PCR was added to a final volume of 50 µl containing 0.5 U of Taq polymerase with the recommended 1 x reaction buffer (Roche), 1.75 mM MgCl₂ (Roche), 200 µM each dNTP (Promega), and 100 nM each primer. Primers for TCR were Vb10-218 (gcaactcattgtaaacgaaaca) and Cb-480 (cgagggtagccttttgtttg), and the primers for TCR were L-Va8-178 (actcaaggaccaagtgtcatttc) and Ca-533 (aacgttccagattccatggtt). The positive PCR products were sequenced directly using a BigDye sequencing kit (Applied Biosystems) with the Vb10-seq primer (aggcgcttctcacctcagtcttca) for TCR and theVa8-rev-493 (aggagctgctgctcttatgg) and Ca-516 (ggttttcggcacattgattt) primers for TCR. Sequences were analyzed on an ABI PRISM 3100 genetic analyzer (Applied Biosystems).

To amplify TCR sequences for cloning, separate second "cloning" PCRs were performed in quadruplicate by amplification of 3 µl of the selected first PCR using the BamHI-LVb10 (cgcccaggatccactatgggctgtaggctcctaagctgtgtgg) and Cb1-TGA-XhoI (ccgcgcctcgagtcatgaattctttcttttgaccatagc) primers for the full-length TCR and the BamHI-Va8-M33–235 (cgcccaggatcccttctatgaacatgcgtcctg) and XhoI-Ca-TGA (ccgcgcctcgagtcaactggaccacagcctc) primers for the full-length TCR. The forward primers incorporate a BamHI restriction site and the ATG codon that initiates the V10 or V8 leader sequences, and the reverse primers incorporate an XhoI site and the TGA termination codon for the C1 or C sequences. The PCR conditions were as described above for the diagnostic PCR, except that the polymerase used was the Expand High Fidelity Taq (Roche). The second cloning PCR program begins at 95°C for 2 min and 72°C for 5 s, continues with 35 cycles of 10 s at 95°C, 1 min at 61°C, and 1 min 30 s at 72°C, and ends with 5 min at 72°C.

The pMIG2 and pMIY2 plasmids were derived from bicistronic murine stem cell virus-based retroviral vectors that encode GFP or yellow fluorescent protein (YFP), respectively, by introducing a new multiple cloning site (sequence gaa ttc aga tct tac gta gct agc gga tcc caa ttg ctc gag) into the EcoRI/XhoI site 5' of the internal ribosome entry site sequence (16). Cloning was performed after BamHI/XhoI digestion of the vector and the gel-purified PCR products. After an initial screening by PCR amplification and sequencing, selected colonies were subcloned and the plasmids were purified (EndoFree plasmid maxi kit; Qiagen) for transfection and for sequencing of the complete inserts. The cloned TCR sequences are available under GenBank accession numbers DQ126340 (TCR), DQ126341 (TCR-C0), and DQ186679 (TCR).

Transduction of 3T3 fibroblasts or 58CD8 cells and cell sorting

Supernatants (SNs) containing viral particles for transduction were produced by transient or stable transfection of the 293-derived (EcoPack2; BD Biosciences) or GP+E86 retroviral packaging cell lines, respectively, as described (16, 17). Transduction of NIH-3T3 fibroblasts was performed with a retroviral SN in the presence of Polybrene (Pb; Sigma-Aldrich, catalog no. H9268) as described (16).

A protocol involving virus-copolymer complex formation and centrifugation (18) was adapted for the transduction of 58CD8 cells. Frozen viral SNs in 2-ml Eppendorf tubes were rapidly thawed (37°C) and mixed first with Pb and then with chondroitin sulfate C (CSC; Sigma-Aldrich, catalog no. C4384), with vigorous mixing after each addition. Stock solutions of each polymer were 20 mg/ml, and the final concentration of each was 80 µg/ml. After a 20-min incubation at 37°C, the virus-Pb/CSC mixtures were centrifuged 5 min in a tabletop Heraeus Biofuge Pico centrifuge at 10,000 x g, and the pellets containing virus-Pb/CSC complexes were resuspended in culture medium in a volume 10-fold reduced as compared with the original viral SN. Medium from the wells of flat-bottom 96-well plates plated the previous day at 5000 58CD8 cells per well was removed and replaced with the virus-Pb/CSC mixture. After 24 h of incubation with the viral complexes, the cells were transferred into 24-well plates.

The 58CD8 cells were first transduced with the TCR-MIY2 construct. Seven days later, 58CD8-YFP⁺ cells were sorted as YFP^low or YFP^high populations and, 5 days after sorting, the 58CD8-YFP^low, 58CD8-YFP^high, and 58CD8 cells were separately transduced with MIG2, TCR-MIG2, or TCR-C0-MIG2 viruses. Five weeks later, the 58CD8-TCR^high/TCR and 58CD8-TCR^high/TCR-C0 groups were labeled with 2C11-biotin/streptavidin-allophycocyanin and sorted as surface CD3⁺ cells.

OP9-DL1 cocultures

RAG-deficient hemopoietic progenitor cells from day 14 fetal liver were cultured on OP9-DL1 monolayers in the presence of 1 ng/ml IL-7 and 5 ng/ml Flt-3L, after which the cells were infected by overnight culture on MIG2, TCR-MIG2, or TCR-C0-MIG2 viral producer monolayers as described (10, 14). The following day, GFP⁺/CD44^–CD25⁺ (DN3) cells were sorted and cocultured on OP9-DL1 monolayers for a further 6 days.

Stimulation of 58CD8-TCR transductants and IL-2 assay

58CD8-TCR transductants (60,000 cells/well) were incubated in 96-well plates (Falcon Plastics) with K^d+ P815 cells (50,000 cells/well) in the presence of pCW3_170–179 and pA24_170–179 (19) or in wells precoated overnight with the 2C11 mAb (BD Biosciences). Supernatants were collected after 48 h of culture. IL-2 concentrations were measured with a CBA mouse IL-2 flex set using a FACSCalibur and FCAP Array software (all BD Biosciences).

Searching for conformational space accessible to C0 loops in a model TCR

A homology model of the TCR/TCR heterodimer was built based on the 2C TCR template (Protein Data Bank code identifier 1TCR) by satisfaction of spatial restraints using the Modeler program (20); the - and -chains were aligned separately using a dynamic programming method implemented in the Modeler program. The sequence identity was 73 and 69% for the - and -chains, respectively. The alignment was compared with prealigned TCR sequences (21) to insure that all conserved sequence motifs were correctly assigned. The 2C TCR template was chosen because its combined and sequence identity was the highest among all of the crystallized TCR structures. The heterodimer complex was subsequently obtained by simultaneous global optimization of alignment-derived restraints for both the - and -chains. Similarly, a model for the TCR/TCR-C0 heterodimer was produced by realigning the C0-containing TCR sequence (TCR-C0) with that of the 2C TCR -chain. C0 insertion resulted in a unique 24-residue gap opening at the V and C domain junction (data not shown). In the resulting TCR model, C0 forms a loop that was subsequently refined using an ab initio approach implemented in the loop refinement routine of the MODELLER program for which default parameters were used; the conformational space of the loop was searched using 1000 simulated annealing cycles involving the entire C0 loop, with the rest of the TCR being kept rigid during the dynamics.

	Results

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
TCR-C0 transcript expression during T cell development and after Ag stimulation in vivo

Earlier studies detected TCR-C0 transcripts in peripheral T cells and in unseparated fetal and adult thymocytes (7, 8). Most thymocytes are CD4⁺CD8⁺ DP cells already expressing TCRs, and <5% represent cells of the less mature CD4^–CD8^– DN stage in which the TCR -chain is associated with the pre-TCR -chain in a CD3-associated pre-TCR complex (22, 23). The pre-TCR controls the -selection checkpoint that allows proliferation and differentiation to the DP stage (23). To analyze the frequency of TCR-C0 transcript expression at different stages of T cell development, we performed RT-PCR on various subpopulations of thymocytes and peripheral T cells sorted under single- or oligo-cell (1–10 cells per tube) conditions. We amplified V1- or V10-TCR cDNAs and sequenced the PCR products to assign J1 or J2 gene usage. Our analysis shows that the majority of VDJ1 transcript-positive cells, from DN thymocytes (>66%) to mature peripheral T cells (60%), coexpress the TCR-C0 isoform (Table I).

View this table: [in this window] [in a new window]   Table I. Expression of TCR-C0 transcripts by immature and mature T cellsa

Single-cell RT-PCR amplification and cloning of full-length TCR cDNAs

We developed a protocol to amplify full-length TCR cDNAs from single cells and used frozen samples of FACS-sorted pCW3/K^d-specific CD8 T cells from a mouse (M-33) with a previously characterized TCR repertoire (13). To amplify -chain sequences, a first PCR was performed with primers corresponding to sequences 5' of the V10-leader (primer L-Vb10–279) and 3' of the Cb1 gene (primer Cb1-1855). Of 24 tubes that each contained a single sorted V10⁺ pCW3/K^d-specific CD8 T cell, 11 were positive according to the second diagnostic PCR performed with internal V10- and C-specific primers, and sequence analysis confirmed that all of these corresponded to V10DJ1 rearrangements (data not shown). Because only two-thirds of the V10 TCRs in the repertoire of this mouse (M-33) had been found to be rearranged to a J1 segment (13), this represents an estimated efficiency for the amplification of full-length sequences of 69% (11 of 16). In one cell sample, we amplified TCR and TCR-C0 cDNAs with identical V10DJ1.3 rearrangements, corresponding to a TCR previously identified (code V10-1.3-1b) from this mouse (13). A second cloning PCR was performed on this sample for cloning into the pMIG2 vector. As expected, colonies corresponding to either the TCR (LVDJC) or TCR-C0 (LVDJC0C) cDNAs were obtained from a single cloning reaction.

We next attempted to coamplify full-length TCR and TCR sequences from sorted single pCW3/K^d-specific T cells from the same mouse (M-33). For this purpose, the first PCR included a mixture of primers specific for V10, C1, and C2 and for V8 and C. From a series of 24 sorted single cells, we amplified 11 V10-TCR (including eight V10DJ1 and three V10DJ2) and three V8-TCR sequences. From two cell samples, sequences corresponding to TCR, TCR, and TCR-C0 were amplified. These correspond to TCRs expressed by two different clones that we had previously identified (codes V10-1.2-9c/V8P29-20c and V10–1.3b/V8P28–21c) (13). The TCR from the latter was cloned into the pMIY2 vector because it is the clonal partner for the TCR (and TCR-C0) cloned above. To our knowledge, this represents the first successful direct cloning of full-length TCR cDNAs from single cells.

TCR-C0 alternate splice transcripts encode protein

We first transduced 3T3 fibroblasts because they are efficient hosts for retroviral vectors, and we performed intracellular (i.c.) staining to detect TCR expression in these nonlymphoid cells. The TCR-C0 isoform was apparently translated into protein, because 3T3 cells transduced with the TCR-C0 vector (3T3-C0 cells) were positive when stained with the C-specific mAb, H57 (Fig. 1). However, neither of the two different V10^b-specific mAbs that stained the control 3T3-TCR cells recognized the TCR-C0 isoform, indicating that some V10 epitopes may be altered or masked by insertion of the C0 peptide.

View larger version (35K): [in this window] [in a new window]   FIGURE 1. Detection of TCR and TCR-C0 proteins in 3T3 transductants. Because the treatment for i.c. staining results in loss of GFP, its expression (FL1) was assessed on nonpermeabilized cells. 3T3 cells and 3T3 cells transduced with TCR-MIG2 or TCR-C0-MIG2 viral particles were analyzed directly for FL1 (GFP) fluorescence (A) or were stained i.c. with the indicated mAb- conjugates and analyzed for FL3 (PE-Cy5) or FL2 (PE) fluorescence (B). Gray histograms represent controls without mAb. The percentage of positive cells in the region defined by the marker is indicated for each histogram, as is the mean fluorescence intensity of the positive cells.

The TCR-C0 isoform can function at the -selection checkpoint

TCR gene rearrangement requires functional recombinase activating genes (Rag1 and Rag2), and T cell development in RAG-deficient mice is blocked at the DN3 stage due to the absence of a functional pre-TCR (9, 28, 29). We previously showed that retroviral expression of a TCR transcript in OP9-DL1 coculture-derived, RAG-deficient DN3 cells allows their development to the DP stage (14). We now demonstrate that the TCR-C0 isoform can also promote the differentiation of RAG-deficient DN3 cells, albeit somewhat less efficiently than its normal TCR counterpart in terms of the percentage of DP cells and their total numbers in the cultures (Fig. 2). These findings indicate that the TCR-C0 isoform clearly retains potential receptor function for immature T cells.

View larger version (49K): [in this window] [in a new window]   FIGURE 2. The cloned TCR-C0 isoform drives the differentiation of RAG-deficient immature T cells to the DP stage. Day 14 fetal liver hemopoietic progenitor cells from RAG-deficient mice were cocultured 7 days with OP9-DL1 cells, after which time the nonadherent (mostly DN3) cells were infected by overnight coculture on MIG2, TCR, or TCR-C0 producer cell monolayers. Sorted GFP+/CD44–CD25+ cells were cultured on OP9-DL1 monolayers (day 0). At the indicated times, nonadherent cells were recovered and stained with CD45 mAb (to exclude CD45– OP9-DL1-GFP cells) and CD4 and CD8 mAbs for FACS analysis. The CD4/CD8 profiles are displayed, and the numbers in the quadrants represent the percent of gated GFP+/CD45+ cells. In an independent experiment (not shown) analyzed on day 4, we observed 0.4, 54, and 22% DP and 0.3-, 187-, and 5.6-fold cell recovery, for MIG2, TCR, TCR-C0, and groups, respectively.

Functional recognition of pMHC by TCR/TCR-C0 surface receptors

To study the potential of the TCR-C0 isoform in a mature receptor, we coexpressed the TCR cloned from pCW3/K^d-specific T cells with its clonally related TCR or TCR-C0 isoforms in the TCR^–CD8⁺ 58CD8 T hybridoma-derived cell line (12). The 58CD8 cells were first transduced with the TCR-YFP virus and sorted into populations expressing two different levels of YFP (TCR^low and TCR^high), and the sorted TCR⁺ cells were then retransduced with either TCR or TCR-C0. Analysis with various TCR-specific mAbs clearly indicated that the 58CD8-TCR/TCR-C0 transductants, as well as the 58CD8-TCR/TCR controls, expressed cell surface TCRs (Fig. 3 and data not shown). Both were positive when stained with V8-, C-, or CD3-specific mAbs, but only the 58CD8-TCR/TCR cells were positive when stained with anti-V10 mAbs. This corresponds with our finding that V10-specific mAbs fail to detect the TCR-C0 isoform after i.c. staining of 3T3-C0 transductants (Fig. 1). To enrich for surface TCR⁺ cells, the 58CD8-TCR^high/TCR and 58CD8-TCR^high/TCR-C0 groups were FACS-sorted as CD3⁺ cells. The 58CD8-TCR/TCR and 58CD8-TCR/TCR-C0 cells displayed a diagonal pattern after double staining with anti-V8 and anti-C or anti-CD3 mAbs (Figs. 3 and 4). These staining patterns suggest that both 58CD8-TCR/TCR and 58CD8-TCR/TCR-C0 cells express CD3-associated heterodimeric cell surface TCR complexes, but confirmation awaits a detailed biochemical analysis.

View larger version (41K): [in this window] [in a new window]   FIGURE 3. Surface TCR expression of 58CD8 cells doubly transduced with TCR and TCR-C0. Sorted 58CD8-TCRhigh cells that had been retransduced with TCR, TCR-C0, or (empty) MIG2 viral particles were surface stained with mAbs specific for V8 (21.14-PE) and biotinylated mAbs specific for V10 (B21.5), TCR-C (H57), or CD3 (2C11), together with streptavidin-allophycocyanin, and analyzed by flow cytometry. Numbers indicate the percentage of cells in the respective quadrants. Sorted 58CD8-TCRlow cells retransduced with TCR, TCR-C0, or (empty) MIG2 viral particles showed similar patterns when separately stained with these mAbs (data not shown).

View larger version (31K): [in this window] [in a new window]   FIGURE 4. Correlated surface expression of TCR and TCR-C0 on 58CD8 transductants. Eighteen days after being sorted as surface CD3+ cells, the 58CD8-TCRhigh/TCR and 58CD8-TCRhigh/TCR-C0 transductants were double-stained with anti-V8 (B21.14-PE) and biotinylated mAbs specific for either V10 (B21.5), C (H57), or CD3 (2C11), together with streptavidin-allophycocyanin, and analyzed by flow cytometry. Numbers indicate the percentage of cells in the respective quadrants.

View larger version (23K): [in this window] [in a new window]   FIGURE 5. 58CD8-TCR /TCR-C0 double transductants can be specifically stimulated by pMHC ligands. A, Sorted CD3+ 58CD8-TCR/TCR (squares) and 58CD8-TCR/TCR-C0 (circles) transductants, as well as control TCR– 58CD8 cells (triangles) were cultured in the presence of P815 cells and the indicated concentrations of pCW3170–179 (solid lines) or pA24170–179 (dashed lines). Triplicate cultures were prepared at each peptide concentration for each cell type, and one culture each was prepared for controls without peptides. Supernatants were collected after 48 h for measurements of IL-2. Data for titrations are presented as the mean ± SD of the triplicate SNs, with some error bars hidden by the symbols. The differences in IL-2 release from 58CD8-TCR/TCR and 58CD8-TCR/TCR-C0 cells were significant (p 0.001; one-tailed t test for independent samples) at individual peptide concentrations from 10–4 to 10–7 M for pCW3 and 10–4 M to 10–5 M for pA24. B, The IL-2 release values for each pCW3 concentration from 10–4 to 10–7 M were analyzed by linear regression to obtain the displayed best fit line. In a second experiment (not shown) where pCW3 was titrated from 10–5 to 10–8 M, the calculated regression was y = 2.9652x + 17.321; R2 = 0.999.

View larger version (15K): [in this window] [in a new window]   FIGURE 6. Relative levels of surface TCR expression and IL-2 responses upon pMHC or anti-CD3 stimulation for 58CD8-TCR/TCR and 58CD8-TCR/TCR-C0 transductants. A, Sorted CD3+ 58CD8-TCR/TCR and 58CD8-TCR/TCR-C0 transductants (see Fig. 4) were surface stained with mAbs specific for C (H57; n = 4), V8 (CTVA8, n = 4; or B21.14, n = 4), CD3 (2C11, n = 5), or CD8 (n = 1), where n represents the number of experiments. The mean fluorescence intensity (MFI) for live cells gated as FL1+ was determined, and ratios of the net MFI (MFI with mAb – MFI without mAb) for 58CD8-TCR/TCR cells divided by the net MFI for 58CD8-TCR/TCR-C0 cells were calculated. The bars represent the mean ± SD. The MFI ratios for groups with n > 1 were compared by a two-tailed t test for independent samples, and only that of H57 was significantly different from the others (p < 0.0001). B, The same cells as in A were cultured for 48 h with pCW3 (10 µM) and P815 cells or on 2C11-coated (20 µg/ml) wells. The ratios of IL-2 measured in SNs from 58CD8-TCR/TCR cells divided by that from 58CD8-TCR/TCR-C0 cells were calculated for each experiment (n = 5 for pCW3; n = 3 for 2C11) and are represented as the mean ± SD, where n represents the number of experiments.

View larger version (17K): [in this window] [in a new window]   FIGURE 7. IL-2 responses of 58CD8-TCR/TCR and 58CD8-TCR/TCR-C0 transductants after stimulation with titrated 2C11 mAb. Sorted CD3+ 58CD8-TCR/TCR (squares) and 58CD8-TCR/TCR-C0 (circles) transductants (see Fig. 4), as well as control TCR– 58CD8 cells (triangles), were cultured in wells preincubated with the indicated concentrations of anti-CD3 mAb (2C11) for 48 h before collecting SNs (one for each data point) for the measurement of IL-2 release.

View larger version (20K): [in this window] [in a new window]   FIGURE 8. IL-2 responses of 58CD8-TCR transductants vary with relative levels of surface TCR expression. The sorted CD3+ 58CD8-TCRhigh/TCR and 58CD8-TCRhigh/TCR-C0 transductants shown in Fig. 4 were again stained with anti-CD3 (2C11) mAb, and each was sorted into two populations displaying different levels of surface CD3 (R1 and R2 define regions of lower and higher mean fluorescence intensity (MFI), respectively). A, Nine days later, the sorted cells were stained with anti-CD3 (2C11) and analyzed by flow cytometry. Background MFI (without mAb) ranged from 3.99 to 4.11. Relative MFI levels after staining the cells with anti-V8 (B21.14) were similar to those shown for anti-CD3 (data not shown). B, Eleven days after sorting, the cells were stimulated with the indicated concentrations of pCW3 in the presence of P815 cells. Two cultures were prepared at each concentration for each cell type. The SNs were collected after 48 h to measure IL-2 release. IL-2 was undetectable (<5pg/ml) in SNs from control cultures prepared without pCW3. Data are presented as the mean ± SD (two SNs tested at each point from the duplicate cultures) with some error bars hidden by the symbols.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

Differential recognition of the TCR-C0 isoform by Abs specific for the normal TCR -chain may provide useful clues about its structure. The TCR-C0 isoform was clearly recognized by the C-specific mAb H57 but not by V10-specific mAbs. FACS analysis indicated that H57 recognizes the TCR-C0 protein not only on 58CD8 cells, apparently as part of a TCR/CD3 complex, but also in fibroblasts as an i.c. protein not associated with other TCR or CD3 proteins. The H57 mAb apparently binds to the C domain FG loop on normal TCR -chains (34). Our finding that the relative level of H57 staining was consistently lower for cells expressing the TCR-C0 isoform as compared with those with a normal TCR (Fig. 6A) may result from an alteration or partial masking of the H57 epitope by the C0 peptide cassette. TCR CDR3-loops can apparently adapt multiple conformations (35, 36, 37, 38, 39, 40). The much longer C0 peptide may represent an intrinsically disordered loop commonly found inserted in eukaryotic proteins (41). With this in mind, we performed molecular modeling and dynamic simulations and were able to define a large number of potential C0 loop conformations in the context of an otherwise normal TCR structure (Fig. 9). Consistent with our functional studies showing cognate pMHC-induced IL-2 release by 58CD8-TCR/TCR-C0 cells, the overall space defined by the derived C0 loop conformations is clearly compatible with TCR/TCR-C0 pairing, and none of the loops reaches the CDR-defined interface for pMHC ligand binding.

View larger version (68K): [in this window] [in a new window]   FIGURE 9. Conformational space accessible to C0 loops within the context of an TCR. A–C, Three different views of the TCR models are represented, with the - and -chains depicted as gray and blue ribbons, respectively, and with the V domains at the top. A random selection of 50 C0 loop conformers resulting from the simulated annealing runs is shown in green. The C-FG loop is highlighted in red for reference. D–F, For clarity, only four C0 conformations are shown. These four loops represent the conformers for which the distance between a residue of the loop and the loop’s anchor points is the greatest. As such, they define the outer limits of the accessible conformational space of C0.

Our present findings documenting the intrinsic receptor function and specificity of the TCR-C0 isoform reveal an intriguing paradox concerning TCRs whose function depends critically on structure, not only for specific pMHC recognition but also for proper association with CD3 signaling dimers (3, 4, 6, 46). TCR genes appear to have evolved in parallel with MHC genes encoding the peptide-presenting ligands (47). It thus seems remarkable that these highly conserved receptors can accommodate the insertion of the 24-aa-long C0 cassette without loss of function. The challenge now will be to determine whether a new TCR function has evolved together with this natural structural variant of the mouse TCR -chain.

	Acknowledgments

 
We thank K. Vignali and A. Burton for construction of the pMIG2 and pMIY2 cloning vectors, C. Bella for cell sorting, and A. Cottalorda for help with IL-2 assays. We are grateful to our colleagues for gifts of cell lines, to A. Wilson and N. Bonnefoy-Bérard for discussions, and to R. Lowry for the VassarStats website (http://faculty.vassar.edu/lowry/VassarStats.html).

	Disclosures

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The authors have no financial conflict of interest.

	Footnotes

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ M.C. is supported by a Canadian Institutes of Health Research Doctoral Research Award. D.A.A.V. and A.L.S.-W. are supported by the National Institutes of Health and the American Lebanese Syrian Associated Charities, J.C.Z.-P. is supported by a Canada Research Chair in Developmental Immunology, and the J.L.M. laboratory is supported by Institut National de la Santé et de la Recherche Médicale and La Ligue Contre le Cancer (Rhône Département, France).

² Current address: Institut National de la Santé et de la Recherche Médicale Unité 817, Institut de Recherche sur le Cancer de Lille, Lille, France.

³ Address correspondence and reprint requests to Dr. Janet L. Maryanski at the current address: Institut National de la Santé et de la Recherche Médicale Unité 576, Hopital de l’Archet, 151 Route de Saint-Antoine de Ginestière, Boîte Postale 3079, 06202 Nice Cedex 3, France. E-mail address: maryanski{at}cervi-lyon.inserm.fr or maryanski{at}unice.fr

⁴ Abbreviations used in this paper: pMHC, peptides presented by MHC molecules; CSC, chondroitin sulfate c; DN, double negative; DP, double positive; i.c., intracellular; SN, supernatant; Pb, Polybrene; SP, single positive; YFP, yellow fluorescent protein.

Received for publication June 14, 2006. Accepted for publication September 29, 2006.

	References

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 

1. Lynch, K. W.. 2004. Consequences of regulated pre-mRNA splicing in the immune system. Nat. Rev. Immunol. 4: 931-940. [Medline]
2. Davis, M. M., P. J. Bjorkman. 1988. T-cell antigen receptor genes and T-cell recognition. Nature 334: 395-402. [Medline]
3. Rudolph, M. G., R. L. Stanfield, I. A. Wilson. 2006. How TCRs bind MHCs, peptides, and coreceptors. Annu. Rev. Immunol. 24: 419-466. [Medline]
4. Kuhns, M. S., M. M. Davis, K. C. Garcia. 2006. Deconstructing the form and function of the TCR/CD3 complex. Immunity 24: 133-139. [Medline]
5. Malissen, B., M. Malissen. 1996. Functions of TCR and pre-TCR subunits: lessons from gene ablation. Curr. Opin. Immunol. 8: 383-393. [Medline]
6. Call, M. E., K. W. Wucherpfennig. 2005. The T cell receptor: critical role of the membrane environment in receptor assembly and function. Annu. Rev. Immunol. 23: 101-125. [Medline]
7. Behlke, M. A., D. Y. Loh. 1986. Alternative splicing of murine T-cell receptor -chain transcripts. Nature 322: 379-382. [Medline]
8. Dent, A. L., P. J. Fink, S. M. Hedrick. 1989. Characterization of an alternative exon of the murine T cell receptor -chain. Pattern of expression and evolutionary conservation. J. Immunol. 143: 322-328. [Abstract]
9. Shinkai, Y., G. Rathbun, K. P. Lam, E. M. Oltz, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A. M. Stall, et al 1992. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68: 855-867. [Medline]
10. Schmitt, T. M., J. C. Zuniga-Pflucker. 2002. Induction of T cell development from hematopoietic progenitor cells by -like-1 in vitro. Immunity 17: 749-756. [Medline]
11. Uyttenhove, C., J. Van Snick, T. Boon. 1980. Immunogenic variants obtained by mutagenesis of mouse mastocytoma P815. I. Rejection by syngeneic mice. J. Exp. Med. 152: 1175-1183. [Abstract/Free Full Text]
12. Stotz, S. H., L. Bolliger, F. R. Carbone, E. Palmer. 1999. T cell receptor (TCR) antagonism without a negative signal: evidence from T cell hybridomas expressing two independent TCRs. J. Exp. Med. 189: 253-264. [Abstract/Free Full Text]
13. Hamrouni, A., A. Aublin, P. Guillaume, J. L. Maryanski. 2003. T cell receptor gene rearrangement lineage analysis reveals clues for the origin of highly restricted antigen-specific repertoires. J. Exp. Med. 197: 601-614. [Abstract/Free Full Text]
14. Ciofani, M., T. M. Schmitt, A. Ciofani, A. M. Michie, N. Çuburu, A. Aublin, J. L. Maryanski, J. C. Zúñiga-Pflücker. 2004. Obligatory role for cooperative signaling by pre-TCR and Notch during thymocyte differentiation. J. Immunol. 172: 5230-5239. [Abstract/Free Full Text]
15. Wilson, A., C. Marechal, H. R. MacDonald. 2001. Biased V usage in immature thymocytes is independent of DJ proximity and pT pairing. J. Immunol. 166: 51-57. [Abstract/Free Full Text]
16. Szymczak, A. L., C. J. Workman, Y. Wang, K. M. Vignali, S. Dilioglou, E. F. Vanin, D. A. Vignali. 2004. Correction of multi-gene deficiency in vivo using a single ‘self-cleaving’ 2A peptide-based retroviral vector. Nat. Biotechnol. 22: 589-594. [Medline]
17. Trop, S., M. Rhodes, D. L. Wiest, P. Hugo, J. C. Zuniga-Pflucker. 2000. Competitive displacement of pT by TCR- during TCR assembly prevents surface coexpression of pre-TCR and TCR. J. Immunol. 165: 5566-5572. [Abstract/Free Full Text]
18. Le Doux, J. M., N. Landazuri, M. L. Yarmush, J. R. Morgan. 2001. Complexation of retrovirus with cationic and anionic polymers increases the efficiency of gene transfer. Hum. Gene Ther. 12: 1611-1621. [Medline]
19. Casanova, J. L., F. Martinon, H. Gournier, C. Barra, C. Pannetier, A. Regnault, P. Kourilsky, J. C. Cerottini, J. L. Maryanski. 1993. T cell receptor selection by and recognition of two class I major histocompatibility complex-restricted antigenic peptides that differ at a single position. J. Exp. Med. 177: 811-820. [Abstract/Free Full Text]
20. Sali, A., T. L. Blundell. 1993. Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234: 779-815. [Medline]
21. Lefranc, M. P., V. Giudicelli, C. Ginestoux, J. Bodmer, W. Muller, R. Bontrop, M. Lemaitre, A. Malik, V. Barbie, D. Chaume. 1999. IMGT, the international ImMunoGeneTics database. Nucleic Acids Res. 27: 209-212. [Abstract/Free Full Text]
22. Saint-Ruf, C., K. Ungewiss, M. Groettrup, L. Bruno, H. J. Fehling, H. von Boehmer. 1994. Analysis and expression of a cloned pre-T cell receptor gene. Science 266: 1208-1212. [Abstract/Free Full Text]
23. von Boehmer, H., I. Aifantis, J. Feinberg, O. Lechner, C. Saint-Ruf, U. Walter, J. Buer, O. Azogui. 1999. Pleiotropic changes controlled by the pre-T-cell receptor. Curr. Opin. Immunol. 11: 135-142. [Medline]
24. Maryanski, J. L., R. S. Accolla, B. Jordan. 1986. H2-restricted recognition of cloned HLA class I gene products expressed in mouse cells. J. Immunol. 136: 4340-4347. [Abstract]
25. Maryanski, J. L., P. Pala, G. Corradin, B. R. Jordan, J. C. Cerottini. 1986. H-2-restricted cytolytic T cells specific for HLA can recognize a synthetic HLA peptide. Nature 324: 578-579. [Medline]
26. MacDonald, H. R., J. L. Casanova, J. L. Maryanski, J. C. Cerottini. 1993. Oligoclonal expansion of major histocompatibility complex class I-restricted cytolytic T lymphocytes during a primary immune response in vivo: direct monitoring by flow cytometry and polymerase chain reaction. J. Exp. Med. 177: 1487-1492. [Abstract/Free Full Text]
27. Casanova, J. L., J. C. Cerottini, M. Matthes, A. Necker, H. Gournier, C. Barra, C. Widmann, H. R. MacDonald, F. Lemonnier, B. Malissen, J. L. Maryanski. 1992. H-2-restricted cytolytic T lymphocytes specific for HLA display T cell receptors of limited diversity. J. Exp. Med. 176: 439-447. [Abstract/Free Full Text]
28. Mombaerts, P., J. Iacomini, R. S. Johnson, K. Herrup, S. Tonegawa, V. E. Papaioannou. 1992. RAG-1-deficient mice have no mature B and T lymphocytes. Cell 68: 869-877. [Medline]
29. Shinkai, Y., S. Koyasu, K. Nakayama, K. M. Murphy, D. Y. Loh, E. L. Reinherz, F. W. Alt. 1993. Restoration of T cell development in RAG-2-deficient mice by functional TCR transgenes. Science 259: 822-825. [Abstract/Free Full Text]
30. Mestas, J., C. C. Hughes. 2004. Of mice and not men: differences between mouse and human immunology. J. Immunol. 172: 2731-2738. [Abstract/Free Full Text]
31. Modrek, B., C. J. Lee. 2003. Alternative splicing in the human, mouse and rat genomes is associated with an increased frequency of exon creation and/or loss. Nat. Genet. 34: 177-180. [Medline]
32. Heyd, F., G. ten Dam, T. Moroy. 2006. Auxiliary splice factor U2AF26 and transcription factor Gfi1 cooperate directly in regulating CD45 alternative splicing. Nat. Immunol. 7: 859-867. [Medline]
33. Lantz, O., A. Bendelac. 1994. An invariant T cell receptor chain is used by a unique subset of major histocompatibility complex class I-specific CD4⁺ and CD4^–