The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Crandall, H.
Right arrow Articles by Weis, J. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Crandall, H.
Right arrow Articles by Weis, J. J.
Right arrowPubmed/NCBI databases
*GEO DataSet
Medline Plus Health Information
*Lyme Disease
The Journal of Immunology, 2006, 177: 7930-7942.
Copyright © 2006 by The American Association of Immunologists, Inc.

Gene Expression Profiling Reveals Unique Pathways Associated with Differential Severity of Lyme Arthritis1

Hillary Crandall*, Diane M. Dunn{dagger}, Ying Ma*, R. Mark Wooten{ddagger}, James F. Zachary§, John H. Weis*, Robert B. Weiss{dagger} and Janis J. Weis2,*

* Department of Pathology, and {dagger} Department of Human Genetics, University of Utah, Salt Lake City, Utah 84112; {ddagger} Department of Medical Microbiology and Immunology, Medical University of Ohio, Toledo, Ohio 43614; and § Department of Pathobiology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61802


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The murine model of Lyme disease provides a unique opportunity to study the localized host response to similar stimulus, Borrelia burgdorferi, in the joints of mice destined to develop severe arthritis (C3H) or mild disease (C57BL/6). Pathways associated with the response to infection and the development of Lyme arthritis were identified by global gene expression patterns using oligonucleotide microarrays. A robust induction of IFN-responsive genes was observed in severely arthritic C3H mice at 1 wk of infection, which was absent from mildly arthritic C57BL/6 mice. In contrast, infected C57BL/6 mice displayed a novel expression profile characterized by genes involved in epidermal differentiation and wound repair, which were decreased in the joints of C3H mice. These expression patterns were associated with disease state rather than inherent differences between C3H and C57BL/6 mice, because C57BL/6-IL-10–/– mice infected with B. burgdorferi develop more severe arthritis than C57BL/6 mice and displayed an early gene expression profile similar to C3H mice. Gene expression profiles at 2 and 4 wk postinfection revealed a common response of all strains that was likely to be important for the host defense to B. burgdorferi and mediated by NF-{kappa}B-dependent signaling. The gene expression profiles identified in this study add to the current understanding of the host response to B. burgdorferi and identify two novel pathways that may be involved in regulating the severity of Lyme arthritis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Lyme disease is a multisystem disorder caused by infection with the tick-borne spirochete Borrelia burgdorferi (1). Signs of infection include a bull’s-eye rash at the site of the tick bite, termed erythema migrans, followed by dissemination of bacteria to various tissues resulting in neurological abnormalities, myocarditis, and arthritis (2). Lyme arthritis occurs in ~60% of individuals not treated with antibiotics at the time of the tick bite, is associated with the presence of B. burgdorferi in joint tissue, and resolves with successful antibiotic treatment (3, 4). A small percentage of individuals with subacute arthritis progress to a chronic treatment-resistant arthritis that is no longer associated with bacteria in joint tissue and is postulated to be autoimmune-mediated (5, 6).

Infection-associated Lyme arthritis has been studied in the mouse, where arthritis develops 3–4 wk following intradermal inoculation and is histopathologically similar to Lyme arthritis in humans (7, 8). The severity of arthritis is genetically regulated, with C3H mice developing severe arthritis whereas C57BL/6 mice develop mild to moderate disease (8, 9). Although this difference is not dependent on MHC alleles, it has been linked to quantitative trait loci (QTL)3 on chromosomes 1, 4, 5, 11, and 12 (10, 11). Interestingly, infected C3H and C57BL/6 mice harbor similar numbers of bacteria in joint tissues, indicating that differences in arthritis severity are not due to differences in host defense, but rather reflect different abilities to regulate the localized inflammatory response (9). B. burgdorferi lipoprotein interaction with TLR2 results in the production of proinflammatory cytokines and chemokines, several of which have been implicated in modulating the development of arthritis (12, 13, 14, 15). Furthermore, C57BL/6 mice lacking the potent anti-inflammatory cytokine IL-10 (C57BL/6 IL-10–/–) develop more severe arthritis than wild-type C57BL/6 mice while more effectively controlling bacterial growth (16, 17, 18).

The mouse model of Lyme arthritis provides a unique opportunity to study contrasting responses to similar bacterial stimuli in mice developing severe or mild arthritis (8, 9, 19). Localized responses to B. burgdorferi were assessed by global gene expression analysis in whole joint tissue from C3H, C57BL/6, and C57BL/6-IL-10–/– mice during the progression of disease development. This analysis revealed the activation of two unexpected and divergent pathways in response to infection in mice destined to develop arthritis of different severities, and suggested that an early commitment to a gene expression phenotype in infected joint tissue could determine the severity of subsequent Lyme arthritis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice

Female C3H/HeNCr (C3H) and C57BL/6NCr (C57BL/6) mice were obtained from the National Cancer Institute, whereas female B6.129P2-IL-10tm1Cgn/J (C57BL/6-IL-10–/–) mice on the closely related C57BL/6J mouse were obtained from The Jackson Laboratory. Mice were housed in the Animal Resource Center at the University of Utah Health Science Center according to the guidelines of the National Institutes of Health for the care and use of laboratory animals.

B. burgdorferi culture and infection

Mice were infected by intradermal injection at 6 wk of age with 2 x 103 B. burgdorferi clone N40 (provided by S. Barthold, University of California, Davis, CA) that had been cultured for 4 days in Barbour-Stoenner-Kelly II medium containing 6% rabbit serum (Sigma-Aldrich).

Assessment of infection status and arthritis severity

Infection of mice was confirmed by culture of spirochetes from bladders, production of B. burgdorferi-specific Abs, and detection of B. burgdorferi recA in ear tissues by quantitative PCR (7, 20). Ankle swelling was used as a relative indicator of arthritis development in the actual tissue collected for microarray analysis and was determined from measurements made of the rear ankle joints with a metric caliper. Increases in ankle measurement were similar to those in previous studies, where complete histological assessment of arthritis severity was performed (9, 16).

Isolation of RNA

Total RNA was isolated from tissues and cells using acid guanidine extraction (21). Skin was removed from the rear ankles, and tissue extending ~5 mm in each direction was collected from infected and control mice at the indicated times. Joint tissues were flash frozen and homogenized in cold acid guanidine using an Ultra-Turrax disperser (IKA Works), and RNA was separated by cesium chloride cushion centrifugation. RNA was recovered by ethanol precipitation and applied to a RNeasy kit (Qiagen).

Gene expression analysis

Equal amounts of total RNA from the more swollen ankle of five individual mice of each genotype from each time point were pooled into a single sample that was prepared for Affymetrix array hybridization according to the manufacturer’s instructions (Affymetrix) (22). cDNA was synthesized from 8 µg of total RNA and biotin-labeled using the One-Cycle Target Labeling Kit (Affymetrix). Each sample was hybridized to triplicate GeneChip arrays; either GeneChip Mouse Expression Array 430A (C3H/HeN) or GeneChip Mouse Genome 430 2.0 Array (C57BL/6 and C57BL/6 IL-10–/–) (Affymetrix) depending on availability, and then stained and washed in the Affymetrix Fluidics Station 450 with program EukGE-WS2v4. Arrays were scanned with either the GeneArray 2500 Scanner (C3H/HeN) or GeneChip Scanner 3000 (C57BL/6 and C57BL/6 IL-10–/–) laser confocal slide scanner. Data from all GeneChips were preprocessed using the affy and gcRMA (Robust Multiarray Average) packages in R (23, 24, 25). Statistical analysis was performed using significance analysis of microarrays (SAM), and data were filtered based on a significant p value (p < 0.05 as determined by SAM) (26). Transcripts with changes meeting significant p values were filtered based on fold change, and those with a change of 2-fold or greater were considered differentially expressed, whereas other transcripts were considered not changed (NC). The function of gene products was primarily determined with the National Cancer Institute/Center for Information Technology microarray database (NCI/CIT mAdb, <http://www.cit.nih.gov/home.asp>) and with Gene Ontology annotations according to Mouse Genome Informatics (27). In some cases, gene function was inferred based on the function of orthologous genes and/or phenotype of other gene family members as determined from public databases such as Ensembl and Mouse Genome Informatics (27, 28). Microarray data from this manuscript may be accessed at the GEO database <http://www.ncbi.nlm.nih.gov/geo/> under accession no. GSE6055.

Real-time quantitative RT-PCR

RT-RCR on 5 µg of total RNA was performed using random primers and M-MLV Reverse Transcriptase (Invitrogen Life Technologies). Quantitative PCR was performed using LightCycler SYBRPlus MasterMix on the LightCycler (Roche Applied Science). The oligonucleotide primers used to detect beta-actin were bactin.F (forward) (5'-GTAACAATGCCATGTTCAAT-3') and bactin.R (reverse) (5'-CTCCATCGTGGGCCGCTCTAG-3'); Cxcl13 were cxcl13.F (5'- -3') and cxcl13.R (5'- -3'); Elovl4 were elovl4.F (5'-TACTATGGGCTGACTGCGTTCG-3') and elovl4.R (5'-GACTGCTTCGGCTCATTGTATGTC-3'); Flg were flg.F (5'-CAATGAAGACTGGGAGGCA AGC-3') and flg.R (5'-TGACTGGAGATGGTTTGGAGTGG-3'); Hrnr were hrnr.F (5'-GCAACAAGATGCCTAAACTCCTGG-3') and hrnr.R (5'-GCTGGTGACTGTGATTTTTCTGC-3'); Igtp were igtp.F (5'-TAGAGCAGACCCACAGAGTTCAGG-3') and igtp.R (5'-CAGCAGTCATAGATTTAGACCACGG-3'); Iigp1 were iigp1.F (5'-GTAGTGTGCTCAATGTTGCTGTCAC-3') and iigp1.R (5'-TACCTCCACCACCCCAGTTTTAGC-3'); Il1b were il1b.F (5'-TCCCAAGCAATACCCAAAGAGAA-3') and il1b.R (5'-TGGGGAAGGCATTAGAAACAGTC-3'); Irf7 were irf7.F (5'-TGTGACCCTCAACACCCTAATACC-3') and irf7.R (5'-CAATAGCCAGTCTCCAAACAGCAC-3'); Mmp3 were mmp3.F (5'-TTGTGTGCTCATCCTACCCATTG-3') and mmp3.R (5'-TTCCTCCATTTTGGCGAACC-3'); and Stat1 were stat1.F (5'-CGTGGGAACGGAAGCATTTG-3') and stat1.R (5'-ACGAGACATCATAGGCAGCGTG-3'). Primers for B. burgdorferi 16S rRNA were 5'GGTCAAGACTGACGCTGAGTCA and 5'GGCGGTCCACTTAACACGTTAG, as described previously (29).

Design of microarray experiment

Gene expression profiling using Affymetrix GeneChip microarrays was performed during the development of arthritis of differing severities in C3H, C57BL/6, and C57BL/6-IL-10–/– mice infected with B. burgdorferi. Expression profiles in joint tissues were determined at 1, 2, and 4 wk of infection, and compared with mock-infected mice, age matched with the 1-wk time point. Previous studies indicated that by 1 wk of infection, B. burgdorferi had spread to the joint tissue, but that inflammatory cell infiltrate was not yet detectable, thus providing an opportunity to capture the early response of endogenous cells of the joint tissue to invading bacteria (4, 7). By 2 wk of infection, bacterial number was at its greatest and there was robust inflammatory cell infiltrate, whereas the 4-wk time point was designed to coincide with the peak of arthritis development in C3H mice (4, 7). Expression profiles were performed on C57BL/6-IL-10–/– mice, which develop more severe arthritis than C57BL/6 mice, to help identify changes in gene expression that are common to the development of arthritis (16).

Because technical and biological variation were expected, RNA was isolated from the joint tissue of five mice at each time point and pooled before microarray analysis, which was performed in triplicate (30). Results were confirmed for selected transcripts by quantitative RT-PCR with the individual samples used to generate the pool, as well as confirmation of selected transcripts from individual animals infected in a second experiment.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Overview of gene expression profiles

B. burgdorferi infection of C3H, C57BL/6, and C57BL/6-IL-10–/– mice was followed over time, with measurements of rear ankle swelling taken as an approximation of the progression of arthritis in the actual joint tissues pooled for microarray analysis (Fig. 1A). Although ankle measurements provide a limited assessment of arthritis, the results reported in Fig 1A are similar to those in our previous report that included histological assessment of arthritis development in C57BL/6-IL-10–/– mice (16). To gain an approximation of B. burgdorferi levels in the individual ankle tissues collected for microarray analysis, we performed RT-PCR using primers for the flaB gene and for 16S rRNA of Borrelia (29, 31). Results were similar with the two primer sets and are shown for the more sensitive 16S rRNA (Fig. 1B). Similar levels of 16S rRNA were present in ankle tissues from C3H and C57BL/6 mice at 1 and 2 wk of infection, whereas at 4 wk of infection 16S rRNA levels were greater in C57BL/6 than C3H joint tissues. 16S rRNA was not detected in samples from uninfected mice, and levels of 16S rRNA were much lower at all time points in C57BL/6-IL-10–/– mice than in either wild type, consistent with previous reports using quantitative PCR detection of DNA in tissues (16).


Figure 1
View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 1. Gene expression profiles as they relate to arthritis development. A, Ankle swelling was determined for each infected and uninfected mouse as tissues were collected for expression analysis, as described in Materials and Methods. B, RT-PCR with primers for Borrelia 16S rRNA was performed on the individual RNA samples used for microarray to estimate relative levels of B. burgdorferi in tissues. Values for C3H and C57BL/6 mice were not significantly different at 1 and 2 wk of infection, whereas the difference at 4 wk was significant (p < 0.05, Student’s t test). Differences between C57BL/6 and IL-10–/– mice were significant at 2 and 4 wk of infection. C, Lines representative of gene expression reflect the average fold change of five genes selected from the IFN-responsive profile (Igtp, Iigp2, Iigp1, Tgtp, and Ifi1) and the epidermal differentiation profile (D) (Flg, Krt2–1, Hrnr, Sprr1b, and Lor.

 
Affymetrix GeneChip array analysis revealed alterations in expression of discrete subsets of genes in RNA collected from the joint tissue of infected mice. At 1 wk of infection, transcripts from 156 genes were increased by >2-fold in C3H mice, whereas in C57BL/6 mice 119 transcripts were increased; this result is based on the 22,000 unique transcripts included on GeneChip 430A of the mouse (Table I). Interestingly, there were only three transcripts changed by >2-fold that were common to C3H and C57BL/6 mice at 1 wk of infection (Figs. 2, 3A). Tissue from infected C57BL/6-IL-10–/– mice revealed 419 gene transcripts increased at 1 wk of infection and displayed clear overlap with those increased in C3H mice (Fig. 3A). At 2 wk postinfection, significant recruitment of leukocytes to joint tissues is evident by histological analysis (7, 9), which was supported by the increase in a large number of genes in all three strains of mice associated with host defense and inflammatory cell infiltrate (Fig. 3B). The 4-wk postinfection time point represents the peak of arthritis as well as full development of the adaptive immune response, consistent with the identification of a group of genes induced only at this late time point. The number of genes changed at 4 wk was less than at 2 wk in both C3H and C57BL/6 mice, possibly reflecting resolution of infection and inflammatory response (Table I and Fig. 3C). In contrast, C57BL/6 IL-10–/– mice displayed an exaggerated and uncontrolled response to infection, with the number of genes changed >2-fold still increasing at the 4-wk time point. This is consistent with the potent ability of IL-10 to regulate acute inflammatory processes (Table I) (32).


View this table:
[in this window]
[in a new window]
 
Table I. Number of unique gene transcripts changed >2-fold in the joints of C3H, C57BL/6, and C57BL/6 IL-10–/– mice at 1, 2, and 4 wk postinfectiona

 

Figure 2
View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 2. Distinct gene expression profiles at 1 wk postinfection in C3H/HeN and C57BL/6 mice. Of the 100 most highly increased transcripts in C3H mice, 67 were related to the IFN response, whereas 75 of the 100 most increased transcripts in C57BL/6 mice were related to epidermal differentiation and wound repair. Only 2 of the 100 most highly increased transcripts were shared in the two mouse strains, Saa3 and Ccl12.

 

Figure 3
View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 3. The number of transcripts changed >2-fold in the joint tissue of C3H/HeN, C57BL/6, and C57BL/6 IL-10–/– mice at 1 wk (A), 2 wk (B), and 4 wk (C) postinfection. The number of nonredundant transcripts with significant p values and changes >2-fold were detected by microarray analysis as described in Materials and Methods, with arrows indicating induction or reduction relative to joint tissue from uninfected mice. Transcripts with changed values that were shared among strains are placed within the appropriate common areas of the Venn diagrams.

 
B. burgdorferi infection induces an early proinflammatory response in arthritis-susceptible C3H mice

At 1 wk of infection, C3H mice displayed a robust induction of genes indicative of a strong proinflammatory response by endogenous cells. In particular, the most highly increased genes were those known to be inducible by type I (IFN-{alpha} and IFN-beta) and/or type II (IFN-{gamma}) IFN (Table II). In fact, 36% (56 of 156) of the genes induced >2-fold in C3H mice were clearly annotated as IFN responsive, and 67 of the 100 most highly induced genes were either IFN responsive or could be linked to the induction and regulation of IFN responses (Fig. 2 and Supplement 1)4 (27). Additional genes increased in C3H mice could be indirectly linked to IFN by their role in regulation and development of the immune response, such as Parp14, Bst2, and Nfil3 (Table II). The genes of the C3H profile were highly induced, up to 120-fold compared with uninfected joint tissue. It is difficult to assign responsibility for this robust IFN response because changes were not detected in either type I or type II IFN transcripts in C3H or C57BL/6 mice at any time, and most of the genes listed in Table II can be induced by either type I or type II IFN (including the highly induced Iigp1, Gbp1, and Tap1 (27, 33)). The increased transcript levels for the signaling molecules Stat1, Irf1, Irf7, and Irf8 also did not provide strong evidence for the selective presence of type I or type II IFN (Table II) (33).


View this table:
[in this window]
[in a new window]
 
Table II. Expression levels of selected IFN-responsive gene transcripts increased at 1 wk postinfection in joints tissue of C3H micea

 
In striking contrast, none of the IFN-inducible gene transcripts was increased >2-fold at 1 wk postinfection in the ankle joints of C57BL/6 mice (Table II and Fig. 2). Although some IFN-inducible transcripts were increased by 2 wk postinfection, the magnitude of change was generally much less than that seen in C3H mice, suggesting that ankle tissues of C57BL/6 mice have a temporally delayed and diminished IFN response to B. burgdorferi infection (Table II, Fig. 1C, and Supplement 2). The association with arthritis was further strengthened by findings with C57BL/6-IL-10–/– mice, which displayed robust induction of many of the IFN-responsive genes characteristic of the expression profile found with severely arthritic C3H mice (Table II, Fig. 3A, and Supplement 3). Although the IFN-induced profile was delayed in IL-10–/– mice, the levels of IFN-inducible genes remained elevated throughout the course of infection rather than returning to baseline as seen with C3H mice (Table II and Fig. 1C) (17, 32). These findings suggest that early production of IFN in the environment of the C3H mouse joint is associated with inflammatory events of arthritis development and that its absence from C57BL/6 mice is protective.

The expression levels of several highly changed transcripts including Iigp1 and Igtp and the signaling molecules Stat1 and Irf7 were assessed in individual mice using quantitative RT-PCR (Fig. 4A–D). The trends of expression observed by microarray analysis were confirmed by RT-PCR for all genes tested, and selected expression patterns were confirmed with samples from a second infection experiment. This result provides important documentation that the microarray analysis reflected the contribution of individual mice rather than the dominant expression of an aberrant sample in the pool and indicate that the robust induction of IFN-responsive genes in joint tissue is a universal feature of the early response of C3H mice to B. burgdorferi infection that is absent in the early response of C57BL/6 mice.


Figure 4
View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 4. Quantification of selected gene transcripts in the joints of individual mice. Expression level of IFN-related transcripts Iigp1 (A), Igtp (B), Stat1 (C), and Irf7 (D); epidermal differentiation-related transcripts Flg (E), Hrnr (F), and Elovl4 (G); transcripts associated with the host defense Cxcl13 (H) and Il1b (I); and a transcript associated with chondrocyte activation Mmp3 (J) were determined using quantitative RT-PCR. Fold change was determined based on the difference between the five individual mice used to generate pooled samples and the average of uninfected controls. In all cases, trends observed by microarray were confirmed by RT-PCR analysis.

 
A novel group of genes is selectively increased in infected C57BL/6 mice

Joint tissue from C57BL/6 mice displayed elevation of an entirely different set of genes than C3H mice at 1 wk postinfection. In fact, of the >100 genes increased at 1 wk postinfection, some up to 40-fold, only two genes were shared with C3H mice, serum amyloid A 3 (Saa3) and the chemokine Ccl12 (Fig. 2). In C57BL/6 mice, a large number (55%; 65 of 119) of transcripts increased >2-fold, and 75 of the 100 most highly induced transcripts at 1 wk postinfection were involved in epidermal differentiation, cell adhesion, and cell-cell interaction or wound repair (Table III and Supplement 2) (27, 34). Increased expression of genes involved in epidermal development was surprising because all skin was removed from the joint tissue before collection, and expression was low in joint tissue collected from uninfected C57BL/6 mice. The increased expression of genes involved in wound repair, such as Krt-2a, and cell-cell interactions, such as Ly6d and Dsp, could be suggestive of a response to disseminating bacteria (35, 36).


View this table:
[in this window]
[in a new window]
 
Table III. Expression levels of selected epidermal differentiation/wound repair-associated gene transcripts increased at 1 wk postinfection in joint tissue of C57BL/6 micea

 
Of note, most of the 119 genes which increased >2-fold at 1 wk postinfection in the joints of C57BL/6 mice were decreased in C3H mice, and comprised a subset of the 401 genes decreased by >2-fold in C3H mice (Figs. 1D and 3A, Table III, and Supplements 1and 2). Seventy-six of the genes with reduced expression in C3H mice were also reduced in C57BL/6 IL-10–/– mice (Table III, Fig. 3A), suggesting that regulation of this response could be related to the inflammatory status of the tissue. Differential expression of this epidermal differentiation/wound repair profile was most evident at 1 wk postinfection; however, elevation in C57BL/6 mice and reduction in C3H and C57BL/6-IL-10–/– mice was maintained at 2 and 4 wk postinfection with B. burgdorferi (Fig. 1D). Interestingly, not all genes induced during epidermal differentiation were altered during B. burgdorferi infection, including Ivl, Ppl, and Sprr2f (Table III) (27).

RT-PCR was used to assess the transcriptional pattern for selected epidermal differentiation/wound repair gene transcripts from Table III, including Flg, Hrnr, and Elovl4. Changes observed by microarray analysis in pooled samples were reproducibly present in the joints of five individual mice comprising the pools for each time point (Fig. 4, E–G) and in tissues from a second infection experiment (data not shown). These data demonstrate that the increased expression of the epidermal transcripts in C57BL/6 mice and reduced expression in C3H and IL-10–/– mice was a feature of the response to B. burgdorferi infection that correlated with the severity of arthritis.

Great care was taken in the removal of skin from the ankle joints used in this study, and histological assessment of many rear ankle tissues prepared in the same manner as for microarray has not revealed differences in the inclusion of skin tissue in the joints of any mouse genotype. To determine whether altered expression of the epidermal profile was a generalized response to infection of the skin or whether it was a response unique to the joint tissue, RT-PCR was performed on RNA prepared from the ears of infected and uninfected mice. Transcript levels for filaggrin were not changed in ear tissue from infected C3H or C57BL/6 mice, suggesting that this differential response to infection was specific for the ankle tissue (data not shown).

B. burgdorferi infection results in expression of genes involved in host defense

In addition to the very distinct gene expression profiles seen early during infection that correlate with arthritis severity, all three strains of mice shared a common response to B. burgdorferi that was evident at 2 and 4 wk postinfection (Fig. 3, B and C). The recruitment of PMNs is a hallmark of Lyme arthritis (8, 15), and by 2 wk of infection modest increases (5-fold) in the PMN-recruiting chemokines Cxcl1, Cxcl2, and Cxcl5 were seen in both C3H and C57BL/6 mice as well as increased levels of PMN gene products such as Mpo, Ncf1, and Ncf4 (Table IV and Supplements 1–3). Additionally, increased transcription of several mononuclear cell-recruiting chemokines, such as Ccl2, Ccl3, Ccl7, and Ccl12, was observed (37). The IFN-responsive T cell-recruiting chemokine Cxcl9 was increased in both C3H and C57BL/6 mice over the course of infection, whereas Cxcl10 was also highly induced in joints of C57BL/6 and C57BL/6-IL-10–/– mice (Table IV) (37). Additional T cell-recruiting chemokines were increased during infection in both C3H and C57BL/6 mice, including Cxcl16, Ccl2, and Ccl7, (37). Transcript levels for the B cell chemokine Cxcl13 were dramatically increased in the joints of both C57BL/6 and C3H mice by 2 wk infection, whereas joints of C57BL/6-IL-10–/– mice displayed a less robust induction of Cxcl13 (Table IV). In fact, Cxcl13 was the only chemokine with greater induction in C57BL/6 mice than in C57BL/6 IL-10–/– mice, an interesting finding in light of the clinical association between Cxcl13 expression and spirochete load in neuroborreliosis (38) and the reduced presence of B. burgdorferi in the joints of IL-10–/– mice (Fig. 1B). Expression profiles for many of the chemokines were confirmed by RT-PCR in individual mice, with the unique profile for Cxcl13 shown in Fig. 4H.


View this table:
[in this window]
[in a new window]
 
Table IV. Expression levels of genes involved in the immune response that are changed >2-folda

 

View this table:
[in this window]
[in a new window]
 
Table IVA. (Continued)

 

View this table:
[in this window]
[in a new window]
 
Table IVB. (Continued)

 
Genes whose expression is associated with host defense were also increased at 2 wk of infection, including additional markers for neutrophils and macrophages, Mpo, Cd14, Tlrs, Fc receptors, and arginase. Complement component C1qa, C1qb, C1qg, C1r, C2, and C3 transcripts were modestly increased in the joints of both C3H and C57BL/6 mice, further suggesting the presence of activated macrophages (Table IV). Transcripts for markers of APCs and Ag-processing machinery, including the MHC, Cd1, Tap1/2, and proteosome subunits indicated the presence of an active acquired host defense in joint tissues at 2 and 4 wk of infection, as did the increased expression of Ig genes (Table IV) (27).

Borrelia and its lipoproteins are known to activate NF-{kappa}B and induce the production of many cytokines including IL-6, IL-1beta, TNF-{alpha}, and IL-12 in vitro (39, 40). Surprisingly, IL-1beta was the only hallmark inflammatory cytokine to be increased in either C3H or C57BL/6 ankle tissue (Table IV and Fig. 4I). In contrast, transcripts for many cytokines were robustly induced at 2 and 4 wk of infection in the IL-10–/– mice (including IL-1b, IFN-{gamma}, IL-6, IL-7, IL15, and TNF family members), indicating that B. burgdorferi does induce these cytokines in the joint but that in the presence of IL-10 their levels are quite low (Table IV and Supplement 3). In fact, RT-PCR, which is much more sensitive than microarray analysis, did reveal the presence of extremely low levels of transcripts for IL-6, TNF, IFN-beta, and IFN-{gamma} in the joint tissues of infected C3H and C57BL/6 mice, with levels below detection in uninfected tissues (data not shown). These results may explain the failure to detect significant changes by microarray. Taken together, they suggest that whereas the contribution of proinflammatory cytokines appears to be tightly controlled in wild-type mice, it is not a dominant feature of the localized response to infection in joint tissue. Interestingly, RT-PCR analysis of spleen samples from infected mice also revealed very low levels of these proinflammatory cytokines and of the IFN-inducible genes Igtp and Iipt (data not shown).

B. burgdorferi infection activates chondrocytes and triggers reactive responses in C3H mice

The most severe manifestation of arthritis in C3H mice includes evidence of reactive processes such as the formation of foci of new chondrocytes and new bone formation at 4 wk of infection (4, 9). Microarray revealed modest increases in gene products associated with chondrocytes from the joints of 4 wk postinfection C3H mice, including several collagen genes, such as Ctsk and Dspg3 (Table V). Quantification of Col1{alpha}2 by RT-PCR demonstrated a range of expression, and in this case only a portion of the individual samples (3 of 5) showed increased expression of this gene late in disease. Future studies will be required to determine whether associations between gene induction and clinical markers of disease can be made. Interesting, many of these genes associated with end-stage arthritis are also induced in rodent models of rheumatoid arthritis (41).


View this table:
[in this window]
[in a new window]
 
Table V. Expression levels of gene transcripts indicative of reactive processes and/or activation of chondrocytes by B. burgdorferia

 
In agreement with findings reported by others (42, 43), transcripts for Mmp3, Mmp9, Mmp13, and Mmp23, as well as tissue inhibitor of matrix metalloproteinase 1 (Timp1) were induced in the joints of C3H mice, whereas transcripts for Mmp3, Mmp8, and Timp1 were increased in C57BL/6-IL-10–/– mice (Table V). Mmp3 expression was also increased in joints of C57BL/6 mice, but to a lesser extent than in C3H or C57BL/6-IL-10–/– mice. Expression profiles of several of the metalloproteinases were confirmed by RT-PCR with individual mice, with results for Mmp3 shown in Fig. 4J.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The murine model of Lyme disease initially developed by Barthold et al. (8) has provided a unique opportunity to study the localized response to a similar infectious challenge in tissues that will ultimately develop distinct severities of arthritis (9, 19). The response to invading bacteria at 1 wk of infection precedes the influx of inflammatory cells and revealed a dramatic difference in the localized response. Although C3H mice displayed a robust response dominated by IFN-inducible transcripts, these transcripts were absent at 1 wk from infected C57BL/6 mice (Table II and Figs. 1 and 2). Instead, the C57BL/6 mouse displayed an increase in an entirely distinct and unexpected group of genes previously associated with epidermal differentiation and wound repair (Table III). The C57BL/6-IL-10–/– mouse shared expression profiles with the C3H mouse, implicating the IFN response in arthritis development rather than in a strain-specific response to infection, and suggesting that suppression of the IFN response in C57BL/6 mice was crucial to suppression of arthritis (Figs. 1 and 3).

A second surprising feature of the early C3H profile was the down-regulation of a large number of genes, many of which were in the same group of epidermal genes that were increased in C57BL/6 mice. More striking was the fact that expression of these genes was also reduced in C57BL/6-IL-10–/– mice, similar to C3H mice, and again arguing that regulation of expression of the epidermal profile was related to the development of inflammatory arthritis, not due to strain-specific differences between C3H and C57BL/6 mice (Table III and Figs. 1 and 3). Expression of several of the epidermal profile genes, including filaggrin, loricrin, and cytokeratins, can be down-regulated by endogenous peptide ligands for nicotinic acetylcholine receptors, providing precedent for reduced expression following signaling pathway activation (44).

It cannot be determined from our results which IFN is responsible for the intense induction of this group of transcripts in C3H mice, or even the possible role of another pleotropic cytokine such as TNF-{alpha} (45). Studies with mice lacking IFN-{gamma} indicate that it is not required for arthritis development (46); however, it is possible that there are compensatory pathways acting in the gene ablation model. Based on the known inflammatory potential of B. burgdorferi, the production of either type I IFN or IFN-{gamma} by the milieu of the joint tissue could certainly occur by 1 wk of infection (17, 47, 48). Alternatively, the early presence the dendritic cell-specific transcript Oasl2 (Table II) in C3H mice may be highly relevant due to the importance of dendritic cells as a sources of type I IFN (49, 50). In clinical trials, treatment with type I IFN has resulted in transient arthritis in patients with multiple sclerosis and hepatitis C infection, providing precedent for involvement of IFN in inflammatory arthritis development (51, 52). Additional experiments will be required to identify the cellular source and identity of the cytokine responsible for the IFN-inducible profile.

Additional experiments will also be required to detail the interplay between the epidermal profile and inflammatory responses. Several published reports provide some insight as to a connection between altered epidermal gene expression profiles in the joints of B. burgdorferi-infected mice and regulation of the inflammatory response. Normal differentiation of the epidermis during development requires the I{kappa}B kinase IKK1 (53), a key component of the classical and alternative NF-{kappa}B-signaling pathways, implicating IKK1 as a common link between regulation of epidermal differentiation genes and inflammation. Additionally, mice with a keratinocyte-specific deletion of the inflammation-associated transcription factor AP-1 displayed altered expression of epidermal differentiation genes and the development of both localized and systemic inflammatory lesions including psoriasis and psoriatic arthritis (54). Because B. burgdorferi achieve high levels in the skin of infected mice, it is also possible that dissemination through the skin promotes increased trafficking of cells that are not normally present in the joint tissue, and that this trafficking influences the overall inflammatory status of the joint (55, 56). Finally, in rheumatoid arthritis, citrullinated proteins such as filaggrin have been identified as targets for autoantibody; however, it is only the citrullinated species that are recognized by rheumatoid arthritis serum, and unmodified filaggrin is actually not expressed in joint tissue (57).

The 2-wk profile revealed unexpected similarities in genes increased in C3H and C57BL/6 mice (Table IV and Fig. 3). Numerous chemokines were induced in both wild-type strains of mice, without correlation with the greater inflammatory cell infiltrate seen in C3H mice (8, 15). In contrast, the robust production of NF-{kappa}B-dependent inflammatory cytokines seen with cultured cells in vitro and during infection of animals and patients was absent from localized response in joint tissues of C3H and C57BL/6 mice (2, 12, 48). The lack of differentially regulated genes downstream of the TLR2, MyD88, and NF-{kappa}B-driven response to B. burgdorferi was unexpected and suggests that activation of this pathway occurs independently from the development and regulation of Lyme arthritis. The possibility that the NF-{kappa}B pathway is a better indicator of the host response to infection rather than a determinant of arthritis severity is consistent with the heightened expression of cytokines and more effective host defense in IL-10–/– mice (Fig. 1B and Table IV). These findings should also be interpreted in light of previous studies with TLR2-deficient mice: these mice harbor high levels of spirochetes in tissues and develop severe arthritis even though isolated cells are defective in production of cytokines in response to B. burgdorferi (58). The lack of differential expression of the NF-{kappa}B-dependent cytokines in B. burgdorferi-infected C3H and C57BL/6 mice is consistent with the observed development of Lyme arthritis in TLR2–/– C3H. The possible implication of type I IFN in arthritic responses is also consistent with Lyme arthritis development in the TLR2–/– mouse, because type I IFN is not a target of TLR2 signaling and its production should proceed normally in the absence of TLR2 (50, 58, 59).

Global gene expression analysis led to the identification of previously unrecognized differences in expression profiles in the joints of C3H and C57BL/6 mice in response to the same stimulus: invading B. burgdorferi. This justifies our strategy of assessing expression in the complex joint tissue and provides new insight into the development of this inflammatory pathology. The differences in gene expression between the arthritis-susceptible (C3H and IL-10–/–) and arthritis-resistant (C57BL/6) strains was evident by 1 wk of infection, suggesting that a very early discriminating event occurs in each strain that determines the outcome of infection. One interpretation of these results is that in the presence of high levels of chemokines, the IFN response of C3H mice promotes leukocytic infiltration resulting in inflammation and arthritis; whereas in C57BL/6 mice, some aspect of the epidermal/wound profile prevents leukocytic infiltration and inflammation, thus limiting arthritis. These early initial events determine the outcome of arthritis severity even in the presence of similarly high levels of bacteria, chemokine production, and proinflammatory cytokine production.

Future investigations will be directed toward a mechanistic understanding of the involvement of these novel pathways in regulation of the development of Lyme arthritis. Additionally, experiments designed to assess the participation of QTL regulating the severity of murine Lyme arthritis in control of these distinct responses may provide further insight into the genetic and biochemical regulation of arthritis development (10, 11).


    Acknowledgments
 
We acknowledge the helpful comments of Liming Yang from the National Institutes of Health, and Joseph Holden, Lorise Gharing, Scott Rogers, and all the members of the Weis laboratory at the University of Utah.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants (AI-32223 to J.J.W. and J.F.Z.; AR-43521 to J.J.W.; AI-24158 to J.H.W.; and HL-072903 to R.B.W.), National Institutes of Health/National Institute of Diabetes and Digestive and Kidney Diseases Training Grant (DK07115 to H.C.), the American Heart Association (Grant 0335148N to R.M.W.), and by funds from Associated Regional University Pathologists. Back

2 Address correspondence and reprint requests to Dr. Janis J. Weis, Department of Pathology, University of Utah School of Medicine, 15 North Medical Drive East, Room 2100, Salt Lake City, Utah 84112-5650. E-mail address: janis.weis{at}path.utah.edu Back

3 Abbreviations used in this paper: QTL, quantitative trait loci; SAM, significance analysis of microarray; F, forward; R, reverse; KO, knockout; NC, not changed; MMP, matrix metalloproteinase; TIMP, tissue inhibitor of MMP. Back

4 The on-line version of this article contains supplemental material. Back

Received for publication June 13, 2006. Accepted for publication September 12, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Burgdorfer, W., A. G. Barbour, S. F. Hayes, J. L. Benach, E. Grunwaldt, J. P. Davis. 1982. Lyme disease: a tick-borne spirochetosis?. Science 216: 1317-1319. [Abstract/Free Full Text]
  2. Steere, A. C., J. Coburn, L. Glickstein. 2004. The emergence of Lyme disease. J. Clin. Invest. 113: 1093-1101. [Medline]
  3. Nocton, J. J., F. Dressler, B. J. Rutledge, P. N. Rys, D. H. Persing, A. C. Steere. 1994. Detection of Borrelia burgdorferi DNA by polymerase chain reaction in synovial fluid from patients with Lyme arthritis. N. Engl. J. Med. 330: 229-234. [Abstract/Free Full Text]
  4. Yang, L., J. H. Weis, E. Eichwald, C. P. Kolbert, D. H. Persing, J. J. Weis. 1994. Heritable susceptibility to severe Borrelia burgdorferi-induced arthritis is dominant and is associated with persistence of large numbers of spirochetes in tissues. Infect. Immun. 62: 492-500. [Abstract/Free Full Text]
  5. Steere, A. C., R. T. Schoen, E. Taylor. 1987. The clinical evolution of Lyme arthritis. Ann. Intern. Med. 107: 725-731. [Abstract/Free Full Text]
  6. Gross, D. M., T. Forsthuber, M. Tary-Lehmann, C. Etling, K. Ito, Z. A. Nagy, J. A. Field, A. C. Steere, B. T. Huber. 1998. Identification of LFA-1 as a candidate autoantigen in treatment-resistant Lyme arthritis. Science 281: 703-706. [Abstract/Free Full Text]
  7. Barthold, S. W., D. H. Persing, A. L. Armstrong, R. A. Peeples. 1991. Kinetics of Borrelia burgdorferi dissemination and evolution of disease after intradermal inoculation of mice. Am. J. Pathol. 139: 263-273. [Abstract]
  8. Barthold, S. W., D. S. Beck, G. M. Hansen, G. A. Terwilliger, K. D. Moody. 1990. Lyme borreliosis in selected strains and ages of laboratory mice. J. Infect. Dis. 162: 133-138. [Medline]
  9. Ma, Y., K. P. Seiler, E. J. Eichwald, J. H. Weis, C. Teuscher, J. J. Weis. 1998. Distinct characteristics of resistance to Borrelia burgdorferi-induced arthritis in C57BL/6N mice. Infect. Immun. 66: 161-168. [Abstract/Free Full Text]
  10. Roper, R. J., J. J. Weis, B. A. McCracken, C. B. Green, Y. Ma, K. S. Weber, D. Fairbairn, R. J. Butterfield, M. R. Potter, J. F. Zachary, et al 2001. Genetic control of susceptibility to experimental Lyme arthritis is polygenic and exhibits consistent linkage to multiple loci on chromosome 5 in four independent mouse crosses. Genes Immun. 2: 388-397. [Medline]
  11. Weis, J. J., B. A. McCracken, Y. Ma, D. Fairbairn, R. J. Roper, T. B. Morrison, J. H. Weis, J. F. Zachary, R. W. Doerge, C. Teuscher. 1999. Identification of quantitative trait loci governing arthritis severity and humoral responses in the murine model of Lyme disease. J. Immunol. 162: 948-956. [Abstract/Free Full Text]
  12. Wooten, R. M., J. J. Weis. 2001. Host-pathogen interactions promoting inflammatory Lyme arthritis: use of mouse models for dissection of disease processes. Curr. Opin. Microbiol. 4: 274-279. [Medline]
  13. Hirschfeld, M., C. J. Kirschning, R. Schwandner, H. Wesche, J. H. Weis, R. M. Wooten, J. J. Weis. 1999. Cutting edge: inflammatory signaling by Borrelia burgdorferi lipoproteins is mediated by Toll-like receptor 2. J. Immunol. 163: 2382-2386. [Abstract/Free Full Text]
  14. Aliprantis, A. O., R. B. Yang, M. R. Mark, S. Suggett, B. Devaux, J. D. Radolf, G. R. Klimpel, P. Godowski, A. Zychlinsky. 1999. Cell activation and apoptosis by bacterial lipoproteins through Toll-like receptor-2. Science 285: 736-739. [Abstract/Free Full Text]
  15. Brown, C. R., V. A. Blaho, C. M. Loiacono. 2003. Susceptibility to experimental Lyme arthritis correlates with KC and monocyte chemoattractant protein-1 production in joints and requires neutrophil recruitment via CXCR2. J. Immunol. 171: 893-901. [Abstract/Free Full Text]
  16. Brown, J. P., J. F. Zachary, C. Teuscher, J. J. Weis, R. M. Wooten. 1999. Dual role of interleukin-10 in murine Lyme disease: regulation of arthritis severity and host defense. Infect. Immun. 67: 5142-5150. [Abstract/Free Full Text]
  17. Ganapamo, F., V. A. Dennis, M. T. Philipp. 2000. Early induction of {gamma} interferon and interleukin-10 production in draining lymph nodes from mice infected with Borrelia burgdorferi. Infect. Immun. 68: 7162-7165. [Abstract/Free Full Text]
  18. Ganapamo, F., V. A. Dennis, M. T. Philipp. 2001. CD19+ cells produce IFN-{gamma} in mice infected with Borrelia burgdorferi. Eur. J. Immunol. 31: 3460-3468. [Medline]
  19. Brown, C. R., S. L. Reiner. 1998. Clearance of Borrelia burgdorferi may not be required for resistance to experimental Lyme arthritis. Infect. Immun. 66: 2065-2071. [Abstract/Free Full Text]
  20. Morrison, T. B., Y. Ma, J. H. Weis, J. J. Weis. 1999. Rapid and sensitive quantification of Borrelia burgdorferi-infected mouse tissues by continuous fluorescent monitoring of PCR. J. Clin. Microbiol. 37: 987-992. [Abstract/Free Full Text]
  21. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, W. J. Rutter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18: 5294-5299. [Medline]
  22. GeneChip Expression Analysis Technical Manual 2005 Affymetrix Incorporated, Santa Clara.
  23. Bolstad, B. M., R. A. Irizarry, M. Astrand, T. P. Speed. 2003. A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 19: 185-193. [Abstract/Free Full Text]
  24. Irizarry, R. A., B. M. Bolstad, F. Collin, L. M. Cope, B. Hobbs, T. P. Speed. 2003. Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res. 31: e15[Abstract/Free Full Text]
  25. Gautier, L., L. Cope, B. M. Bolstad, R. A. Irizarry. 2004. affy: analysis of Affymetrix GeneChip data at the probe level. Bioinformatics 20: 307-315. [Abstract/Free Full Text]
  26. Tusher, V. G., R. Tibshirani, G. Chu. 2001. Significance analysis of microarrays applied to the ionizing radiation response. Proc. Natl. Acad. Sci. USA 98: 5116-5121. [Abstract/Free Full Text]
  27. Eppig, J. T., C. J. Bult, J. A. Kadin, J. E. Richardson, J. A. Blake, A. Anagnostopoulos, R. M. Baldarelli, M. Baya, J. S. Beal, S. M. Bello, et al 2005. The Mouse Genome Database (MGD): from genes to mice: a community resource for mouse biology. Nucleic Acids Res. 33: D471-D475. [Abstract/Free Full Text]
  28. Hubbard, T., D. Andrews, M. Caccamo, G. Cameron, Y. Chen, M. Clamp, L. Clarke, G. Coates, T. Cox, F. Cunningham, et al 2005. Ensembl 2005. Nucleic Acids Res. 33: D447-D453. [Abstract/Free Full Text]
  29. Ornstein, K., A. G. Barbour. 2006. A reverse transcriptase-polymerase chain reaction assay of Borrelia burgdorferi 16S rRNA for highly sensitive quantification of pathogen load in a vector. Vector Borne Zoonotic Dis. 6: 103-112. [Medline]
  30. Kendziorski, C., R. A. Irizarry, K. S. Chen, J. D. Haag, M. N. Gould. 2005. On the utility of pooling biological samples in microarray experiments. Proc. Natl. Acad. Sci. USA 102: 4252-4257. [Abstract/Free Full Text]
  31. Hodzic, E., S. Feng, K. J. Freet, S. W. Barthold. 2003. Borrelia burgdorferi population dynamics and prototype gene expression during infection of immunocompetent and immunodeficient mice. Infect. Immun. 71: 5042-5055. [Abstract/Free Full Text]
  32. Moore, K. W., R. de Waal Malefytqq, R. L. Coffman, A. O’Garra. 2001. Interleukin-10 and the interleukin-10 receptor. Annu. Rev. Immunol. 19: 683-765. [Medline]
  33. Platanias, L. C.. 2005. Mechanisms of type-I- and type-II-interferon-mediated signalling. Nat. Rev. Immunol. 5: 375-386. [Medline]
  34. Mack, J. A., S. Anand, E. V. Maytin. 2005. Proliferation and cornification during development of the mammalian epidermis. Birth Defects Res. C Embryo Today 75: 314-329. [Medline]
  35. Wojcik, S. M., D. S. Bundman, D. R. Roop. 2000. Delayed wound healing in keratin 6a knockout mice. Mol. Cell. Biol. 20: 5248-5255. [Abstract/Free Full Text]
  36. Brakenhoff, R. H., M. Gerretsen, E. M. Knippels, M. van Dijk, H. van Essen, D. O. Weghuis, R. J. Sinke, G. B. Snow, G. A. van Dongen. 1995. The human E48 antigen, highly homologous to the murine Ly-6 antigen ThB, is a GPI-anchored molecule apparently involved in keratinocyte cell-cell adhesion. J. Cell Biol. 129: 1677-1689. [Abstract/Free Full Text]
  37. Esche, C., C. Stellato, L. A. Beck. 2005. Chemokines: key players in innate and adaptive immunity. J. Invest. Dermatol. 125: 615-628. [Medline]
  38. Narayan, K., D. Dail, L. Li, D. Cadavid, S. Amrute, P. Fitzgerald-Bocarsly, A. R. Pachner. 2005. The nervous system as ectopic germinal center: CXCL13 and IgG in Lyme neuroborreliosis. Ann. Neurol. 57: 813-823. [Medline]
  39. Wooten, R. M., V. R. Modur, T. M. McIntyre, J. J. Weis. 1996. Borrelia burgdorferi outer membrane protein A induces nuclear translocation of nuclear factor-{kappa}B and inflammatory activation in human endothelial cells. J. Immunol. 157: 4584-4590. [Abstract]
  40. Sellati, T. J., D. A. Bouis, R. L. Kitchens, R. P. Darveau, J. Pugin, R. J. Ulevitch, S. C. Gangloff, S. M. Goyert, M. V. Norgard, J. D. Radolf. 1998. Treponema pallidum and Borrelia burgdorferi lipoproteins and synthetic lipopeptides activate monocytic cells via a CD14-dependent pathway distinct from that used by lipopolysaccharide. J. Immunol. 160: 5455-5464. [Abstract/Free Full Text]
  41. Ibrahim, S. M., D. Koczan, H. J. Thiesen. 2002. Gene-expression profile of collagen-induced arthritis. J. Autoimmun. 18: 159-167. [Medline]
  42. Behera, A. K., E. Hildebrand, J. Scagliotti, A. C. Steere, L. T. Hu. 2005. Induction of host matrix metalloproteinases by Borrelia burgdorferi differs in human and murine Lyme arthritis. Infect. Immun. 73: 126-134. [Abstract/Free Full Text]
  43. Gebbia, J. A., J. L. Coleman, J. L. Benach. 2001. Borrelia spirochetes upregulate release and activation of matrix metalloproteinase gelatinase B (MMP-9) and collagenase 1 (MMP-1) in human cells. Infect. Immun. 69: 456-462. [Abstract/Free Full Text]
  44. Arredondo, J., A. I. Chernyavsky, D. L. Jolkovsky, R. J. Webber, S. A. Grando. 2006. SLURP-2: a novel cholinergic signaling peptide in human mucocutaneous epithelium. J. Cell. Physiol. 208: 238-245. [Medline]
  45. Gallagher, J., J. Howlin, C. McCarthy, E. P. Murphy, B. Bresnihan, O. FitzGerald, C. Godson, H. R. Brady, F. Martin. 2003. Identification of Naf1/ABIN-1 among TNF-{alpha}-induced expressed genes in human synoviocytes using oligonucleotide microarrays. FEBS Lett. 551: 8-12. [Medline]
  46. Brown, C. R., S. L. Reiner. 1999. Experimental Lyme arthritis in the absence of interleukin-4 or {gamma} interferon. Infect. Immun. 67: 3329-3333. [Abstract/Free Full Text]
  47. Ma, Y., K. P. Seiler, K. F. Tai, L. Yang, M. Woods, J. J. Weis. 1994. Outer surface lipoproteins of Borrelia burgdorferi stimulate nitric oxide production by the cytokine-inducible pathway. Infect. Immun. 62: 3663-3671. [Abstract/Free Full Text]
  48. Kang, I., S. W. Barthold, D. H. Persing, L. K. Bockenstedt. 1997. T-helper-cell cytokines in the early evolution of murine Lyme arthritis. Infect. Immun. 65: 3107-3111. [Abstract]
  49. Tiefenthaler, M., R. Marksteiner, S. Neyer, F. Koch, S. Hofer, G. Schuler, M. Nussenzweig, R. Schneider, C. Heufler. 1999. M1204, a novel 2',5' oligoadenylate synthetase with a ubiquitin-like extension, is induced during maturation of murine dendritic cells. J. Immunol. 163: 760-765. [Abstract/Free Full Text]
  50. Honda, K., H. Yanai, A. Takaoka, T. Taniguchi. 2005. Regulation of the type I IFN induction: a current view. Int. Immunol. 17: 1367-1378. [Abstract/Free Full Text]
  51. Strueby, L., B. Nair, A. Kirk, R. M. Taylor-Gjevre. 2005. Arthritis and bursitis in multiple sclerosis patients treated with interferon-beta. Scand. J. Rheumatol. 34: 485-488. [Medline]
  52. Wilson, L. E., D. Widman, S. H. Dikman, P. D. Gorevic. 2002. Autoimmune disease complicating antiviral therapy for hepatitis C virus infection. Semin. Arthritis Rheum. 32: 163-173. [Medline]
  53. Li, Q., Q. Lu, J. Y. Hwang, D. Buscher, K. F. Lee, J. C. Izpisua-Belmonte, I. M. Verma. 1999. IKK1-deficient mice exhibit abnormal development of skin and skeleton. Genes Dev. 13: 1322-1328. [Abstract/Free Full Text]
  54. Zenz, R., R. Eferl, L. Kenner, L. Florin, L. Hummerich, D. Mehic, H. Scheuch, P. Angel, E. Tschachler, E. F. Wagner. 2005. Psoriasis-like skin disease and arthritis caused by inducible epidermal deletion of Jun proteins. Nature 437: 369-375. [Medline]
  55. Sellati, T. J., S. L. Waldrop, J. C. Salazar, P. R. Bergstresser, L. J. Picker, J. D. Radolf. 2001. The cutaneous response in humans to Treponema pallidum lipoprotein analogues involves cellular elements of both innate and adaptive immunity. J. Immunol. 166: 4131-4140. [Abstract/Free Full Text]
  56. Norgard, M. V., B. S. Riley, J. A. Richardson, J. D. Radolf. 1995. Dermal inflammation elicited by synthetic analogs of Treponema pallidum and Borrelia burgdorferi lipoproteins. Infect. Immun. 63: 1507-1515. [Abstract]
  57. Baeten, D., I. Peene, A. Union, L. Meheus, M. Sebbag, G. Serre, E. M. Veys, F. De Keyser. 2001. Specific presence of intracellular citrullinated proteins in rheumatoid arthritis synovium: relevance to antifilaggrin autoantibodies. Arthritis Rheum. 44: 2255-2262. [Medline]
  58. Wooten, R. M., Y. Ma, R. A. Yoder, J. P. Brown, J. H. Weis, J. F. Zachary, C. J. Kirschning, J. J. Weis. 2002. Toll-like receptor 2 is required for innate, but not acquired, host defense to Borrelia burgdorferi. J. Immunol. 168: 348-355. [Abstract/Free Full Text]
  59. Wang, G., Y. Ma, A. Buyuk, S. McClain, J. J. Weis, I. Schwartz. 2004. Impaired host defense to infection and Toll-like receptor 2-independent killing of Borrelia burgdorferi clinical isolates in TLR2-deficient C3H/HeJ mice. FEMS Microb. Lett. 231: 219-225. [Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
M. M. Petzke, A. Brooks, M. A. Krupna, D. Mordue, and I. Schwartz
Recognition of Borrelia burgdorferi, the Lyme Disease Spirochete, by TLR7 and TLR9 Induces a Type I IFN Response by Human Immune Cells
J. Immunol., October 15, 2009; 183(8): 5279 - 5292.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. A. Blaho, M. W. Buczynski, C. R. Brown, and E. A. Dennis
Lipidomic Analysis of Dynamic Eicosanoid Responses during the Induction and Resolution of Lyme Arthritis
J. Biol. Chem., August 7, 2009; 284(32): 21599 - 21612.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
Y. Ma, J. C. Miller, H. Crandall, E. T. Larsen, D. M. Dunn, R. B. Weiss, M. Subramanian, J. H. Weis, J. F. Zachary, C. Teuscher, et al.
Interval-Specific Congenic Lines Reveal Quantitative Trait Loci with Penetrant Lyme Arthritis Phenotypes on Chromosomes 5, 11, and 12
Infect. Immun., August 1, 2009; 77(8): 3302 - 3311.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. J. Heilpern, W. Wertheim, J. He, G. Perides, R. T. Bronson, and L. T. Hu
Matrix Metalloproteinase 9 Plays a Key Role in Lyme Arthritis but Not in Dissemination of Borrelia burgdorferi
Infect. Immun., July 1, 2009; 77(7): 2643 - 2649.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. C. Miller, Y. Ma, J. Bian, K. C. F. Sheehan, J. F. Zachary, J. H. Weis, R. D. Schreiber, and J. J. Weis
A Critical Role for Type I IFN in Arthritis Development following Borrelia burgdorferi Infection of Mice
J. Immunol., December 15, 2008; 181(12): 8492 - 8503.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
C Eklow, D Makrygiannakis, L Backdahl, L Padyukov, A-K Ulfgren, J C Lorentzen, and V Malmstrom
Cellular distribution of the C-type II lectin dendritic cell immunoreceptor (DCIR) and its expression in the rheumatic joint: identification of a subpopulation of DCIR+ T cells
Ann Rheum Dis, December 1, 2008; 67(12): 1742 - 1749.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Wang, M. M. Petzke, R. Iyer, H. Wu, and I. Schwartz
Pattern of Proinflammatory Cytokine Induction in RAW264.7 Mouse Macrophages Is Identical for Virulent and Attenuated Borrelia burgdorferi
J. Immunol., June 15, 2008; 180(12): 8306 - 8315.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. R. Cruz, M. W. Moore, C. J. La Vake, C. H. Eggers, J. C. Salazar, and J. D. Radolf
Phagocytosis of Borrelia burgdorferi, the Lyme Disease Spirochete, Potentiates Innate Immune Activation and Induces Apoptosis in Human Monocytes
Infect. Immun., January 1, 2008; 76(1): 56 - 70.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Crandall, H.
Right arrow Articles by Weis, J. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Crandall, H.
Right arrow Articles by Weis, J. J.
Right arrowPubmed/NCBI databases
*GEO DataSet
Medline Plus Health Information
*Lyme Disease


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS