The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O’Hara, A. M.
Right arrow Articles by Crowe, S. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O’Hara, A. M.
Right arrow Articles by Crowe, S. E.
The Journal of Immunology, 2006, 177: 7990-7999.
Copyright © 2006 by The American Association of Immunologists, Inc.

Interleukin-8 Induction by Helicobacter pylori in Gastric Epithelial Cells is Dependent on Apurinic/Apyrimidinic Endonuclease-1/Redox Factor-11

Ann M. O’Hara*, Asima Bhattacharyya*, Randy C. Mifflin{dagger}, Michael F. Smith*, Kieran A. Ryan*, Kevin G.-E. Scott*, Makoto Naganuma*, Antonella Casola{ddagger}, Tadahide Izumi§, Sankar Mitra§, Peter B. Ernst* and Sheila E. Crowe2,*

* Department of Internal Medicine, University of Virginia, Charlottesville, Virginia 22908; and {dagger} Department of Internal Medicine, {ddagger} Department of Pediatrics, and § Department of Human Biological Chemistry and Genetics, University of Texas Medical Branch, Galveston, Texas 77555


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Helicobacter pylori infection causes inflammation and increases the expression of IL-8 in human gastric epithelial cells. H. pylori activates NF-{kappa}B and AP-1, essential transcriptional factors in H. pylori-induced IL-8 gene transcription. Although colonization creates a local oxidative stress, the molecular basis for the transition from infection to the expression of redox-sensitive cytokine genes is unknown. We recently reported that the expression of apurinic/apyrimidinic endonuclease-1/redox factor-1 (APE-1/Ref-1), which repairs oxidative DNA damage and reductively activates transcription factors including AP-1 and NF-{kappa}B, is increased in human gastric epithelia during H. pylori infection. In this study, we examine whether APE-1/Ref-1 functions in the modulation of IL-8 gene expression in H. pylori-infected human gastric epithelial cells. Small interfering RNA-mediated silencing of APE-1/Ref-1 inhibited basal and H. pylori-induced AP-1 and NF-{kappa}B DNA-binding activity without affecting the nuclear translocation of these transcription factors and also reduced H. pylori-induced IL-8 mRNA and protein. In contrast, overexpression of APE-1/Ref-1 enhanced basal and H. pylori-induced IL-8 gene transcription, and the relative involvement of AP-1 in inducible IL-8 promoter activity was greater in APE-1/Ref-1 overexpressing cells than in cells with basal levels of APE-1/Ref-1. APE-1/Ref-1 inhibition also reduced other H. pylori-induced chemokine expression. By implicating APE-1/Ref-1 as an important regulator of gastric epithelial responses to H. pylori infection, these data elucidate a novel mechanism controlling transcription and gene expression in bacterial pathogenesis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Helicobacter pylori is a Gram-negative bacterium that colonizes the human gastric mucosa and is a major cause of chronic superficial gastritis, duodenal or gastric ulceration, and gastric adenocarcinoma (1, 2, 3). Strains that encode a cluster of cag genes located within the cag pathogenicity island (PAI)3 (3) are associated with more severe disease manifestations (4). Infection is characterized by an infiltration of mononuclear and polymorphonuclear cells into the gastric mucosa (5) and the accumulation of various cytokines, including IL-1beta, IL-6, IL-8, and TNF-{alpha} (6). Of these, IL-8, a CXC chemokine, plays a pivotal role in the recruitment and activation of neutrophils in response to H. pylori infection (7). A major source of IL-8 in the gastric mucosa is the epithelium, and the coculture of cag PAI-bearing H. pylori with gastric epithelial cells stimulates IL-8 secretion (8, 9, 10, 11).

IL-8 gene expression is regulated primarily at the transcriptional level (12), and several transcription factors have been implicated in H. pylori-induced IL-8 promoter activation in gastric epithelial cells (13, 14, 15). In particular, both AP-1 and NF-{kappa}B act as essential transcriptional factors in H. pylori-induced IL-8 gene transcription (16, 17). Although colonization creates a local oxidative stress (18) and studies have shown that reactive oxygen species (ROS) modulate IL-8 secretion in gastric epithelial cells (17, 19), the molecular basis for the transition from infection to the expression of redox-sensitive cytokine genes, such as IL-8, has not been determined.

Apurinic/apyrimidinic endonuclease-1/redox factor-1 (APE-1/Ref-1) is an essential, ubiquitous, multifunctional protein involved in the base excision repair of oxidative DNA damage (20, 21). APE-1/Ref-1 also regulates the DNA-binding activity of a number of transcription factors in a redox-dependent manner via the reduction of conserved cysteine residues in their DNA binding domains (22). These transcription factors include the AP-1 proteins Fos and Jun, NF-{kappa}B, Myb, p53, hypoxia-inducible factor-1-{alpha}, and others (reviewed by Evans et al. in Ref. 23).

APE-1/Ref-1 is regulated at both the transcriptional and posttranslational levels (24). ROS enhance APE-1/Ref-1 expression and activity in fibroblasts, macrophages, B cells, and other cell types (25, 26, 27, 28). Studies have shown that infection with H. pylori generates ROS (29), resulting in the accumulation of ROS within the gastric mucosa (18) including the epithelial cells (30), which, in turn, leads to oxidative DNA damage (31) in infected patients. Previously, we reported that treatment with hydrogen peroxide as well as infection with H. pylori, but not Campylobacter jejuni, enhanced APE-1/Ref-1 expression in human gastric epithelial cells (32). Moreover, altered levels or cellular location of APE-1/Ref-1 have been found in some cancers, including ovarian and prostate (33, 34), while an APE-1/Ref-1-like gene was recently shown to be up-regulated in gastric cancer (35).

In this study, we investigate whether APE-1/Ref-1 regulates gastric epithelial cell responses to H. pylori and, specifically, whether APE-1/Ref-1 modulates IL-8 gene expression in response to infection. We report that the silencing of APE-1/Ref-1 expression in gastric epithelial cells inhibits basal and H. pylori-induced AP-1 and NF-{kappa}B DNA-binding activity and abrogates H. pylori-induced IL-8 mRNA and protein. Conversely, APE-1/Ref-1 overexpression enhances H. pylori-induced IL-8 gene transcription.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Primers and PCRs

Unless stated otherwise, total RNA was extracted using the RNeasy kit (Qiagen) and reverse transcribed using the SuperScript First Strand synthesis system (Invitrogen Life Technologies). Negative no-RT controls were prepared by the omission of reverse transcriptase from reaction mixtures. Real-time dual-labeled probe PCR for human APE-1/Ref-1 or human IL-8 was performed in a SmartCycler (Cepheid) using primer and tetrachloro-6-carboxyfluorescein (TET)-labeled probe sets designed by us (Integrated DNA Technologies). The IL-8 primer/probe sequences have been described (36), and sequences for the APE-1/Ref-1 primers were 5'-TGGATTGTGGATGGGCTTCGAGCC-3' (forward), 5'-AAGGAGCTGACCAGTATTGATGA-3' (reverse), and 5'-/5TET/TAAAGGAAGAAGCCCCAGATATACTGT/3BHQ-1/-3' (probe). Real-time RT-PCR was performed, and following amplification the APE-1/Ref-1 or IL-8 mRNA expression levels were determined semiquantitatively by comparing the critical threshold (CT) values to a standard curve and normalizing these CT values against 18S rRNA CT values (36).

GAPDH and beta-actin mRNA expression levels were visualized on 2% agarose gels following conventional PCR amplification in a DNA Engine thermocycler (MJ Research). The beta-actin primers were from Applied Biosystems and the GAPDH primers were 5'-GGCGTCTTCACCACCATGGAG-3' (forward) and 5'-AAGTTGTCATGGATTGACCTTGG-3' (reverse). Cycling parameters for GAPDH were 95°C for 5 min followed by 34 cycles at 95°C for 1 min, 55°C for 1 min, and 72°C for 1 min, whereas those for beta-actin were 95°C for 5 min followed by 39 cycles at 95°C for 1 min, 60°C for 1 min, and 72°C for 1 min.

Additional samples were generated and subjected to real-time RT-PCR using the MJ Research Opticon system with SYBR Green I (Molecular Probes) as a fluorescent reporter. IL-8 mRNA in these samples was assayed as described above. Hypoxanthine phosphoribosyltransferase (HPRT), MIP-3{alpha}, and GRO-{alpha} cDNAs were amplified in separate reactions. Duplicate PCRs were performed for each sample and the average threshold cycle number was determined using the Opticon software. Normalized levels of MIP-3{alpha} and GRO-{alpha} expression were determined using the formula 2(Rt – Et), where Rt is the threshold cycle for the reference gene (HPRT) and Et is the threshold cycle for the experimental gene ({Delta}{Delta}CT method). Data are thus expressed as arbitrary units. Sequences for the HPRT primers were 5'-TGCCGAGGATTTGGAAAAAGTG-3' (forward) and 5'-CACAGAGGGCCACAATGTGATG-3' (reverse). Sequences for the MIP-3{alpha} primers were 5'-CTGGCCAATGAAGGCTGTGA-3' (forward) and 5'-ACCTCCAACCCCAGCAAGGT-3' (reverse). Sequences for the GRO-{alpha} primers were 5'-AAACCGAAGTCATAGCCACACT-3' (forward) and 5'-CAGGGCCTCCTTCAGGAACA-3' (reverse). A real-time dual-labeled probe PCR for human ENA-78 was performed in a SmartCycler (Cepheid) using a preoptimized FAM-labeled primer and probe set (Applied Biosystems). Normalized levels of ENA-78 were determined using the formula 2(Rt – Et), as described above.

Isolation of human gastric epithelial cells by laser capture microdissection

Gastric biopsy samples were taken from human subjects undergoing medically indicated endoscopy at the Digestive Health Center of Excellence, University of Virginia (Charlottesville, VA) in accordance with an Institutional Review Board-approved protocol. H. pylori infection status was determined in separate samples obtained for diagnostic purposes using histochemistry with immunostaining for H. pylori according to standard Department of Pathology (University of Virginia) diagnostic methods. Study biopsy samples were snap frozen and sections (8 µm) were prepared and micro dissected as described previously (32). RNA was extracted from the captured cells using the Absolutely RNA nanoprep kit (Stratagene) and cDNA and no-RT controls were prepared. Following RT-PCR amplification of APE-1/Ref-1, the PCR products were analyzed by 2% agarose gel electrophoresis.

Cell lines and bacteria

The human gastric epithelial cell line AGS (provided by P. Sherman, University of Toronto, Toronto, Canada) was grown in Ham’s F12 medium (Invitrogen Life Technologies) supplemented with 10% heat-inactivated FCS (Invitrogen Life Technologies). The human monocyte THP-1 cell line (American Type Culture Collection) was maintained in RPMI 1640 (HyClone) containing 10% heat-inactivated FCS.

H. pylori 26695, a cag PAI-bearing strain (37) (American Type Culture Collection), H. pylori 8-1, a cag PAI-deficient isogenic knockout strain (provided by D. Berg, Washington University School of Medicine, St. Louis, MO), and H. pylori LC-11, a clinically isolated cag PAI-bearing strain (38), were maintained on blood agar plates (BD Biosciences). Before use in experiments, the bacteria were cultured overnight at 37°C in Brucella broth (Invitrogen Life Technologies) with 10% FCS under microaerophilic conditions and the bacterial number was determined as described (39).

Stimulation of AGS cells

All stimulations of AGS cells were performed in serum-free Ham’s F12 medium to minimize serum-induced IL-8 release (9) and to allow an analysis of the response to exogenous stimuli. Previously, we determined an optimal bacteria to epithelial cell ratio of 300:1 for stimulating epithelial cells with H. pylori (39), and this was the infectious dose used in this study. Formalin-killed H. pylori 26695, prepared as described (8), was also used at a ratio of 300:1. Supernatant fluids of sonicated H. pylori 26695 were prepared as previously reported (40). The protein concentration of the sonicates was determined by Bradford assay (Bio-Rad) and the sonicates were used at a concentration of 10 µg/ml (equivalent to protein extract from 300:1 bacteria).

Silencing of APE-1/Ref-1 in AGS cells

APE-1/Ref-1 expression was inhibited by using human APE-1/Ref-1 small interfering RNA (siRNA) 21-oligonucleotide sequences as described previously by Fan et al. (41): 5'-GUCUGGUACGACUGGAGUACC-3' (sense) and 5'-UACUCCAGUCGUACCAGACCC-3' (antisense) (Dharmacon Research). We designed a negative control siRNA duplex by scrambling the APE-1/Ref-1 siRNA sequences, and a homology search indicated that the scrambled oligonucleotides lacked sequence-specific homology to any human gene. Sequences of the scrambled siRNA were 5'-ACGGUGUAGGUCGACUGUAdTdT-3' (sense) and 5'-UACAGUCGACCUACACCGUdTdT-3' (antisense) (Dharmacon). In later experiments, siControl RNA (Dharmacon), a nontargeting siRNA, was used instead of scrambled siRNA. For all APE-1/Ref-1 inhibition assays, AGS cells (0.5 x 105/well) were seeded into 4-cm2 12-well plates in 1 ml of Ham’s F12 medium with 10% heat-inactivated FCS for 24 h before siRNA transfection. Optimization assays indicated that the most significant siRNA activity was attained using 50 nM APE-1/Ref-1 siRNA, a concentration used by others in a previous study (41). Consequently, AGS cells were transfected with 50 nM APE-1/Ref-1 siRNA, 50 nM scrambled APE-1/Ref-1 siRNA, or transfection reagent alone using 2 µl of LipofectAMINE 2000 (Invitrogen Life Technologies) diluted in Opti-MEM I reduced serum medium (Invitrogen Life Technologies) according to the manufacturer’s instructions. After 24 h, the transfection reagent was removed and the cells were incubated in 2 ml of growth medium for a further 24–48 h before analyzing APE-1/Ref-1 expression levels.

Confirmation of siRNA-mediated silencing of APE-1/Ref-1

The effects of siRNA transfection on APE-1/Ref-1 expression in AGS cells were analyzed 48 and 72 h posttransfection using real-time RT-PCR and Western blotting. APE-1/Ref-1 mRNA expression was quantified using real-time RT-PCR as described above. Immunoblotting was performed on cell lysates as described (40), and 5 µg of protein was fractionated by 12% SDS-PAGE. The protein transferred onto nitrocellulose membrane was incubated with anti-human APE-1/Ref-1 mAb (Novus Biologicals followed by HRP-conjugated goat anti-mouse IgG (Cell Signaling Technology). Immunoreactions were visualized by ECL (Amersham Biosciences) and autoradiographed. Protein expression was quantified using densitometry and protein loading was normalized to beta-actin as described (32). To investigate the specificity of the APE-1/Ref-1 siRNA, an equal concentration of cDNA samples from APE-1/Ref-1 siRNA-transfected or nontransfected cells were PCR amplified using the beta-actin and GAPDH primers, and the expression levels of beta-actin and GAPDH mRNA were compared.

Analysis of the effect of APE-1/Ref-1 silencing on H. pylori-induced IL-8

Nontransfected cells, mock-transfected cells, and cells transfected with 50 nM APE-1/Ref-1 siRNA were stimulated with H. pylori 48 h posttransfection. Increased IL-8 mRNA expression in gastric epithelial cell lines within 1 h of exposure to H. pylori has been reported (9, 10) and, consequently, IL-8 mRNA expression levels were determined using real-time RT-PCR 1 h postinfection. Previously, we reported that H. pylori-infected gastric epithelial cells produced significant amounts of IL-8 protein within 3 h (8) and, thus, IL-8 protein levels in cell culture supernatants were quantified 3 h postinfection using an ELISA DuoSet kit (R&D Systems) according to the manufacturer’s protocol. To normalize for cell number between control- and siRNA-transfected cells in siRNA assays, the total protein concentration of lysates was determined by Bradford assay and results were expressed as picograms of IL-8 per milligram of total protein.

EMSA

AGS cells (2 x 106) were seeded in triplicate in 75-cm2 tissue culture flasks in 10 ml of growth medium and incubated for 24 h. Subsequently, the medium was replaced with 8 ml of fresh medium and the cells were transfected with 50 nM APE-1/Ref-1 siRNA using 16 µl of LipofectAMINE 2000 per flask. Nontransfected cells were used as controls. After 24 h, the medium was replaced with 10 ml of serum-free medium and the cells were incubated for a further 24 h before infection with H. pylori for varying times. Triplicate samples were pooled, nuclear proteins were extracted as described (42), and proteins were normalized using the BCA protein assay reagent kit (Pierce). EMSAs were performed using the Gel Shift assay system (Promega) with [{gamma}-32P]ATP (Amersham Biosciences) end-labeled consensus AP-1 and NF-{kappa}B oligonucleotides (Promega). The DNA binding reaction mixtures contained 8.5 µg of nuclear extract in gel shift binding buffer (Promega) and 0.06 pmol of {gamma}-32P-labeled AP-1 or NF-{kappa}B oligonucleotide. The samples were fractionated through 4% nondenaturing polyacrylamide gels in TBE buffer (10 mM Tris-HCl (pH 8.0) and 1 mM EDTA). In competition assays, 3.5 pmol of cold AP-1 or NF-{kappa}B consensus probes (specific competitors) or cold nonspecific competitors were added to control samples at the same time as the probe. Following electrophoresis, gels were dried and exposed for autoradiography at –70°C. For the gel mobility supershift assays, 1 µl of either preimmune serum, anti-p50, anti-p65, or anti-c-Rel Ab or 2 µl of anti-c-Jun or anti-c-Fos Ab (Santa Cruz Biotechnology) were added to reaction mixtures after the probe.

Assessment of the effect of APE-1/Ref-1 silencing on H. pylori-induced expression of NF-{kappa}B and AP-1 in the nucleus

The effects of APE-1/Ref-1 siRNA transfection on NF-{kappa}B, AP-1, and APE-1 nuclear transport in AGS cells were analyzed 48 h posttransfection using Western blotting. Total cellular lysates were also analyzed by Western blotting to check the extent of silencing on the APE-1/Ref-1 level itself. After treating the cells with 300:1 H. pylori for 1 h (for NF-{kappa}B) or 2 h (for AP-1), nuclear and total cell lysates were prepared using methods as described earlier (32). Protein concentrations were measured using a BCA protein assay reagent kit (Pierce). For the transcription factors, 8 µg of nuclear proteins were fractionated by 10% SDS-PAGE. The proteins were transferred onto nitrocellulose membranes, blocked in 5% nonfat dry milk-containing TBST buffer, and incubated with rabbit p50, p65, c-Fos, and c-Jun Abs (all from Cell Signaling Technology) at 1/1000 dilutions, followed by incubation with HRP-conjugated anti-rabbit IgG (Cell Signaling Technology) at 1/2000 dilution. Total cell lysates or nuclear proteins (5 µg) were fractionated to detect total or nuclear APE-1/Ref-1, respectively. Membrane was incubated with anti-human APE-1/Ref-1 mAb (Novus Biologicals) at 1/3000 dilution, followed by HRP-conjugated goat anti-mouse IgG (Cell Signaling Technology) at 1/2000 dilution. Immunoreactions were visualized by ECL (Amersham Biosciences).

Plasmids

Luciferase-linked 5'-deletion constructs of the human IL-8 promoter were prepared using the –1498/+44 hIL-8/Luc plasmid as a template as described (43, 44). The –1498/+44 hIL-8/Luc and –162/+44 hIL-8/Luc plasmids contain binding sites for AP-1, NF-IL-6, and NF-{kappa}B, whereas these binding sites are deleted in the –54/+44 hIL-8/Luc plasmid. Site-directed mutations of the IL-8 AP-1 or NF-{kappa}B binding sites in the context of the –162/+44 hIL-8 promoter were introduced by the PCR overlap extension mutagenesis technique as described previously (45). The APE-1/Ref-1 expression vector pFLAG-APE-1 cDNA3.1 was prepared as described (32).

Overexpression of APE-1/Ref-1

AGS cells (1 x 105) were seeded in triplicate in 4-cm2 12-well plates and after 24 h were transiently transfected with 0.25 µg of one of the hIL-8/Luc promoter constructs and 0.025 µg of phRL-TK Renilla as an internal control vector (Promega) using FuGENE 6 transfection reagent (Roche Diagnostics) at a ratio of 3 µl of FuGENE 6 per 1 µg of DNA. To induce the overexpression of APE-1/Ref-1, cells were cotransfected with 0.25 µg of pFLAG-APE-1 cDNA3.1. After a 24-h incubation, the transfection reagent was removed and the cells were incubated for a further 48 h in 2 ml of Ham’s F12 medium with 0.2% heat-inactivated FCS. Subsequently, cells were stimulated in serum-free medium for 3 h and then lysed using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s instructions. The firefly and Renilla luminescence signals were quantified sequentially using a MircoBeta TriLux luminescence counter (Wallac), and firefly luciferase was normalized to Renilla luciferase activity. However, in cells cotransfected with pFLAG-APE-1 cDNA3.1 we observed that Renilla luciferase activity was induced by APE-1/Ref-1 overexpression. Similar effects of experimental conditions on internal control vectors have been reported (46, 47) and, consequently, as others have done (48) we determined the total protein concentration of the lysates by Bradford assay and results were expressed as IL-8 luciferase activity normalized to protein.

Statistical analysis

Data were compared using a two-tailed Student’s t test, or data from experiments involving multiple samples subject to each treatment were analyzed for multiple pairwise comparisons by the Mann-Whitney rank sum test and the Kruskal-Wallis one-way ANOVA test. The signed Wilcoxon’s rank sum test was used to analyze cytokine mRNA levels. Data are expressed as mean ± SEM and results were considered significant if p values were <0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
APE-1/Ref-1 is expressed in situ by human gastric epithelial cells

We first determined whether APE-1/Ref-1 is expressed constitutively in the normal human gastric epithelium. Gastric epithelial cells were excised from two H. pylori-negative human gastric mucosal biopsy specimens. Using RT-PCR, a 169-bp APE-1/Ref-1 PCR product was successfully amplified from the captured gastric epithelial cells but not from the no-RT controls (Fig. 1). Nongastric monocyte-like THP-1 cells were used as a positive control. Constitutive expression of APE-1/Ref-1 in the AGS gastric epithelial cell line was similarly confirmed (data not shown). These studies indicate that the APE-1/Ref-1 gene is expressed by AGS cells and in situ by the normal human gastric epithelium.


Figure 1
View larger version (6K):
[in this window]
[in a new window]
 
FIGURE 1. Native human gastric epithelial cells express APE-1/Ref-1 in situ. Gastric epithelial cells were excised by laser capture microdissection from human gastric antral mucosal biopsy specimens. RT-PCR confirmed the constitutive expression of APE-1/Ref-1 mRNA in the cDNA samples from the two H. pylori-negative subjects and in cDNA prepared from THP-1 cells.

 
Silencing of APE-1/Ref-1 using RNA interference

To investigate whether APE-1/Ref-1 modulates gastric epithelial cell responses to H. pylori, we aimed to silence APE-1/Ref-1 expression by transfecting siRNA duplexes for APE-1/Ref-1 into AGS cells. The scrambled siRNA duplex was used as a negative control. After 48 h, APE-1/Ref-1 mRNA expression was significantly inhibited by >90% in cells transfected with APE-1/Ref-1 siRNA as compared with mock-transfected (transfection reagent alone) or scrambled siRNA-transfected cells (Fig. 2A), and APE-1/Ref-1 mRNA was inhibited by 75% 72 h posttransfection (data not shown). siRNA-mediated silencing of APE-1/Ref-1 was also confirmed by Western blotting (Fig. 2, B and C). The scrambled siRNA did not affect APE-1/Ref-1 expression (Fig. 2B), whereas the APE-1/Ref-1 siRNA significantly inhibited APE-1/Ref-1 protein by 38 or 60% 48 or 72 h posttransfection, respectively, compared with scrambled siRNA-transfected cells (Fig. 2C). However, at later time points siRNA activity decreased and APE-1/Ref-1 protein returned to constitutive levels (data not shown). In subsequent studies to assess the functional effect of APE-1/Ref-1 silencing on gastric epithelial cell responses to infection, AGS cells were infected with H. pylori 26695 48 h after transfection, when the silencing of APE-1/Ref-1 mRNA was optimal. Transfection with APE-1/Ref-1 siRNA did not affect beta-actin protein expression (Fig. 2B) or beta-actin or GAPDH mRNA expression (data not shown), demonstrating the target specificity of the APE-1/Ref-1 siRNA.


Figure 2
View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 2. Confirmation of siRNA-mediated silencing of APE-1/Ref-1 in AGS cells. A, A significant inhibition of APE-1/Ref-1 mRNA expression was observed 48 h posttransfection in uninfected AGS cells transfected with APE-1/Ref-1 siRNA. Data are expressed as levels of normalized APE-1/Ref-1 mRNA expression (mean ± SEM) relative to APE-1/Ref-1 mRNA expression in uninfected mock-transfected cells (n = 4). *, p < 0.05 vs transfection with reagent alone (mock transfected) or scrambled siRNA. B, A representative Western blot demonstrating inhibition of the APE-1/Ref-1 protein in cells transfected with APE-1/Ref-1 siRNA 72 h posttransfection as compared with mock-transfected or scrambled siRNA-transfected cells. Reprobing with a beta-actin Ab verified equal loading and confirmed that APE-1/Ref-1 siRNA did not affect beta-actin expression. C, The graph represents the results of densitometric analysis of immunoblots from four separate experiments and depicts normalized APE-1/Ref-1 protein expression (mean ± SEM) in cells transfected with scrambled or APE-1/Ref-1 siRNA as a percentage of mock-transfected cells 48 and 72 h posttransfection. APE-1/Ref-1 siRNA significantly inhibited APE-1/Ref-1 protein expression at each time point. *, p < 0.05 vs scrambled siRNA-transfected cells.

 
Silencing of APE-1/Ref-1 inhibits H. pylori-induced transcription factor activation

APE-1/Ref-1 is known to reductively regulate AP-1 and NF-{kappa}B DNA-binding activity (22, 49). Using EMSAs we examined whether infection with H. pylori increased activation of these transcription factors in AGS cells and, subsequently, whether transcription factor activation was affected by APE-1/Ref-1 gene silencing. High basal AP-1 DNA-binding activity was observed in uninfected nontransfected AGS cells, and a time-dependent enhanced binding of AP-1 was observed in cells infected with cag PAI-bearing H. pylori 26695, but not its cag-negative isogenic mutant (Fig. 3A). In supershift assays, the H. pylori 26695-activated AP-1 band was shifted with both anti-c-Fos and anti-c-Jun Abs, but not with an isotype control (Fig. 3B), demonstrating that in AGS cells H. pylori 26695 induces an AP-1 heterodimer composed of c-Fos and c-Jun. In cells with silenced APE-1/Ref-1 expression, both basal and H. pylori-induced AP-1 DNA-binding activity were markedly inhibited as compared to cells with basal levels of APE-1/Ref-1 (Fig. 3C).


Figure 3
View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 3. Silencing of APE-1/Ref-1 inhibits basal and H. pylori-induced AP-1 DNA-binding activity. AGS cells were infected with H. pylori for 1 or 2 h as indicated and uninfected cells served as controls. A nuclear extract was used to bind to a radiolabeled AP-1 probe. A, A representative EMSA autoradiogram demonstrating that, in nontransfected cells, H. pylori 26695 but not H. pylori 8-1 induced a time-dependent enhanced activation of AP-1 as compared with uninfected cells. B, A representative autoradiogram from a supershift assay. Nuclear extracts from AGS cells infected with H. pylori 26695 for 2 h were used in the EMSA in the absence of Ab or in the presence of anti-c-Fos Ab, anti-c-Jun Ab, or preimmune rabbit serum (isotype control) as indicated. C, A representative EMSA autoradiogram showing AP-1 activation in nontransfected (Non-transf.) or APE-1/Ref-1 siRNA-transfected (siRNA-transf.) cells infected for 2 h with H. pylori 26695. The specificity of the shifted AP-1 complex was demonstrated using an excess of unlabeled NF-{kappa}B or AP-1 oligonucleotides.

 
Control AGS cell extracts contained little nuclear NF-{kappa}B binding activity, but infection with H. pylori 26695 markedly increased NF-{kappa}B binding activity within 30 min, although binding was not further increased after 1 h (Fig. 4A). At the same time points, a smaller increase in NF-{kappa}B binding was observed following infection with H. pylori 8-1 (Fig. 4A). In supershift assays, the H. pylori 26695-induced NF-{kappa}B complex was completely shifted with anti-p50 Ab (Fig. 4B). However, no supershift was evident with anti-c-Rel Ab or an isotype control. In contrast, a small partial shift of the complex was consistently observed with anti-p65 Ab. This finding suggests that in AGS cells H. pylori 26695 rapidly induces NF-{kappa}B complexes composed of p50/p65 heterodimers or p50/p50 homodimers. The little nuclear NF-{kappa}B binding activity that was detected in control nontransfected cells was almost completely abolished in untreated cells transfected with APE-1/Ref-1 siRNA, and H. pylori 26695-induced NF-{kappa}B DNA binding was also inhibited in cells with silenced APE-1/Ref-1 expression as compared with H. pylori-infected nontransfected cells (Fig. 4C). These data demonstrate that the silencing of APE-1/Ref-1 inhibits transcription factor activation in gastric epithelial cells at baseline and following infection with H. pylori, indicating that APE-1/Ref-1 plays a role in the regulation of AP-1 and NF-{kappa}B DNA-binding activity in these cells.


Figure 4
View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 4. Silencing of APE-1/Ref-1 inhibits basal and H. pylori-induced NF-{kappa}B DNA-binding activity. AGS cells were infected with H. pylori for 30 min or 1 h as indicated, and uninfected cells served as controls. Nuclear extract was incubated with a radiolabeled NF-{kappa}B probe. A, A representative EMSA autoradiogram showing that H. pylori 26695 and, to a lesser extent, H. pylori 8-1 increased NF-{kappa}B DNA-binding activity in nontransfected cells as compared with uninfected controls. B, A representative autoradiogram from a supershift assay. Nuclear extracts from AGS cells infected with H. pylori 26695 for 1 h were used in the EMSA in the absence of Ab or in the presence of anti-p50, anti-p65, or anti-c-Rel Abs or preimmune rabbit serum (isotype control), as indicated. The specificity of the NF-{kappa}B complex was determined using an excess of unlabeled AP-1 or NF-{kappa}B oligonucleotides. C, A representative EMSA autoradiogram showing NF-{kappa}B activation in nontransfected (Non-transf.) or APE-1/Ref-1 siRNA-transfected (siRNA-transf.) AGS cells infected for 1 h with H. pylori 26695. Cold NF-{kappa}B or AP-1 oligonucleotides confirmed specific NF-{kappa}B DNA binding.

 
Silencing of APE-1/Ref-1 does not inhibit nuclear accumulation of H. pylori-induced transcription factors

The above results confirm that APE-1/Ref-1 affects the DNA-binding activity of transcription factors, but we wondered whether APE-/Ref-1 also influences the nuclear accumulation of these transcription factors. To examine this question, we performed Western blotting of nuclear extracts from APE-1/Ref-1 siRNA- or siControl RNA-transfected AGS cells that were then H. pylori-infected or left uninfected using Abs to c-Jun, c-Fos, p50, and p65. As shown in the representative blots in Fig. 5, siRNA treatment did not affect the nuclear accumulation of H. pylori-stimulated expression of these transcription factors. As expected, H. pylori infection increased the expression of APE-1/Ref-1in both the nuclear and total cellular extracts.


Figure 5
View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 5. APE-1/Ref-1 silencing does not affect H. pylori-induced nuclear expression of NF-{kappa}B and AP-1 transcription factors. Nontransfected (lanes 1 and 4), control siRNA-transfected (lanes 2 and 5), or APE-1/Ref-1 siRNA-transfected (lanes 3 and 6) AGS cells were infected with H. pylori for 1 or 2 h or left uninfected. After harvesting, nuclear extracts were prepared and 8 µg of protein was analyzed by SDS-PAGE immunoblotting for NF-{kappa}B p50, p65, c-Jun, and c-Fos. APE-1/Ref-1 levels were assessed in nuclear and total cellular extracts. The data shown are representative of four separate experiments.

 
APE-1/Ref-1 is required for H. pylori-induced IL-8 secretion

The production of IL-8 protein in supernatants from H. pylori-infected or uninfected AGS cells was examined 3 h postinfection. In the absence of serum, IL-8 was not detected in supernatants from uninfected cells. Infection with cag PAI-bearing H. pylori 26695 or LC-11 significantly increased IL-8 secretion, whereas formalin-killed H. pylori 26695, H. pylori 26695-derived sonicate, or H. pylori 8-1 did not stimulate IL-8 (Fig. 6A). This finding demonstrates that H. pylori-induced IL-8 was dependent on viable cag PAI-bearing H. pylori.


Figure 6
View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 6. APE-1/Ref-1 siRNA-mediated inhibition of H. pylori-induced IL-8 expression in gastric epithelial cells. A, The supernatants of AGS cells infected at 300:1 with one of three H. pylori strains, formalin (F)-killed H. pylori 26695, or 10 µg/ml H. pylori 26695-derived sonicates for 3 h were assayed for IL-8, and the results are expressed as picogram per milliliter of IL-8. Live cag PAI-bearing H. pylori stimulated a significant increase in IL-8. *, p < 0.05 vs uninfected cells. formalin-killed H. pylori 26695, H. pylori cell sonicates, or the cag PAI-negative strain did not stimulate IL-8 secretion. B, Mock-transfected or APE-1/Ref-1 siRNA-transfected AGS cells were infected with H. pylori 26695 and IL-8 mRNA expression was determined after 1 h. The graph depicts the percentage of normalized IL-8 mRNA expression. H. pylori-induced IL-8 mRNA was significantly inhibited in APE-1/Ref-1 siRNA-transfected cells. *, p < 0.05 vs H. pylori-infected mock-transfected cells. C, AGS cells were infected 48 h after siRNA transfection with H. pylori 26695 for 3 h, the supernatants were assayed for IL-8, and results are expressed as picograms of IL-8 per milligram of total protein concentration. In cells transfected with APE-1/Ref-1 siRNA, H. pylori 26695-induced IL-8 protein was significantly inhibited. *, p < 0.05 vs H. pylori-infected mock-transfected cells. All data represent the mean ± SEM of three to five separate experiments.

 
We next examined whether APE-1/Ref-1 gene silencing affected IL-8 expression in H. pylori 26695-infected AGS cells 48 h after transfection. A significant increase in IL-8 mRNA expression was detected in AGS cells infected with H. pylori 26695 for 1 h as compared with uninfected cells, and the H. pylori-induced IL-8 mRNA was significantly inhibited (>60%) in cells transfected with APE-1/Ref-1 siRNA as compared with H. pylori-infected mock-transfected cells (Fig. 6B). Furthermore, in cells with silenced APE-1/Ref-1 expression the H. pylori-induced IL-8 protein was significantly inhibited by >55% as compared with H. pylori-infected mock-transfected cells (Fig. 6C). This effect was specific to the APE-1/Ref-1 siRNA, as the levels of the IL-8 protein secreted by cells transfected with scrambled siRNA (416.9 ± 134 pg of IL-8 per milligram of total protein) in response to H. pylori were not significantly different from those secreted by infected mock-transfected cells (590.4 ± 80.8 pg of IL-8 per milligram of total protein). These data implicate APE-1/Ref-1 as an important molecule in the modulation of H. pylori-induced IL-8 expression in gastric epithelial cells.

APE-1/Ref-1 also plays a role in the expression of other H. pylori-induced chemokines

Although IL-8 is the most widely reported chemokine to be induced in gastric epithelial cells during H. pylori infection in vitro and in vivo, other chemokines have been shown to be up-regulated by infection (50, 51). To determine whether APE-1/Ref-1 played a role in the expression of other gastric epithelial chemokines, RT-PCR was performed on cells treated with APE-1/Ref-1 siRNA or siControl RNA and then infected with H. pylori or left uninfected. Chemokine expression in siControl RNA-transfected cells was not significantly different from that in nontransfected cells (data not shown) and, thus, only data from APE-1/Ref-1 siRNA- and siControl RNA-transfected cells are included in Table I. As shown in Table I, siRNA for APE-1/Ref-1 reduced the H. pylori-stimulated mRNA expression of IL-8, MIP-3{alpha}, and GRO-{alpha}, although the effect on GRO-{alpha} was not statistically significant. H. pylori infection had no significant effect on ENA-78 mRNA and, thus, the effect of silencing of APE-1/Ref-1 could not be evaluated for this chemokine with very low level mRNA expression (data not shown).


View this table:
[in this window]
[in a new window]
 
Table I. APE-1/Ref-1 suppresses H. pylori-induced chemokine mRNA expressiona

 
H. pylori-induced IL-8 promoter activation

To examine the effects of H. pylori on IL-8 gene transcription, AGS cells were transiently transfected with luciferase-linked 5'-deletion constructs of the human IL-8 promoter (Fig. 7A). In cells with basal levels of APE-1/Ref-1 bearing the –1498/+44 hIL-8/Luc plasmid, infection with H. pylori 26695 or LC-11 for 3 h significantly increased IL-8 luciferase activity by >6-fold as compared with uninfected cells (Fig. 7B). In contrast, formalin-killed H. pylori 26695, H. pylori 26695-derived sonicates, or H. pylori 8-1 did not augment IL-8 promoter activity (Fig. 7B). In cells transfected with –54/+44 hIL-8/Luc, the deletion of the IL-8 promoter to –54 bp completely abolished H. pylori 26695-induced IL-8 luciferase activity (Fig. 7C). Together, these data demonstrate that the region of the IL-8 promoter from –1498 bp to –54 bp contains regulatory elements that are essential for the stimulation of IL-8 gene transcription by live cag PAI-bearing H. pylori.


Figure 7
View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 7. H. pylori-induced IL-8 gene transcription in AGS cells. A, Schematic representation of the luciferase-linked 5'-deletion constructs of the human IL-8 promoter used in this study. B, AGS cells transfected with the –1498/+44 hIL-8/Luc construct were infected at 300:1 with one of three H. pylori strains, formalin (f)-killed H. pylori 26695, or 10 µg/ml H. pylori 26695-derived sonicates for 3 h. In cells transfected with the –1498/+44 hIL-8/Luc construct, only live H. pylori 26695 or LC-11 significantly increased IL-8 transcription. *, p < 0.05 vs uninfected cells. C, AGS cells were transfected with the –1498/+44 or –54/+44 hIL-8/Luc constructs and infected for 3 h at 300:1 with H. pylori 26695. The bacteria significantly increased IL-8 transcription (*, p < 0.05 vs uninfected cells) only in cells bearing the –1498/+44 hIL-8/Luc construct. All data are expressed as fold induction of normalized IL-8 luciferase activity (mean ± SEM) relative to uninfected cells (n = 3).

 
APE-1/Ref-1 is involved in IL-8 promoter activation

We next evaluated the involvement of APE-1/Ref-1 in IL-8 gene activation by cotransfecting AGS cells with –1498/+44 hIL-8/Luc and pFLAG-APE-1 cDNA3.1 to overexpress APE1/Ref-1. Real-time RT-PCR confirmed the overexpression of APE-1/Ref-1 in cells cotransfected with pFLAG-APE-1 cDNA3.1 (Fig. 8A). In uninfected cells, the overexpression of APE-1/Ref-1 significantly increased IL-8 luciferase activity by 5-fold compared with cells with basal levels of APE-1/Ref-1 (Fig. 8B). In addition, the 5-fold increase in IL-8 luciferase activity induced by H. pylori in cells with basal levels of APE-1/Ref-1 was further enhanced (9-fold) in APE-1/Ref-1-overexpressing cells (Fig. 8B). These data further implicate APE-1/Ref-1 in the regulation of IL-8 gene activation in gastric epithelial cells under basal conditions and following infection with H. pylori.


Figure 8
View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 8. APE-1/Ref-1 is involved in IL-8 promoter activation. A, Increased levels of APE-1/Ref-1 mRNA were detected in pFLAG-APE-1 cDNA3.1-transfected cells compared with nontransfected cells. B, AGS cells transfected with –1498/+44 hIL-8/Luc alone or cotransfected with pFLAG-APE-1 cDNA3.1 were infected with H. pylori 26695 for 3 h. The overexpression of APE-1/Ref-1 significantly increased IL-8 luciferase activity in uninfected cells, and the IL-8 luciferase activity induced by H. pylori at baseline was significantly enhanced in APE-1/Ref-1 overexpressing cells following infection. *, p < 0.05 vs uninfected cells with constitutive levels of APE-1/Ref-1. C, AGS cells transfected with one of the site-mutated plasmids of the –162/+44 hIL-8/Luc construct were infected with H. pylori 26695 for 3 h. In cells bearing the –162/+44 hIL-8/Luc plasmid, H. pylori significantly stimulated IL-8 gene transcription, and mutation of the AP-1 or NF-{kappa}B binding sites significantly decreased H. pylori-induced IL-8 promoter activity (*, p < 0.05). D, AGS cells cotransfected with one of the site-mutated plasmids of the –162/+44 hIL-8/Luc construct and pFLAG-APE-1 cDNA3.1 were infected with H. pylori 26695 for 3 h. In APE-1/Ref-1-overexpressing cells, H. pylori significantly increased the IL-8 luciferase activity of the –162/+44 hIL-8/Luc plasmid and mutation of the AP-1 or NF-{kappa}B binding sites significantly reduced luciferase activity. *, p < 0.05 vs IL-8 luciferase activity in uninfected cells with basal levels of APE-1/Ref-1. All data in B–D represent the relative IL-8 luciferase activity (mean ± SEM) of each respective plasmid as compared to control cells with constitutive levels of APE-1/Ref-1 (n = 3).

 
Although the overexpression of APE-1/Ref-1 significantly increased IL-8 luciferase activity in untreated cells, IL-8 protein remained undetectable in the untreated cells regardless of APE-1/Ref-1 levels. IL-8 protein levels in H. pylori-infected APE-1/Ref-1 overexpressing cells were not significantly different from infected cells with basal levels of APE-1/Ref-1. In infected cells transfected with –1498IL-8/Luc alone the IL-8 protein levels were 758.26 ± 158 pg/ml, and in infected cells transfected with –1498IL-8Luc + FLAG-APE-1 the levels were 572.6 ± 106 pg/ml (n = 4). IL-8 protein was measured after 3 h in the supernatants of the cells that were lysed for the luciferase assay, so it is possible that the measurements were taken before this enhanced transcriptional activity would have translated into increased protein expression.

To better establish the relative role of APE-1/Ref-1-regulated transcription factors in IL-8 transcription, we determined the effect of site-directed mutations of the AP-1 or NF-{kappa}B sites on inducible promoter activity in AGS cells with basal or overexpressed levels of APE-1/Ref-1. The constructs bearing site-directed mutations of the AP-1 or NF-{kappa}B binding sites were prepared from the –162/+44 hIL-8/Luc plasmid. In cells with basal levels of APE-1/Ref-1, infection with H. pylori 26695 significantly elevated the luciferase activity of the –162/+44 hIL-8/Luc plasmid by 13-fold as compared with uninfected cells (Fig. 8C). Mutation of the AP-1 binding site almost halved H. pylori 26695-induced luciferase activity, whereas mutation of the NF-{kappa}B binding site completely abrogated it (Fig. 8C). This result indicates that although both binding sites contribute to optimal IL-8 promoter induction following H. pylori infection, the NF-{kappa}B binding site is more critical for H. pylori-induced IL-8 gene transcription in cells with normal levels of APE-1/Ref-1.

In APE-1/Ref-1-overexpressing cells, stimulation with H. pylori 26695 increased by >200-fold the luciferase activity of the parent –162/+44 hIL-8/Luc plasmid as compared to uninfected cells with basal levels of APE-1/Ref-1 (Fig. 8D). In APE-1/Ref-1 overexpressing cells, mutation of the AP-1 binding site significantly abrogated H. pylori-induced luciferase activity (9-fold decrease) as compared with the parent construct, and mutation of the NF-{kappa}B binding site significantly reduced this activity by a further 5-fold (Fig. 8D). These results suggest that APE-1/Ref-1 overexpression affects NF-{kappa}B and AP-1 regulatory activity, indicating that both of these elements act synergistically for maximal transcriptional induction of IL-8 following H. pylori infection. However, in APE-1/Ref-1 overexpressing cells the relative involvement of AP-1 in inducible IL-8 promoter activation is more important than in cells that express constitutive levels of APE-1/Ref-1.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
APE-1/Ref-1 exhibits mutually exclusive transcription factor activating and DNA repair functions (20, 22) that are essential for mammalian cell survival (52). The DNA-binding activity of AP-1 and NF-{kappa}B are mediated by APE-1/Ref-1 through redox-dependent mechanisms involving the reduction of cysteine residues in these transcription factors (22, 49). Using APE-1/Ref-1 silencing techniques, we showed that APE-1/Ref-1-dependent transcription factor activation occurs in gastric epithelial cells. Furthermore, basal NF-{kappa}B DNA-binding activity was abolished and H. pylori-induced NF-{kappa}B activation was inhibited following APE-1/Ref-1 silencing. The APE-1/Ref-1 dependent effect was evident when using the strain bearing the cag PAI (H. pylori 26695). Although the cag PAI-deficient strain H. pylori 8-1 stimulated a small increase in NF-{kappa}B activation as compared with uninfected cells, this response was markedly less than that induced by H. pylori 26695. Furthermore, studies by others have also shown a marginal increase in NF-{kappa}B activation by isogenic mutants bearing mutations of specific cag genes (53, 54).

Silencing of APE-1/Ref-1 did not affect nuclear accumulation of p50 or p65 proteins after H. pylori treatment, further delineating the role APE-1/Ref-1 plays in the activation of NF-{kappa}B. To our knowledge, a role for APE-1/Ref-1 in NF-{kappa}B activation following an infectious stimulus has not been reported previously. The observed incomplete inhibition of H. pylori-induced NF-{kappa}B DNA-binding activity may be due to the persistence of some APE-1/Ref-1 in the cells. As an alternative explanation, APE-1/Ref-1 has been reported to play dual and opposing roles in the regulation of NF-{kappa}B activation (55, 56). APE-1/Ref-1 and thioredoxin may act independently and synergistically to promote NF-{kappa}B DNA binding (23). Thus, some degree of H. pylori-induced NF-{kappa}B activation may still occur in the absence of APE-1/Ref-1.

In cells with silenced APE-1/Ref-1 expression, we detected decreased AP-1 DNA binding at baseline and a significant inhibition of H. pylori-induced AP-1 DNA-binding activity. These findings are in agreement with a study in heat-shocked rodent fibroblasts and HeLa cells, where residual AP-1 DNA binding remained following APE-1/Ref-1 immunodepletion, indicating that APE-1/Ref-1 regulates inducible AP-1 binding (57). Conversely, in a study of whole rat embryo cultures, both basal and oxidative stress-induced AP-1 DNA binding were eliminated in the absence of APE-1/Ref-1, suggesting an absolute requirement for APE-1/Ref-1 for AP-1 translational activation (58). However, this discrepancy may be attributed to developmental regulation in the embryonic model. Moreover, c-Jun itself plays a central role in activating the APE-1/Ref-1 promoter while simultaneously being a target of redox regulation by APE-1/Ref-1 (22). Other studies have shown that inhibition of APE-1/Ref-1 using immunodepletion or anti-sense techniques diminished both basal and mitogen-induced or oxidative stress-induced AP-1 DNA binding (22, 58, 59). The corollary was also true in that augmented APE-1/Ref-1 expression increased AP-1 and NF-{kappa}B DNA-binding activity at baseline and in response to oxidative stimuli (27, 55). In the current study, the silencing of APE-1/Ref-1 did not affect nuclear accumulation of c-Jun or c-Fos proteins after H. pylori treatment. Taken together, our data implicate a functional role for APE-1/Ref-1 in H. pylori-induced transcription factor activation in gastric epithelial cells.

The current study demonstrates that the silencing of APE-1/Ref-1 significantly inhibited H. pylori-induced IL-8 mRNA and protein expression in AGS cells, whereas the overexpression of APE-1/Ref-1 augmented both basal and H. pylori-induced IL-8 promoter activity. The effect of inhibiting APE-1/Ref-1 was not unique to IL-8, as both MIP-3{alpha} and GRO-{alpha} mRNA expression was also reduced after siRNA treatment. These observations are consistent with other approaches showing that APE-1/Ref-1 regulates IL-4 and IL-6 production in mast cells to some stimuli (60). However, the present data go on to show that in the absence of APE-1/Ref-1, AP-1 and NF-{kappa}B are not reductively activated and, thus, cannot bind to the IL-8 promoter. In contrast, APE-1/Ref-1 overexpression favors increased reductive activation of these transcription factors, resulting in enhanced binding and increased IL-8 promoter activity. Indeed, the site-directed mutation experiments demonstrated that the overexpression of APE-1/Ref-1 affected AP-1 and NF-{kappa}B regulatory activity. In APE-1/Ref-1-overexpressing cells, the relative involvement of AP-1 in H. pylori–induced IL-8 promoter activity was significantly greater than in cells with basal levels of APE-1/Ref-1. Nevertheless, synergism between AP-1 and NF-{kappa}B is required for optimal IL-8 promoter activation in cells with basal or overexpressed levels of APE-1/Ref-1 as described previously (13, 14, 16, 17).

Studies have shown that AP-1 and NF-{kappa}B are redox-responsive elements (12) and that the generation of ROS by H. pylori (29) may trigger their activation in gastric epithelial cells. Furthermore, APE-1/Ref-1 itself is regulated by ROS and other environmental stimuli (25, 26, 28, 61), and it has been suggested that the induction of IL-8 and other chemokines by H. pylori is redox sensitive and may depend on ROS-mediated activation of NF-{kappa}B and AP-1 in gastric epithelial cells (17). Interestingly, an APE-1/Ref-1-like gene has been associated with gastric cancer (35) and H. pylori itself has been implicated in gastric carcinogenesis (2, 62). Taken together, we believe that APE-1/Ref-1 plays a unique role in sensing oxidative stress and coordinating molecular events ranging from DNA repair and transcription factor regulation. Considering these previous findings and those of the present study, future studies may help to elucidate an involvement of APE-1/Ref-1 in some of the key events that can lead to chronic inflammation or to the development of gastric cancer.

In summary, our data demonstrate a novel role for APE-1/Ref-1 in H. pylori-induced AP-1 and NF-{kappa}B DNA-binding activity and the subsequent IL-8 production by gastric epithelial cells. Collectively, the data demonstrate an important role for APE-1/Ref-1 in the regulation of gastric epithelial cell responses to H. pylori infection, thereby elucidating a novel mechanism controlling transcription and gene expression in bacterial pathogenesis.


    Acknowledgment
 
We thank Elizabeth Wiznerowicz for her technical assistance.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants RO1 DK61769-01 (to S.E.C.), RO1 ES 08457 (to S.M.), RO1 DK51677 (to P.B.E.), and R21 AI48173 (to P.B.E.). Support from the Immunology and Cell Isolation Core of the University of Virginia Digestive Health Center (National Institutes of Health Grant DK67629) is gratefully acknowledged. K.G.-E.S. was supported by the Canadian Association of Gastroenterology. Back

2 Address correspondence and reprint requests to Dr. Sheila E. Crowe, Department of Internal Medicine, University of Virginia, Post Office Box 800708, Charlottesville, VA 22908-0708. E-mail address: scrowe{at}virginia.edu Back

3 Abbreviations used in this paper: PAI, pathogenicity island; APE-1/Ref-1, apurinic/apyrimidinic endonuclease-1/redox factor-1; ROS, reactive oxygen species; CT, critical threshold; HPRT, hypoxanthine phosphoribosyltransferase; siRNA, small interfering RNA. Back

Received for publication June 19, 2006. Accepted for publication September 25, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Peterson, W. L.. 1991. Helicobacter pylori and peptic ulcer disease. N. Engl. J. Med. 324: 1043-1048. [Medline]
  2. Uemura, N., S. Okamoto, S. Yamamoto, N. Matsumura, S. Yamaguchi, M. Yamakido, K. Taniyama, N. Sasaki, R. J. Schlemper. 2001. Helicobacter pylori infection and the development of gastric cancer. N. Engl. J. Med. 345: 784-789. [Abstract/Free Full Text]
  3. Ernst, P. B., D. A. Peura, S. E. Crowe. 2006. The translation of Helicobacter pylori basic research to patient care. Gastroenterology 130: 188-206. [Medline]
  4. Blaser, M. J., J. C. Atherton. 2004. Helicobacter pylori persistence: biology and disease. J. Clin. Invest. 113: 321-333. [Medline]
  5. Yoshida, N., D. N. Granger, D. J. Evans, Jr, D. G. Evans, D. Y. Graham, D. C. Anderson, R. E. Wolf, P. R. Kvietys. 1993. Mechanisms involved in Helicobacter pylori-induced inflammation. Gastroenterology 105: 1432-1440.
  6. Yamaoka, Y., M. Kita, T. Kodama, N. Sawai, K. Kashima, J. Imanishi. 1997. Induction of various cytokines and development of severe mucosal inflammation by cagA gene positive Helicobacter pylori strains. Gut 41: 442-451. [Abstract/Free Full Text]
  7. Mooney, C., J. Keenan, D. Munster, I. Wilson, R. Allardyce, P. Bagshaw, B. Chapman, V. Chadwick. 1991. Neutrophil activation by Helicobacter pylori. Gut 32: 853-854. [Abstract/Free Full Text]
  8. Crowe, S. E., L. Alvarez, P. M. Sherman, Y. Jin, M. Dytoc, R. H. Hunt, J. Patel, M. J. Muller, P. B. Ernst. 1995. Expression of interleukin-8 and CD54 by human gastric epithelium after H. pylori infection in vitro. Gastroenterology 108: 65-74. [Medline]
  9. Sharma, S. A., M. K. R. Tummuru, G. G. Miller, M. J. Blaser. 1995. Interleukin-8 response of gastric epithelial cell lines to Helicobacter pylori stimulation in vitro. Infect. Immun. 63: 1681-1687. [Abstract]
  10. Crabtree, J. E., A. Covacci, S. M. Farmery, Z. Xiang, D. S. Tompkins, S. Perry, I. J. D. Lindley, R. Rappuoli. 1995. Helicobacter pylori induced interleukin-8 expression in gastric epithelial cells is associated with CagA positive phenotype. J. Clin. Pathol. 48: 41-45. [Abstract/Free Full Text]
  11. Peek, R. M., Jr, G. G. Miller, K. T. Tham, G. I. Perez-Perez, X. Zhao, J. C. Atherton, M. J. Blaser. 1995. Heightened inflammatory response and cytokine expression in vivo to cagA+ Helicobacter pylori strains. Lab. Invest. 71: 760-770.
  12. Roebuck, K. A.. 1999. Regulation of interleukin-8 gene expression. J. Interferon Cytokine Res. 19: 429-438. [Medline]
  13. Keates, S., Y. S. Hitti, M. Upton, C. P. Kelly. 1997. Helicobacter pylori infection activates NF-{kappa}B in gastric epithelial cells. Gastroenterology 113: 1099-1109. [Medline]
  14. Sharma, S. A., M. K. Tummuru, M. J. Blaser, L. D. Kerr. 1998. Activation of IL-8 gene expression by Helicobacter pylori is regulated by transcription factor nuclear factor-{kappa}B in gastric epithelial cells. J. Immunol. 160: 2401-2407. [Abstract/Free Full Text]
  15. Naumann, M., S. Wessler, C. Bartsch, B. Wieland, A. Covacci, R. Haas, T. F. Meyer. 1999. Activation of activator protein 1 and stress response kinases in epithelial cells colonized by Helicobacter pylori encoding the cag pathogenicity island. J. Biol. Chem. 274: 31655-31662. [Abstract/Free Full Text]
  16. Aihara, M., D. Tsuchimoto, H. Takizawa, A. Azuma, H. Wakebe, Y. Ohmoto, K. Imagawa, M. Kikuchi, N. Mukaida, K. Matsushima. 1997. Mechanisms involved in Helicobacter pylori-induced interleukin-8 production by a gastric cancer cell line, MKN45. Infect. Immun. 65: 3218-3224. [Abstract]
  17. Chu, S. H., H. Kim, J. Y. Seo, J. W. Lim, N. Mukaida, K. H. Kim. 2003. Role of NF-{kappa}B and AP-1 on Helicobater pylori-induced IL-8 expression in AGS cells. Dig. Dis. Sci. 48: 257-265. [Medline]
  18. Davies, G. R., N. J. Simmonds, T. R. J. Stevens, M. T. Sheaff, N. Banatvala, I. F. Laurenson, D. R. Blake, D. S. Rampton. 1994. Helicobacter pylori stimulates antral mucosal reactive oxygen metabolite production in vivo. Gut 35: 179-174. [Abstract/Free Full Text]
  19. Shimada, T., N. Watanabe, H. Hiraishi, A. Terano. 1999. Redox regulation of interleukin-8 expression in MKN28 cells. Dig. Dis. Sci. 44: 266-273. [Medline]
  20. Izumi, T., T. K. Hazra, I. Boldogh, A. E. Tomkinson, M. S. Park, S. Ikeda, S. Mitra. 2000. Requirement for human AP endonuclease 1 for repair of 3'-blocking damage at DNA single-strand breaks induced by reactive oxygen species. Carcinogenesis 21: 1329-1334. [Abstract/Free Full Text]
  21. Xanthoudakis, S., R. J. Smeyne, J. D. Wallace, T. Curran. 1996. The redox DNA repair protein, Ref-1, is essential for early embryonic development in mice. Proc. Natl. Acad. Sci. USA 93: 8919-8923. [Abstract/Free Full Text]
  22. Xanthoudakis, S., G. Miao, F. Wang, Y.-C. E. Pan, T. Curran. 1992. Redox activation of Fos-Jun DNA binding activity is mediated by a DNA repair enzyme. EMBO J. 11: 3323-3335. [Medline]
  23. Evans, A. R., M. Limp-Foster, M. R. Kelley. 2000. Going APE over ref-1. Mutat. Res. 461: 83-108. [Medline]
  24. Pines, A., L. Perrone, N. Bivi, M. Romanello, G. Damante, M. Gulisano, M. R. Kelley, F. Quadrifoglio, G. Tell. 2005. Activation of APE1/Ref-1 is dependent on reactive oxygen species generated after purinergic receptor stimulation by ATP. Nucleic Acids Res. 33: 4379-4394. [Abstract/Free Full Text]
  25. Ramana, C. V., I. Boldogh, T. Izumi, S. Mitra. 1998. Activation of apurinic/apyrimidinic endonuclease in human cells by reactive oxygen species and its correlation with their adaptive response to genotoxicity of free radicals. Proc. Natl. Acad. Sci. USA 95: 5061-5066. [Abstract/Free Full Text]
  26. Grosch, S., G. Fritz, B. Kaina. 1998. Apurinic endonuclease (Ref-1) is induced in mammalian cells by oxidative stress and involved in clastogenic adaptation. Cancer Res. 58: 4410-4416. [Abstract/Free Full Text]
  27. Flaherty, D. M., M. M. Monick, A. B. Carter, M. W. Peterson, G. W. Hunninghake. 2002. Oxidant-mediated increases in redox factor-1 nuclear protein and activator protein-1 DNA binding in asbestos-treated macrophages. J. Immunol. 168: 5675-5681. [Abstract/Free Full Text]
  28. Frossi, B., G. Tell, P. Spessotto, A. Colombatti, G. Vitale, C. Pucillo. 2002. H2O2 induces translocation of APE/Ref-1 to mitochondria in the Raji B cell line. J. Cell. Physiol. 193: 180-186. [Medline]
  29. Nagata, K., H. Yu, M. Nishikawa, M. Kashiba, A. Nakamura, E. F. Sato, T. Tamura, M. Inoue. 1998. Helicobacter pylori generates superoxide radicals and modulates nitric oxide metabolism. J. Biol. Chem. 273: 14071-14073. [Abstract/Free Full Text]
  30. Bagchi, D., G. Bhattacharya, S. J. Stohs. 1996. Production of reactive oxygen species by gastric cells in association with Helicobacter pylori. Free Radical Res. 24: 439-450. [Medline]
  31. Baik, S.-C., H.-S. Youn, M.-H. Chung, W.-K. Lee, M.-J. Cho, G.-H. Ko, C.-K. Park, H. Kasai, K.-H. Rhee. 1996. Increased oxidative DNA damage in Helicobacter pylori-infected human gastric mucosa. Cancer Res. 56: 1279-1282. [Abstract/Free Full Text]
  32. Ding, S. Z., A. M. O’Hara, T. L. Denning, B. Dirden-Kramer, R. C. Mifflin, V. E. Reyes, K. A. Ryan, S. N. Elliott, T. Izumi, I. Boldogh, et al 2004. Helicobacter pylori and H2O2 increases AP endonuclease-1/redox factor-1 expression in human gastric epithelial cells. Gastroenterology 127: 845-858. [Medline]
  33. Kelley, M. R., L. Cheng, R. Foster, R. Tritt, J. Jiang, J. Broshears, M. Koch. 2001. Elevated and altered expression of the multifunctional DNA base excision repair and redox enzyme APE1/ref-1 in prostate cancer. Clin. Cancer Res. 7: 824-830. [Abstract/Free Full Text]
  34. Moore, D. H., H. Michael, R. Tritt, S. H. Parsons, M. R. Kelley. 2000. Alterations in the expression of the DNA repair/redox enzyme APE/ref-1 in epithelial ovarian cancers. Clin. Cancer Res. 6: 602-609. [Abstract/Free Full Text]
  35. Wang, G. S., M. W. Wang, B. Y. Wu, X. B. Liu, W. D. You, X. Y. Yang. 2003. A gene encoding an apurinic/apyrimidinic endonuclease-like protein is up-regulated in human gastric cancer. World J. Gastroenterol. 9: 1196-1201. [Medline]
  36. Ryan, K. A., M. F. Smith, Jr, M. K. Sanders, P. B. Ernst. 2004. Reactive oxygen and nitrogen species differentially regulate Toll-like receptor 4-mediated activation of NF-{kappa}B and interleukin-8 expression. Infect. Immun. 72: 2123-2130. [Abstract/Free Full Text]
  37. Akopyants, N. S., S. W. Clifton, D. Kersulyte, J. E. Crabtree, B. E. Youree, C. A. Reece, N. O. Burkanov, E. S. Drazek, B. A. Roe, D. E. Berg. 1998. Analyses of the cag pathogenicity island of Helicobacter pylori. Mol. Microbiol. 28: 37-53. [Medline]
  38. Dytoc, M., B. Gold, M. Louie, M. Heusca, L. Fedorko, S. E. Crowe, C. Lingwood, J. Brunton, P. M. Sherman. 1993. Comparison of Helicobacter pylori and attaching-effacing Escherichia coli adhesion to eukaryotic cells. Infect. Immun. 61: 448-456. [Abstract/Free Full Text]
  39. Fan, X. J., S. E. Crowe, S. Behar, H. Gunasena, G. Ye, H. Haeberle, N. Van Houten, W. K. Gourley, P. B. Ernst, V. E. Reyes. 1998. The effect of class II MHC expression on adherence of Helicobacter pylori and induction of apoptosis in gastric epithelial cells: a mechanism for Th1 cell-mediated damage. J. Exp. Med. 187: 1659-1669. [Abstract/Free Full Text]
  40. Wang, J., E. G. Brooks, K. B. Bamford, T. L. Denning, J. Pappo, P. B. Ernst. 2001. Negative selection of T cells by Helicobacter pylori as a model for bacterial strain selection by immune evasion. J. Immunol. 167: 926-934. [Abstract/Free Full Text]
  41. Fan, Z., P. J. Beresford, D. Zhang, Z. Xu, C. D. Novina, A. Yoshida, Y. Pommier, J. Lieberman. 2003. Cleaving the oxidative repair protein Ape1 enhances cell death mediated by granzyme A. Nat. Immunol. 4: 145-153. [Medline]
  42. Smith, M. F., Jr, D. Eidlen, W. P. Arend, A. Gutierrez-Hartmann. 1994. LPS-induced expression of the human IL-1 receptor antagonist gene is controlled by multiple interacting promoter elements. J. Immunol. 153: 3584-3593. [Abstract]
  43. Casola, A., R. P. Garofalo, M. Jamaluddin, S. Vlahopoulos, A. R. Brasier. 2000. Requirement of a novel upstream response element in respiratory syncytial virus-induced IL-8 gene expression. J. Immunol. 164: 5944-5951. [Abstract/Free Full Text]
  44. Brasier, A. R., M. Jamaluddin, A. Casola, W. Duan, Q. Shen, R. P. Garofalo. 1998. A promoter recruitment mechanism for tumor necrosis factor-{alpha}-induced interleukin-8 transcription in type II pulmonary epithelial cells. Dependence on nuclear abundance of Rel A, NF-{kappa}B1, and c-Rel transcription factors. J. Biol. Chem. 273: 3551-3561. [Abstract/Free Full Text]
  45. Garofalo, R., M. Sabry, M. Jamaluddin, R. Yu, A. Casola, P. Ogra, A. Brasier. 1996. Transcriptional activation of the interleukin-8 gene by respiratory syncytial virus infection in alveolar epithelial cells: nuclear translocation of the RelA transcription factor as a mechanism producing airway mucosal inflammation. J. Virol. 70: 8773-8781. [Abstract]
  46. Osborne, S. A., K. F. Tonissen. 2002. pRL-TK induction can cause misinterpretation of gene promoter activity. BioTechniques 33: 1240-1242. [Medline]
  47. Huszar, T., I. Mucsi, T. Terebessy, A. Masszi, S. Adamko, C. Jeney, L. Rosivall. 2001. The use of a second reporter plasmid as an internal standard to normalize luciferase activity in transient transfection experiments may lead to a systematic error. <