The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bochtler, P.
Right arrow Articles by Reimann, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bochtler, P.
Right arrow Articles by Reimann, J.
The Journal of Immunology, 2006, 177: 8307-8314.
Copyright © 2006 by The American Association of Immunologists, Inc.

Functional Adaptive CD4 Foxp3 T Cells Develop in MHC Class II-Deficient Mice1

Petra Bochtler, Christian Wahl, Reinhold Schirmbeck and Jörg Reimann2

Department of Internal Medicine I, University of Ulm, Ulm, Germany


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
CD4 Foxp3 regulatory T (TR) cells are well-defined regulator T cells known to develop in the thymus through positive selection by medium-to-high affinity TCR-MHC interactions. We asked whether Foxp3 TR cells can be generated in the complete absence of MHC class II molecules. CD4 Foxp3 TR cells are found in secondary lymphoid tissues (spleen and lymph nodes) and peripheral tissues (liver) but not the thymus of severely MHC class II-deficient (A{alpha}–/– B6) mice. These TR cells preferentially express CD103 (but not CD25) but up-regulate CD25 surface expression to high levels in response to TCR-mediated activation. MHC class II-independent Foxp3 TR cells down modulate vaccine-induced, specific antiviral CD8 T cell responses of A{alpha}–/– B6 mice in vivo. Furthermore, these TR cells suppress IL-2 release and proliferative responses in vitro of naive CD25– (CD4 or CD8) T cells from normal B6 mice primed by bead-coupled anti-CD3/anti-CD28 Ab as efficiently as CD4CD25high TR cells from congenic, normal B6 mice. MHC class II-independent CD4 Foxp3+ TR cells thus preferentially express the (TGF-beta-induced) integrin molecule {alpha}E (CD103), are generated mainly in the periphery and efficiently mediate immunosuppressive effects.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Increasing interest is focused at the basic, translational, and clinical level of research on the biology of regulatory T (TR)3 cells and their potential for the treatment of immunopathology (1, 2, 3). The forkhead family transcription factor Foxp3 has emerged as the master regulatory factor in the development and function of TR cells (4, 5, 6). CD4 Foxp3+ TR cells are the best characterized TR cell population in the large and heterogeneous group of CD4 or CD8 T cells with suppressive functions. The evidence for Foxp3 as a necessary and sufficient factor for TR cell generation and function comes from different sources. Spontaneous Foxp3 mutations in mice (scurfy) and humans (immune dysfunction, polyendocrinopathy, enteropathy, X-linked; IPEX), or the knockout of Foxp3 in mice show that the deficiency of this transcription factor leads to T cell hyperreactivity resulting in autoimmune disease. In contrast, transgene-driven overexpression of Foxp3 rescues mice from scurfy disease but strikingly impairs the establishment of T cell immunity. T cells expressing a transduced gene encoding Foxp3 develop a TR phenotype (7, 8). The knockin of a reporter into the Foxp3-encoding locus shows that expression of this gene coincides with expression of the TR phenotype (9). There is thus convincing evidence that Foxp3+ T cells are a major TR cell population, although the heterogeneity in development, phenotype, and suppressive effects of Foxp3+ TR cell populations is an unresolved issue.

TR cells are categorized as natural or adaptive (3, 10). The relative contribution of natural (thymus-derived) and adaptive (peripherally generated) TR cells to the pool of peripheral Foxp3 TR cells is uncertain. Natural CD4 CD25high TR cells express Foxp3 and are generated in the thymus independent of IL-2/CD25 or TGF-beta. Their intrathymic development is independent of commitment to either the CD4 or CD8 lineage but depends on positive selection by medium-to-high affinity TCR-MHC interactions that generates a repertoire skewed toward recognition of self-Ags (11). Positive selection of CD4 Foxp3 TR cells in the thymus may dependent on MHC class II expression by cortical epithelium (12) and/or thymic stromal lymphopoietin-conditioned plasmacytoid dendritic cells (DC) in the medulla of the thymus (13). Natural TR cells preferentially home to T cell zones of secondary lymphoid tissues where they control effector T cell development from naive precursors. Studies in conditional MHC-II-deficient mice indicate that peripheral homeostasis of natural Foxp3 TR cells depends at least partially on MHC-II-dependent TCR stimulation and IL-2 availability (14).

Adaptive TR cells may or may not express Foxp3. Recent data demonstrated the conversion of peripheral, naive CD4 CD25–Foxp3– T cells into adaptive, regulatory CD4 CD25+Foxp3+ TR cells through TGF-beta-mediated induction of Foxp3 expression in the absence of IL-6 (9, 15, 16, 17, 18, 19, 20, 21). Different DC populations seem to generate and/or regulate TR cell homeostasis in the periphery. Peripheral immature or mature myeloid DC that constitutively engulf and process self Ags under steady state conditions may maintain the natural TR cell pool (22). In allotolerance, an exclusive interaction of Foxp3 TR cells with plasmacytoid DC has been demonstrated (10, 23). Most natural CD4 Foxp3 TR cells are constitutively CD25high, but some CD4 (CD25+ or CD25–) Foxp3 TR cells express CD103 (the {alpha}E chain in the cadherin-binding integrin {alpha}Ebeta7) and are a potent, possibly adaptive TR cell subpopulation, particularly in epithelial environments (24, 25). These TR cells are found in mucosal tissues (26) and efficiently migrate to inflamed sites (27). CD103 seems to mediate the homing of TR cells and their subsequent retention in the dermis in Leishmania infection (25, 28).

We have reported the generation of effector function and regulatory activity in the MHC class II-independent CD4 {alpha}beta T cell population of completely MHC class II-deficient mice (29, 30). Adoptive transfer of CD4 {alpha}beta T cells from wild-type (wt) or MHC class II-deficient (A{alpha}–/– or Abeta–/–) C57BL/6J (B6) donor mice into congenic, immunodeficient RAG–/– hosts induced an aggressive transfer colitis (29). CD4 T cells developing in mice deficient in MHC class II comprised a major (80%) single-positive (SP) CD4+ CD8– subset and a minor (20%) double-positive (DP) CD4+ CD8+ subset. Although a single-cell assay for Foxp3 was not available at the time, PCR data suggested that TR cells were present mainly in the DP T cell population from spleen, mesenteric lymph nodes, and colonic lamina propria of MHC class II-deficient mice. These TR cells could partially control the proinflammatory potential of SP CD4 T cells in the transfer colitis model (30). Here, we test whether Foxp3+ TR cells develop in the thymus or in the periphery of MHC class II-deficient mice, whether class II-independent Foxp3+ TR cells express CD4 or CD8, or CD103 and/or CD25, and whether they are functional in vitro and in vivo.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Mice

Wild-type C57BL/6J mice (H-2b) (B6) mice and H-2 class II-deficient (A{alpha}–/–) B6 mice (31) were bred and kept under standard pathogen-free conditions in the animal colony of Ulm University (Ulm, Germany). Female and male mice were used at 8–12 wk of age. All animal experiments were performed according to the guidelines of the local Animal Use and Care Committee and the Provincial Animal Welfare Law.

Isolation of cells

Single cell suspensions were aseptically prepared from spleen, inguinal, and mesenteric lymph nodes or liver as described (32). T cells were purified using the CD8 T cell (Miltenyi Biotec) or CD4 T cell MACS isolation kit (Miltenyi Biotec). The purity of the isolated CD8+ or CD4+ T cells was >98% as verified by flow cytometry (FCM).

FCM analysis

Cells washed twice (in PBS, 0.3% w/v BSA supplemented with 0.1% w/v sodium azide) were preincubated with mAb 2.4G2 (BD Biosciences) to block nonspecific binding of Abs to FcR. Cells were washed, incubated for 30 min at 4°C with 0.5 µg/106 cells of the relevant mAb, and washed. In most experiments, cells were subsequently incubated for 20 min at 4°C with a second-step reagent. Four-color FCM analyses were performed by FACSCalibur (BD Biosciences). The forward narrow angle light scatter was used as an additional parameter to facilitate exclusion of dead cells and aggregated cell clumps. Data were analyzed using the FCS Express (DeNovo) software. The following reagents from BD Biosciences or eBioscience were used: allophycocyanin-conjugated anti-CD8 mAb 53-6.7 and anti-CD4; biotinylated anti-CD8, anti-CD25, anti-CD44, anti-CD28, anti-CD80, anti-CD86, anti-ICOSL, anti-CD94, anti-B7-H3, and anti-B7-H4; PE-conjugated anti-CD25 mAb PC61, anti-CD103, anti-CD69, anti-PD-1, anti-CTLA-4, anti-BTLA, anti-CD3, anti-PD-L2, anti-PD-L1, anti-ICOS, anti-NK1.1 and anti-CD54; CD1d-IgG1 fusion protein DimerX; and FITC-conjugated anti-Foxp3.

For intracellular staining of BTLA, CTLA, and PD-1, cells were surface stained with allophycocyanin-conjugated anti-CD4 mAb followed by fixation with 2% paraformaldehyde, resuspension in permeabilization buffer (HBSS, 0.5% BSA, 0.5% saponin, and 0.05% sodium azide), incubation with Ab for 30 min at room temperature and two washes in permeabilization buffer. Stained cells were resuspended in PBS, 0.3% w/v BSA supplemented with 0.1% w/v sodium azide. Foxp3 staining was performed using a kit (eBioscience) following the manufacturer’s instruction.

To perform the CD1d-Dimer Assay, we incubated 4 µg of the soluble, divalent mouse CD1d-IgG1 fusion protein DimerX overnight with 100 ng of {alpha}-galactosylceramide ({alpha}GalCer) at 37°C and neutral pH. {alpha}GalCer was a gift from Dr. Yasuhiko Koezuka (Pharmaceutical Research Laboratory, Kirin Brewery, Gunma, Japan). The {alpha}GalCer-loaded CD1d-IgG1 dimers were incubated with PE-coupled anti-IgG1 (BD Biosciences) for 60 min at 4°C. Mouse NKT cells were labeled with {alpha}GalCer-loaded CD1d-IgG1 dimers at 4°C for 60 min.

In vivo suppression of CD4 T cells in mice

CD4 T cells were suppressed in mice by i.p. injections of the anti-CD4 mAb YTS 191.1 (days 4 and 1 prevaccination, at the time of vaccination, and days 4 and 9 postvaccination) of 200 µl of PBS containing 100 µg Ab. FCM analyses of PBMC populations demonstrated that >98% of the CD4 T cells were deleted at the time of vaccination.

Vaccination of mice

We used the hepatitis B surface Ag (HBsAg) to assay the effect of Foxp3 TR cells on specific CD8 T cell responses because we previously demonstrated that different vaccination strategies efficiently elicit Kb-restricted, spleen (S190–197) VWLSVIWM peptide (S2)-specific CD8 T cell responses to this Ag (33, 34). HBsAg particles produced in Hansenula polymorpha (strain RB10) were purified from crude yeast extracts by adsorption to silica gel, column chromatography, and isopycnic ultracentrifugation (35). These particles were kindly provided by Dr. K. Melber (Rhein Biotech, Düsseldorf, Germany). The indicated dose of HBsAg particles was mixed in 50 µl of PBS with 20 µg of the oligonucleotide (ODN) TCATTGGAAAACGTTCTTCGGGGCG (MWG-Biotech) and injected i.m.

Specific CD8 T cell frequencies

Spleen cells (1 x 107/ml) from immunized mice were incubated for 4 h in RPMI 1640 with 2.5 µg/ml synthetic Kb-binding S190–197 VWLSVIWM peptide (S2) of HBsAg (obtained from Jerini BioTools) in the presence of 5 µg/ml brefeldin A (Sigma-Aldrich). Harvested cells were surface stained with allophycocyanin-conjugated anti-CD8 mAb fixed with 2% paraformaldehyde and stained with FITC-conjugated anti-IFN-{gamma} mAb. Alternatively, cells were washed twice in FACS buffer (PBS, 0.3% w/v BSA supplemented with 0.1% w/v sodium azide) and incubated for 30 min at 4°C with allophycocyanin-conjugated anti-CD8 mAb and the PE-conjugated tetramer Kb/S2 (Kb with bound VWLSVIWM) provided by the National Institute of Allergy and Infectious Diseases Tetramer Facility. Cells were washed twice in FACS buffer. Frequencies of IFN-{gamma}+ CD8+ or tetramer+ CD8+ T cells/105 CD8 T cells were determined by FCM. Mean numbers of CD8+ IFN-{gamma}+ or tetramer+ CD8+ T cells/105 CD8 T cells of five individual mice are shown.

CFSE labeling

CD4 or CD8 T cells were washed twice with PBS and incubated with 5 µM CFSE (Invitrogen Life Technologies) for 15 min at 37°C. CFSE labeling was stopped with cold FCS, and the cells were washed twice with medium.

In vitro activation

We used CD4+ CD25high T cells electronically sorted from the spleen of normal or A{alpha}–/– B6 mice injected 18 h previously with 50 µg of anti-CD3 mAb 145-2C11 as in vivo preactivated TR cells. These TR cells were cocultured at a 1:1 ratio for 2–4 days with MACS-isolated, CFSE-labeled splenic CD25–CD4 or CD8 T cells from naive B6 mice in the presence of anti-CD3/CD28 dynabeads (DYNAL) at a bead-to-T cell ratio of 1:2.

Cytokine determination by ELISA

IL-2 in supernatants was detected by conventional double-sandwich ELISA using mAb JES6-1A12 and biotinylated mAb JES6-5H4. Extinction was analyzed at 405/490 nm on a Tecan microplate ELISA reader (Tecan) using EasyWin software (Tecan). For detection of IL-10, we used the OptEIA kit from BD Biosciences.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Foxp3+ TR cells in wt B6 mice

Foxp3 expression was analyzed at the single-cell level in nonstimulated, splenic CD4 or CD8 T cells from wt B6 mice (Fig. 1A). Foxp3+ cells were found almost exclusively in CD4 (but not CD8) CD3 T cell populations, with 8–14% of all CD4 T cells being Foxp3+ (Fig. 1, B and C). Of the gated CD4 Foxp3+ TR cells, 50–60% were CD25high, 15–20% were CD103+ and about one-third was CD25–CD103– (Fig. 1D). The analysis of the marker profile of Foxp3+ vs Foxp3– CD4 T cells revealed similar expression levels of (intracellular and surface) PD-1 and BTLA and of (surface) CD28, CD54, CD94, and PD-L1 in both CD4 T cell subsets. No (or very low) surface expression of CTLA-4, ICOS, CD80, CD86, ICOSL, PD-L2, B7-H3, B7-H4, or NK1.1 was detectable in both CD4 T cell subsets (Fig. 1E). Some Foxp3+ CD4 TR cells expressed enhanced levels of CD69 and CD44 on the surface and CTLA-4 within the cell when compared with the corresponding Foxp3– CD4 T cells (Fig. 1E). Foxp3+ CD4 TR cells did not express the ({alpha}GalCer-loaded) CD1d dimer-binding TCR, indicating that Foxp3 is not expressed by NKT cells with an invariant TCR. We did not detect differences in the marker profiles of CD25+ vs CD103+ Foxp3+ CD4 TR cells (data not shown). Similar to the spleen, mesenteric and inguinal lymph node CD4 T cell populations contained a fraction of 8–14% Foxp3+ cells (data not shown). Hence, Foxp3 TR cells represent a fairly constant fraction of 10–15% of the CD4 T cells in secondary lymphoid tissues.


Figure 1
View larger version (38K):
[in this window]
[in a new window]

  		FIGURE 1. Splenic Foxp3+ TR cells in wt B6 mice. A, Gating of CD4+ and CD8+CD3+ T cells; Foxp3+ CD8 T cell subset (B); Foxp3+ CD4 T cell subset (C); CD25 and CD103 surface expression by splenic CD4 Foxp3+ T cells (D); Marker profile of splenic Foxp3– vs Foxp3+ CD4 T cells (E). Intracellular CTLA-4, BTLA, and PD-1 was measured by cytoplasmic staining (the histogram comprises cells that express the respective marker on the surface and within the cell). Representative data from three pooled wt B6 mice are shown (of five independent experiments performed).

 
Foxp3+ TR cells in MHC class II-deficient (A{alpha}–/–) B6 mice

Only low numbers of CD4 {alpha}beta T cells are found in B6 mice completely deficient in MHC class II molecules (31, 36, 37). The origin and function of these MHC class II-independent CD4 T cells are unknown, but some of these T cells are CD1d-restricted NKT cells (38). We asked whether Foxp3-expressing cells can be found in the small CD4 T cell population or the major CD8 T cell population of MHC class II-deficient A{alpha}–/– B6 mice. The small CD4 T cell population in A{alpha}–/– B6 mice (5 x 105 cells/spleen in A{alpha}–/– B6 mice vs 107 cells/spleen in wt B6 mice) represented only 6% of the total splenic T cell population, i.e., was 20 times smaller than the CD8 T cell population. CD8 T cells represented >90% of the total splenic T cell population of A{alpha}–/– mice (6 x 106 cells/spleen in A{alpha}–/– B6 mice and 5 x 106 cells/spleen in wt B6 mice). Foxp3+ was expressed by 20% of the cells in the CD4 T cell population (105 cells/spleen in A{alpha}–/– B6 mice vs 106 cells/spleen in wt B6 mice) and 1% of all the cells in the CD8 T cell population (105 cells/spleen in A{alpha}–/– B6 mice and 104 cells/spleen in wt B6 mice) (Fig. 2). Therefore, almost equal numbers of Foxp3+ T cells (105/spleen) were found in the splenic CD4 and CD8 T cell populations of A{alpha}–/– mice. Foxp3+ TR cells can hence develop in the absence of MHC class II molecules and are present in CD4+ as well as CD8+ T cell populations in MHC class II-deficient mice.


Figure 2
View larger version (23K):
[in this window]
[in a new window]

  		FIGURE 2. Splenic Foxp3+ TR cells in MHC class II-deficient (A{alpha}–/–) B6 mice. Foxp3 expression by freshly isolated, splenic CD4 and CD8 T cell subsets from A{alpha}–/– B6 mice. Surface expression of CD25 and CD103 by gated FoxP3+ CD4 or CD8 T cells is shown. Representative data from pooled spleen cells of three A{alpha}–/– B6 mice are shown (of five independent experiments performed). Boxed areas represent the gates set for cells analyzed in the dot blots to which the arrows point. In the histograms, white curves represent staining with isotype control Ab; gray filled curves represent staining with conjugated Ab of the indicated specificity.

 
The surface expression profile of CD4/CD8 coreceptors of splenic or lymph node CD4 T cell populations from A{alpha}–/– B6 mice was unusual. Whereas 80% of the CD4 T cells displayed a SP (CD4+CD8–) surface phenotype, 20% of the CD4 T cells were DP (CD4+CD8+; Fig. 2). Within the SP T cell population, 12–15% of the cells were Foxp3+ (similar to the frequency of Foxp3+ TR cells in splenic CD4 T cell populations from wt mice). In contrast, 40% of the DP T cells were Foxp3+ TR cells (data not shown). Foxp3+ TR cells were hence 3-fold enriched in the splenic DP T cell population from A{alpha}–/– B6 mice, confirming our previous report (30).

The surface phenotype of CD4 Foxp3+ TR cells from A{alpha}–/– and wt B6 mice differed. Most (80–90%) Foxp3+ cells from A{alpha}–/– B6 mice were CD103+, whereas only a minor fraction (20%) was CD25+ (Fig. 2). A similar prevalence of CD103 surface expression was found in the CD8 Foxp3+ T cell population. Hence, Foxp3+ T cells generated under MHC class II-deficient conditions show a different distribution in the CD4 and CD8 T cell subset and a different surface phenotype compared with those found in wt congenic controls. Further surface profiling of CD25+ vs CD103+ CD4 (Foxp3+ vs Foxp3–) T cells from wt vs A{alpha}–/– mice (using the marker panel described in Fig. 1E) revealed no major differences between these subsets. As in wt B6 mice, a fraction of the CD4 Foxp3+ T cells from A{alpha}–/– mice was activated (CD69+) and expressed surface PD-L1 but not (or only low levels of) PD-1, BTLA, or CTLA-4 (data not shown). The main difference between CD4 Foxp3+ T cells from wt vs A{alpha}–/– mice was thus the surface expression of CD25 vs CD103.

Foxp3+ TR cells are not found in the thymus of MHC class II-deficient mice

We searched for Foxp3+ T cells in the thymus of young (5-wk-old) or adult (15-wk-old) A{alpha}–/– or wt B6 mice. A subset of 10–15% Foxp3+ cells was readily detectable in the single-positive CD4+ CD8– but not CD4– CD8+ thymocyte population of wt B6 mice (Fig. 3A). Most of these CD4 TR cells were CD25high but CD103low (Fig. 3B). This CD4 Foxp3 TR cell population was similar in young and adult wt mice (Fig. 3A). In contrast, no CD4 Foxp3+ cells were detected in thymocyte populations of young A{alpha}–/– B6 mice and only variable but low numbers (<0.5%) were found in thymocyte populations from adult A{alpha}–/– B6 mice (Fig. 3A). The numbers of Foxp3+ CD4 or CD8 T cells increased in the spleen of A{alpha}–/– but not wt B6 mice with age (Fig. 3A). Peripheral Foxp3+ TR cells in A{alpha}–/– B6 mice are hence unlikely to be thymus derived and expand in the periphery with age.


Figure 3
View larger version (22K):
[in this window]
[in a new window]

  		FIGURE 3. Thymic Foxp3+ T cells in wt and MHC class II-deficient (A{alpha}–/–) B6 mice. Thymocytes and spleen cells were obtained from either 5- or 15-wk-old wt B6 mice or (age- and sex-matched) MHC class II-deficient (A{alpha}–/–) B6 mice. A, Foxp3+ cells in the SP (CD4+ CD8– or CD4– CD8+) T cell populations; B, surface expression of CD25 and CD103 by cells in the gated Foxp3+ vs Foxp3–CD4+CD8– thymocyte population from 5-wk-old wt B6 mice. The very low number of Foxp3+ CD4+ CD8– thymocytes from MHC class II-deficient (A{alpha}–/–) B6 mice did not allow us to perform a similar analysis in these mice. Representative data from pooled spleen cells of three wt and three A{alpha}–/– B6 mice per group are shown (of three independent experiments performed). White curves represent staining with isotype control Ab; gray filled curves represent staining with conjugated Ab of the indicated specificity.

 
CD4 Foxp3+ T cells from A{alpha}–/– B6 mice respond to polyclonal in vivo activation

We tested if CD4 Foxp3+ T cells from A{alpha}–/– B6 mice can be activated in vivo. Fifty micrograms of anti-CD3 Ab were injected i.p. into wt or A{alpha}–/– B6 mice and the activation of T cells was analyzed 18 h postinjection. The % Foxp3+ T cells in the splenic CD4 T cell population increased in response to polyclonal activation but the absolute numbers of Foxp3+ CD4 T cells per spleen remained similar (due to a decline in Foxp3– CD4 T cells after polyclonal stimulation). Foxp3+ CD4 T cells up-regulated surface expression of CD69, CD44, and CD25 but not CD103 and down-regulated surface expression of BTLA after polyclonal stimulation (Fig. 4A, data not shown). Enhanced CD25 surface expression by CD4 Foxp3+ T cells from wt and A{alpha}–/– B6 mice in response to polyclonal in vivo activation indicates that these TR cells are functional.


Figure 4
View larger version (22K):
[in this window]
[in a new window]

  		FIGURE 4. Activated Foxp3+ CD4 T cells in wt and MHC class II-deficient (A{alpha}–/–) B6 mice. Mice were injected i.p. with 50 µg of either the anti-CD3{epsilon} mAb 145-2C11 or the isotype control (hamster IgG1) Ab. Spleen cells were obtained from animals 18 h postinjection. A, Surface expression of CD25 and CD103 by gated Foxp3+ CD4 T cells; B, Foxp3 expression by activated, splenic CD4 T cells expressing low (box a), intermediate (box b), or high (box c) levels of surface CD25. The sorted CD25highCD4 T cell population was used for functional assays (shown in Fig. 6). Representative data from pooled spleen cells of three mice per group are shown (of four independent experiments performed). White curves represent staining with isotype control Ab; gray filled curves represent staining with conjugated Ab of the indicated specificity.

 
CD25low, CD25intermediate, and CD25high subsets could be readily distinguished in the activated splenic CD4 T cell population. Only few Foxp3+ T cells were found in the CD25low or CD25intermediate fractions, whereas 80–90% of the cells in the CD25high subset were Foxp3+ (Fig. 4B). The CD4 CD25high subset of the splenic T cell population from treated wt or A{alpha}–/– mice that can be readily sorted for functional studies is thus highly enriched for Foxp3+ T cells.

CD4 Foxp3+ T cells from A{alpha}–/– B6 mice down-modulate T cell responses

To assess the regulatory activity of CD4 Foxp3+ T cells from wt vs A{alpha}–/– B6 mice in vivo, we used a vaccine (i.e., HBsAg particles mixed with immunostimulating CpG ODNs) that efficiently primes CD4 T cell help-independent CD8 T cell responses (39). wt or A{alpha}–/– B6 mice were depleted of CD4 T cells by repeated Ab treatment that reduced the detectable CD4+ and Foxp3+ T cell numbers in spleen and lymph nodes by >98% during the entire period of the ongoing immune response (Fig. 5A). The vaccine-induced CD8 T cell response of wt and A{alpha}–/– B6 mice to the well-defined, Kb-restricted HBsAg epitope (34) was enhanced by depleting CD4 T cells (Fig. 5B, Table I). This was apparent when different doses of the vaccine were used, and when the response was detected either by staining tetramer+ CD8 T cells or by measuring the number of CD8 T cells with specifically inducible IFN-{gamma} expression. No tetramer+ CD8 T cells expressing Foxp3 were found in either mouse line. Although this enhancement was only 2-fold, it is in line with previously published data (40) and may well be of biological significance. In wt as well as MHC class II-deficient mice, CD4 T cells can thus down modulate specific CD8 T cell responses.


Figure 5
View larger version (27K):
[in this window]
[in a new window]

  		FIGURE 5. CD4 TR cells from wt and MHC class II-deficient (A{alpha}–/–) B6 mice control priming of anti-viral CD8 T cell responses. A, Mice were treated by repeated i.p. injections of 100 µg of either the anti-CD4 mAb YTS-191 or isotype control (rat IgG) Ab. Depletion (or inactivation) of CD4 Foxp3+ T cells at the time of vaccination was confirmed by FCM. B, Mice were vaccinated by a single i.m. injection of 5 or 20 µg of HBsAg particles per mouse (formulated with 20 µg of CpG-containing ODNs). Specific, splenic CD8 T cells were measured 14 days after vaccination using Kb/S2 tetramers. Mean values of five individual mice per group (±SEM) are shown. Data from a representative (of two independent) experiment(s) are shown.

 

View this table:
[in this window]
[in a new window]

  		Table I. Depletion of CD4 TR cells facilitates priming of CD8 T cell responses

 
We confirmed in vitro that MHC class II-independent CD4 CD25 T cells down-modulate CD4 and CD8 T cell responses. Sorted splenic CD25high CD4 T cells from anti-CD3 Ab-treated, wt or A{alpha}–/– B6 mice (Fig. 4B) were cocultured with purified, naive (CFSE-labeled) CD25– CD4 or CD8 T cells (at a 1:1 ratio) from wt B6 mice in the presence of microbead-coupled anti-CD3 and anti-CD28 Abs. Proliferation and IL-2 release of activated CD4 as well as CD8 T cells were blocked in the presence of CD25high CD4 TR cells from wt as well as A{alpha}–/– B6 mice (Fig. 6). Anti-CD3/CD28-stimulated TR cells from wt but not A{alpha}–/– B6 mice produced large amounts of IL-10. CD25high CD4 T cells from A{alpha}–/– B6 mice thus qualify as TR cells, similar to their counterparts from MHC class II-expressing wt B6 mice.


Figure 6
View larger version (20K):
[in this window]
[in a new window]

  		FIGURE 6. In vitro down-modulation of T cell priming by Foxp3+ CD4 T cells from wt and A{alpha}–/– B6 mice. CD4 CD25high T cells were FACS purified from anti-CD3 Ab or control Ab-treated wt or A{alpha}–/– B6 mice. These cells contained 80–90% Foxp3+ cells. Naive CD25– CD4 or CD8 T cells were isolated by MACS from the spleen of wt B6 mice and labeled with CFSE. These CD4 or CD8 T cells (3 x 104 per well) were cocultured with CD25high CD4 T cells from either wt B6 mice or MHC class II-deficient (A{alpha}–/–) B6 mice (3 x 104 per well) for 4 days in the presence of bead-coupled anti-CD3/anti-CD28 Ab. A, Cytokine release into the medium was analyzed by ELISA. Mean values of triplicate cultures (±SEM) from a representative (of two independent) experiment(s) are shown. B, CFSE dilution was measured by FCM. Data are gated on CFSE+ cells.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
We demonstrate in this study that CD4 Foxp3 TR cells are found in secondary lymphoid tissues and the periphery but not the thymus of severely MHC class II-deficient mice. These TR cells constitutively express CD103 but up-regulate CD25 surface expression in response to TCR-mediated activation. MHC class II-independent TR cells down-modulate specific CD8 T cell responses in vivo and IL-2 release and proliferation of CD4 or CD8 T cells primed in vitro. Functional CD4 Foxp3+ TR cells thus develop in the complete absence of MHC class II molecules presumably in peripheral tissues.

We found CD4 Foxp3+ TR cells in spleen, lymph nodes, and liver of A{alpha}–/– B6 mice but not in the thymus. The surface phenotype of Foxp3 TR cells from A{alpha}–/– B6 mice was heterogeneous, but most of these TR cells were CD103high and CD25low. CD4 Foxp3 TR cells from A{alpha}–/– B6 mice up-regulated surface expression of CD25, CD69, and CD44 in response to TCR-mediated activation. It has been hypothesized that natural Foxp3 TR cells constitutively express high surface levels of CD25 because they are primed in a TGF-beta-independent manner by self Ags in the thymus and are continuously challenged by self Ags in peripheral tissues, thereby exerting tonic suppression, which contributes to self tolerance (3, 9, 41). In contrast, adaptive Foxp3 TR cells are primed in peripheral tissues by (CD103-inducing) TGF-beta from naive Foxp3– precursors by specific challenge of foreign Ag and can be repeatedly challenged by this Ag in, e.g., chronic infection (28). If correct, MHC class II-deficient A{alpha}–/– B6 mice would harbor adaptive but not natural Foxp3 TR cells. This would imply that establishment of natural TR cell control in the thymus is strictly MHC class II dependent whereas establishment of adaptive TR cell control in the periphery is more flexible in terms of restriction element usage.

We found no CD4+ Foxp3+ cells in thymi of young A{alpha}–/– B6 mice, whereas substantial numbers of Foxp3+ cells were readily detected in SP CD4+CD8– thymocyte populations of sex- and age-matched, congenic wt B6 mice. The minor and variable subset of CD4 Foxp3+ T cells emerging in thymi of adult A{alpha}–/– B6 mice may result from reentry of activated T blasts into the thymus (42). Only few CD8 Foxp3+ T cells were found in thymi of A{alpha}–/– B6 mice, although the splenic CD8 T cell population of these animals contained a Foxp3+ subset that (although small) was 4- to 10-fold expanded when compared with that in wt B6 mice. The CD4 and CD8 Foxp3 TR cell populations expanded in the spleen of A{alpha}–/– B6 mice with age. Although we did not detect Ag-specific (tetramer+) CD8 Foxp3+ T cells in vaccinated A{alpha}–/– B6 mice, these TR cells may be expanded by repeated Ag challenge.

Although NKT cells are frequent in the CD4 {alpha}beta T cell compartment of A{alpha}–/– B6 mice, splenic CD4 Foxp3+ TR cells from A{alpha}–/– B6 mice were not conventional NKT cells. These T cells did not express an invariant TCR that binds glycolipid-loaded CD1d dimers. CD1d–/– B6 mice do not lack CD4 Foxp3+ CD103highCD25low TR cells (data not shown). We thus found no evidence that point to NKT cells as part of the Foxp3 TR cell population, although suppressive NKT cells have been identified (43, 44, 45, 46) and Foxp3+ TR cells and NKT cells have been shown to cooperate in the control of autoimmune disease (47). NKT-like cells with a variant TCR (that are ill defined) may contribute to the Foxp3+ TR cell pool.

Recognition and restriction specificity of CD4 Foxp3+ TR cells were resolved when TCR transgenic systems were used (20) but not under natural conditions. The restriction element in the specific recognition of Foxp3+ CD4 TR cells from A{alpha}–/– B6 mice is unknown. There are few leads that suggest candidates. It is intriguing that Foxp3+ TR cells preferentially express CD4 even in the absence of conventional MHC class II molecules. MHC class II (-like) molecules present in A{alpha}–/– B6 mice (DM and DO molecules) do not present peptides to T cells. Alternatively, MHC class I-like molecules (such as Qa-1, TL, and H2M3) may present epitopes to these TR cells that would make this subset NKT-like. A coreceptor function for CD103 is not known, although enhancement of CD3/TCR-induced activation of intestinal intraepithelial T cells by stimulation with an CD103-binding Ab has been described (48). A{alpha}–/– mice seem to be a novel model for the study of adaptive Foxp3+ TR cells (isolated from the natural Foxp3+ TR cell compartment).


   Acknowledgments
 
We greatly appreciate the expert technical assistance of Ellen Allmendinger. We gratefully acknowledge the gift of the MHC class II-deficient A{alpha}–/– B6 mice from Dr. H. Bluethmann (Roche, Basel, Switzerland) and the HBsAg/Kb tetramers from the National Institute of Allergy and Infectious Diseases Tetramer Facility (Emory University Vaccine Center, Atlanta, GA). We thank Dr. G. Hämmerling (German Cancer Research Center, Heidelberg, Germany) for helpful discussions.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Grant Rei 549/10-2 from Deutsche Forschungsgemeinschaft (to J.R.). Back

2 Address correspondence and reprint requests to Dr. Joerg Reimann, Department of Internal Medicine I, University of Ulm, Albert Einstein Allee 11, D-89081 Ulm, Germany, E-mail address: joerg.reimann{at}uni-ulm.de Back

3 Abbreviations used in this paper: TR, regulatory T; wt, wild type; DC, dendritic cell; S, spleen; SP; single-positive CD4+CD8–; DP, double-positive CD4+CD8+; FCM, flow cytometry; {alpha}GalCer, {alpha}-galactosylceramide; HBsAg, hepatitis B surface Ag; ODN, oligodeoxynucleotide. Back

Received for publication July 24, 2006. Accepted for publication September 29, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Shevach, E. M.. 2002. CD4 CD25 suppressor T cells: more questions than answers. Nat. Rev. Immunol. 2: 389-400. [Medline]
  2. Sakaguchi, S.. 2004. Naturally arising CD4 regulatory T cells for immunologic self-tolerance and negative control of immune responses. Annu. Rev. Immunol. 22: 531-562. [Medline]
  3. Weaver, C. T., L. E. Harrington, P. R. Mangan, M. Gavrieli, K. M. Murphy. 2006. Th17: an effector CD4 T cell lineage with regulatory T cell ties. Immunity 24: 677-688. [Medline]
  4. Ramsdell, F.. 2003. Foxp3 and natural regulatory T cells: key to a cell lineage?. Immunity 19: 165-168. [Medline]
  5. Fontenot, J. D., A. Y. Rudensky. 2005. A well adapted regulatory contrivance: regulatory T cell development and the forkhead family transcription factor Foxp3. Nat. Immunol. 6: 331-337. [Medline]
  6. Ziegler, S. F.. 2006. FOXP3: of mice and men. Annu. Rev. Immunol. 24: 209-226. [Medline]
  7. Iwashiro, M., R. J. Messer, K. E. Peterson, I. M. Stromnes, T. Sugie, K. J. Hasenkrug. 2001. Immunosuppression by CD4 regulatory T cells induced by chronic retroviral infection. Proc. Natl. Acad. Sci. USA 98: 9226-9230. [Abstract/Free Full Text]
  8. Hori, S., T. Nomura, S. Sakaguchi. 2003. Control of regulatory T cell development by the transcription factor Foxp3. Science 299: 1057-1061. [Abstract/Free Full Text]
  9. Wan, Y. Y., R. A. Flavell. 2005. Identifying Foxp3-expressing suppressor T cells with a bicistronic reporter. Proc. Natl. Acad. Sci. USA 102: 5126-5131. [Abstract/Free Full Text]
  10. Tang, Q., J. A. Bluestone. 2006. Plasmacytoid DCs and Treg cells: casual acquaintance or monogamous relationship?. Nat. Immunol. 7: 551-553. [Medline]
  11. Fontenot, J. D., J. P. Rasmussen, L. M. Williams, J. L. Dooley, A. G. Farr, A. Y. Rudensky. 2005. Regulatory T cell lineage specification by the forkhead transcription factor Foxp3. Immunity 22: 329-341. [Medline]
  12. Bensinger, S. J., A. Bandeira, M. S. Jordan, A. J. Caton, T. M. Laufer. 2001. Major histocompatibility complex class II-positive cortical epithelium mediates the selection of CD4+CD25+ immunoregulatory T cells. J. Exp. Med. 194: 427-438. [Abstract/Free Full Text]
  13. Watanabe, N., Y. H. Wang, H. K. Lee, T. Ito, Y. H. Wang, W. Cao, Y. J. Liu. 2005. Hassall’s corpuscles instruct dendritic cells to induce CD4+CD25+ regulatory T cells in human thymus. Nature 436: 1181-1185. [Medline]
  14. Shimoda, M., F. Mmanywa, S. K. Joshi, T. Li, K. Miyake, J. Pihkala, J. A. Abbas, P. A. Koni. 2006. Conditional ablation of MHC-II suggests an indirect role for MHC-II in regulatory CD4 T cell maintenance. J. Immunol. 176: 6503-6511. [Abstract/Free Full Text]
  15. Chen, W., W. Jin, N. Hardegen, K. J. Lei, L. Li, N. Marinos, G. McGrady, S. M. Wahl. 2003. Conversion of peripheral CD4+CD25– naive T cells to CD25+CD4 regulatory T cells by TGF-beta induction by transcription factor Foxp3. J. Exp. Med. 198: 1875-1886. [Abstract/Free Full Text]
  16. Fantini, M. C., C. Becker, G. Monteleone, F. Pallone, P. R. Galle, M. F. Neurath. 2004. TGFbeta induces a regulatory phenotype in CD4 CD25– T Cells through Foxp3 induction and down-regulation of Smad7. J. Immunol. 172: 5149-5153. [Abstract/Free Full Text]
  17. Verhasselt, V., O. Vosters, C. Beuneu, C. Nicaise, P. Stordeur, M. Goldman. 2004. Induction of Foxp3-expressing regulatory CD4 T cells by human mature autologous dendritic cells. Eur. J. Immunol. 34: 762-772. [Medline]
  18. Curotto de Lafaille, M. A., A. C. Lino, N. Kutchukhidze, J. J. Lafaille. 2004. CD25– T cells generate CD4 FoxP3+ regulatory T cells by peripheral expansion. J. Immunol. 173: 7259-7268. [Abstract/Free Full Text]
  19. Hong, J., N. Li, X. Zhang, B. Zheng, J. Z. Zhang. 2005. Induction of CD4 CD25+ regulatory T cells by copolymer-I through activation of transcription factor Foxp3. Proc. Natl. Acad. Sci. USA 102: 6449-6454. [Abstract/Free Full Text]
  20. Kretschmer, K., I. Apostolou, D. Hawiger, K. Khazaie, M. C. Nussenzweig, H. von Boehmer. 2005. Inducing and expanding regulatory T cell populations by foreign antigen. Nat. Immunol. 6: 1219-1227. [Medline]
  21. Liu, Y., I. Teige, B. Birnir, S. Issazadeh-Navikas. 2006. Neuron-mediated generation of regulatory T cells from encephalitogenic T cells suppresses EAE. Nat. Med. 12: 518-525. [Medline]
  22. Cong, Y., A. Konrad, N. Iqbal, R. D. Hatton, C. T. Weaver, C. O. Elson. 2005. Generation of antigen-specific, Foxp3-expressing CD4 regulatory T cells by inhibition of APC proteosome function. J. Immunol. 174: 2787-2795. [Abstract/Free Full Text]
  23. Ochando, J. C., C. Homma, Y. Yang, A. Hidalgo, A. Garin, F. Tacke, V. Angeli, Y. Li, P. Boros, Y. Ding, R. Jessberger, et al 2006. Alloantigen-presenting plasmacytoid dendritic cells mediate tolerance to vascularized grafts. Nat. Immunol. 7: 652-662. [Medline]
  24. Lehmann, J., J. Huehn, M. de la Rosa, F. Maszyna, U. Kretschmer, V. Krenn, M. Brunner, A. Scheffold, A. Hamann. 2002. Expression of the integrin {alpha}Ebeta7 identifies unique subsets of CD25+ as well as CD25– regulatory T cells. Proc. Natl. Acad. Sci. USA 99: 13031-13036. [Abstract/Free Full Text]
  25. Suffia, I., S. K. Reckling, G. Salay, Y. Belkaid. 2005. A role for CD103 in the retention of CD4 CD25+ Treg and control of Leishmania major infection. J. Immunol. 174: 5444-5455. [Abstract/Free Full Text]
  26. Leithaeuser, F., T. Meinhardt-Krajina, K. Fink, B. Wotschke, P. Moeller, J. Reimann. 2006. Foxp3-expressing CD103+ regulatory T cells accumulate in dendritic cell aggregates of the colonic mucosa in murine transfer colitis. Am. J. Pathol. 168: 1898-1909. [Abstract/Free Full Text]
  27. Huehn, J., K. Siegmund, J. C. Lehmann, C. Siewert, U. Haubold, M. Feuerer, G. F. Debes, J. Lauber, O. Frey, G. K. Przybylski, et al 2004. Developmental stage, phenotype, and migration distinguish naive- and effector/memory-like CD4 regulatory T cells. J. Exp. Med. 199: 303-313. [Abstract/Free Full Text]
  28. Suffia, I. J., S. K. Reckling, C. A. Piccirillo, R. S. Goldszmid, Y. Belkaid. 2006. Infected site-restricted Foxp3+ natural regulatory T cells are specific for microbial antigens. J. Exp. Med. 203: 777-788. [Abstract/Free Full Text]
  29. Trobonjaca, Z., F. Leithaeuser, P. Moller, H. Bluethmann, Y. Koezuka, H. R. MacDonald, J. Reimann. 2001. MHC-II-independent CD4+ T cells induce colitis in immunodeficient RAG–/– hosts. J. Immunol. 166: 3804-3812. [Abstract/Free Full Text]
  30. Krajina, T., F. Leithäuser, J. Reimann. 2004. MHC class II-independent CD25+ CD4 CD8{alpha}beta+ {alpha}beta T cells attenuate CD4 T cell-induced transfer colitis. Eur. J. Immunol. 34: 705-714. [Medline]
  31. Kontgen, F., G. Suss, C. Stewart, M. Steinmetz, H. Bluethmann. 1993. Targeted disruption of the MHC class II A{alpha} gene in C57BL/6 mice. Int. Immunol. 5: 957-964. [Abstract/Free Full Text]
  32. Trobonjaca, Z., F. Leithäuser, P. Moller, R. Schirmbeck, J. Reimann. 2001. Activating immunity in the liver. I. Liver dendritic cells (but not hepatocytes) are potent activators of IFN{gamma} release by liver NKT cells. J. Immunol. 167: 1413-1422. [Abstract/Free Full Text]
  33. Schirmbeck, R., N. Dikopoulos, M. Kwissa, F. Leithäuser, K. Lamberth, S. Buus, K. Melber, J. Reimann. 2003. Breaking tolerance in hepatitis B surface antigen (HBsAg) transgenic mice by vaccination with cross-reactive, natural HBsAg variants. Eur. J. Immunol. 33: 3342-3352. [Medline]
  34. Schirmbeck, R., W. Böhm, N. Fissolo, K. Melber, J. Reimann. 2003. Different immunogenicity of H-2 Kb-restricted epitopes in natural variants of the hepatitis B surface antigen. Eur. J. Immunol. 33: 2429-2438. [Medline]
  35. Janowicz, Z. A., K. Melber, A. Merckelbach, E. Jacobs, N. Harford, M. Comberbach, C. P. Hollenberg. 1991. Simultaneous expression of the S and L surface antigens of hepatitis B, and formation of mixed particles in the methylotrophic yeast. Hansenula polymorpha. Yeast 7: 431-443.
  36. Cosgrove, D., D. Gray, A. Dierich, J. Kaufman, M. Lemeur, C. Benoist, D. Mathis. 1991. Mice lacking MHC class II molecules. Cell 66: 1051-1066. [Medline]
  37. Grusby, M. J., R. S. Johnson, V. E. Papaioannou, L. H. Glimcher. 1991. Depletion of CD4 T cells in major histocompatibility complex class II-deficient mice. Science 253: 1417-1420. [Abstract/Free Full Text]
  38. Cardell, S., S. Tangri, S. Chan, M. Kronenberg, C. Benoist, D. Mathis. 1995. CD1-restricted CD4+ T cells in major histocompatibility complex class II-deficient mice. J. Exp. Med. 182: 993-1004. [Abstract/Free Full Text]
  39. Wild, J., M. J. Grusby, R. Schirmbeck, J. Reimann. 1999. Priming MHC-I-restricted cytotoxic T lymphocyte responses to exogenous hepatitis B surface antigen is CD4 T cell dependent. J. Immunol. 163: 1880-1887. [Abstract/Free Full Text]
  40. Dikopoulos, N., A. Bertoletti, A. Kroger, H. Hauser, R. Schirmbeck, J. Reimann. 2005. Type I IFN negatively regulates CD8 T cell responses through IL-10-producing CD4 T regulatory 1 cells. J. Immunol. 174: 99-109. [Abstract/Free Full Text]
  41. Bluestone, J. A., A. K. Abbas. 2003. Natural versus adaptive regulatory T cells. Nat. Rev. Immunol. 3: 253-257. [Medline]
  42. Agus, D. B., C. D. Surh, J. Sprent. 1991. Reentry of T cells to the adult thymus is restricted to activated T cells. J. Exp. Med. 173: 1039-1046. [Abstract/Free Full Text]
  43. Cui, J., N. Watanabe, T. Kawano, M. Yamashita, T. Kamata, C. Shimizu, M. Kimura, E. Shimizu, J. Koike, H. Koseki, et al 1999. Inhibition of T helper cell type 2 cell differentiation and immunoglobulin E response by ligand-activated V{alpha}14 natural killer T cells. J. Exp. Med. 190: 783-792. [Abstract/Free Full Text]
  44. Sonoda, K. H., M. A. Exley, S. Snapper, S. P. Balk, J. Stein-Streilein. 1999. CD1-reactive natural killer T cells are required for development of systemic tolerance through an immune-privileged site. J. Exp. Med. 190: 1215-1226. [Abstract/Free Full Text]
  45. Seino, K. K., K. Fukao, K. Muramoto, K. Yanagisawa, Y. Takada, S. Kakuta, Y. Iwakura, L. van Kaer, K. Takeda, T. Nakayama, M. Taniguchi, H. Bashuda, H. Yagita, K. Okumura. 2001. Requirement for natural killer T (NKT) cells in the induction of allograft tolerance. Proc. Natl. Acad. Sci. USA 98: 2577-2581. [Abstract/Free Full Text]
  46. Sonoda, K. H., D. E. Faunce, M. Taniguchi, M. A. Exley, S. B. Balk, J. Stein-Streilein. 2001. NK T cell-derived IL-10 is essential for the differentiation of antigen- specific T regulatory cells in systemic tolerance. J. Immunol. 166: 42-50. [Abstract/Free Full Text]
  47. Liu, R., A. La Cava, X. F. Bai, Y. Jee, M. Price, D. I. Campagnolo, P. Christadoss, T. L. Vollmer, L. van Kaer, F. D. Shi. 2005. Cooperation of invariant NKT cells and CD4 CD25+ T regulatory cells in the prevention of autoimmune myasthenia. J. Immunol. 175: 7898-7904. [Abstract/Free Full Text]
  48. Sarnacki, S., B. Begue, H. Buc, D. F. Le, B. N. Cerf. 1992. Enhancement of CD3-induced activation of human intestinal intraepithelial lymphocytes by stimulation of the beta7-containing integrin defined by HML-1 monoclonal antibody. Eur. J. Immunol. 22: 2887-2892. [Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
D. C. Jay, L. M. Reed-Loisel, and P. E. Jensen
Polyclonal MHC Ib-Restricted CD8+ T Cells Undergo Homeostatic Expansion in the Absence of Conventional MHC-Restricted T Cells
J. Immunol., March 1, 2008; 180(5): 2805 - 2814.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bochtler, P.
Right arrow Articles by Reimann, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bochtler, P.
Right arrow Articles by Reimann, J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS