The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bergtold, A.
Right arrow Articles by Clynes, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bergtold, A.
Right arrow Articles by Clynes, R.
The Journal of Immunology, 2006, 177: 7287-7295.
Copyright © 2006 by The American Association of Immunologists, Inc.

FcR-Bearing Myeloid Cells Are Responsible for Triggering Murine Lupus Nephritis1

Amy Bergtold*, Anamika Gavhane{dagger}, Vivette D’Agati{ddagger}, Michael Madaio§ and Raphael Clynes2,{dagger}

* Integrated Program in Cellular, Molecular, and Biophysical Studies, {dagger} Department of Microbiology and Medicine, {ddagger} Department of Pathology, Columbia University, College of Physicians and Surgeons, New York, NY 10032; and § Department of Medicine, University of Pennsylvania, School of Medicine, Philadelphia, PA 19104


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Lupus glomerulonephritis is initiated by deposition of IgG-containing immune complexes in renal glomeruli. FcR engagement by immune complexes (IC) is crucial to disease development as uncoupling this pathway in FcR{gamma}–/– abrogates inflammatory responses in (NZB x NZW)F1 mice. To define the roles of FcR-bearing hemopoietic cells and of kidney resident mesangial cells in pathogenesis, (NZB x NZW)F1 bone marrow chimeras were generated. Nephritis developed in (NZB x NZW)F1 mice expressing activating FcRs in hemopoietic cells. Conversely, recipients of FcR{gamma}–/– bone marrow were protected from disease development despite persistent expression of FcR{gamma} in mesangial cell populations. Thus, activating FcRs on circulating hemopoietic cells, rather than on mesangial cells, are required for IC-mediated pathogenesis in (NZB x NZW)F1. Transgenic FcR{gamma}–/– mice expressing FcR{gamma} limited to the CD11b+ monocyte/macrophage compartment developed glomerulonephritis in the anti-glomerular basement disease model, whereas nontransgenic FcR{gamma}–/– mice were completely protected. Thus, direct activation of circulating FcR-bearing myeloid cells, including monocytes/macrophages, by glomerular IC deposits is sufficient to initiate inflammatory responses.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Immune complex (IC)3 deposition in tissue contributes to many autoimmune disease states including systemic vasculitis, arthritis, blistering skin diseases, and glomerulonephritis. Studies of acute murine models of Ab-mediated inflammation in the skin (1, 2, 3, 4), joints (5, 6, 7, 8, 9, 10, 11, 12), lungs (13), kidneys (14, 15, 16, 17, 18, 19), and peritoneum (20, 21) in gene-deficient mice permit the general conclusion that the coordinate expression of activating and inhibitory FcRs on effector cells regulates inflammatory responses. Complement components including C5a contribute directly as chemoattractants and as inducers of preferential up-regulation of activating FcRs on effector cells (20, 22, 23, 24).

The initial events following IC deposition in the tissues include the local activation of complement and the triggering of tissue-resident cells though their Fc and complement receptors. The resultant collective action of locally produced chemokines, cytokines, and small molecule mediators of inflammation activates endothelial cells and promotes the adhesion and diapedesis of activated bloodborne effectors, including monocytes and neutrophils, into the tissue. In this scenario, the recruitment of circulating cellular effectors is expected to occur as a consequence of local activation of resident tissue cells. The importance of resident cells including tissue macrophages and mast cells in the initiation of the inflammatory cascade and subsequent recruitment of circulating neutrophils has been demonstrated in the joints (25, 26, 27) and in Arthus reactions in the lungs (13, 22, 28), peritoneum (21, 29, 30), and skin (3).

In the kidney, the relevant resident cell that would be expected to initiate the inflammatory response to ICs deposited in glomeruli is the mesangial cell (MC). MC activation contributes directly to glomerular pathogenesis through proliferation and collagen deposition and indirectly through the production of the inflammatory mediators (31, 32) cytokines and chemokines (31, 33). Indeed, FcRs are expressed on cultured rodent and human MC (34, 35, 36), and Fc{gamma}R cross-linking on cultured MC induces matrix deposition (34) and the production of inflammatory mediators including chemokines (37, 38) and cytokines (39). Numerous studies have implicated Fc{gamma}R cross-linking on MC as a proximal and key step in IC-mediated nephritis, yet few studies have directly demonstrated mesangial expression of Fc{gamma}R in vivo. Low-level expression of the inhibitory Fc{gamma}RIIB on glomerular cells was detectable by immunohistochemistry (17), but other studies have failed to detect Fc{gamma}R at the RNA level (40). FcR{gamma}–/– mice are protected from the development of nephritis despite IC mesangial deposition (18, 19). However, a requisite inflammatory role of FcRs on MC in vivo remains unclear.

Recent work in the anti-glomerular basement membrane (anti-GBM) model suggests instead that circulating hemopoietic cells directly engage immune deposits in the mesangium, initiating the inflammatory response without prior recruitment by FcR-engaged MC. Transferred wild-type (WT) neutrophils become activated in FcR{gamma}–/– hosts bearing IC mesangial deposits, arguing that acute injury can be initiated by FcR cross-linking-circulating neutrophils (41). In bone marrow (BM) chimeras (42) using FcR{gamma}+/+ and FcR{gamma}–/– donors and recipients, anti-GBM nephritis required FcR-bearing cells in the hemopoietic compartment, suggesting that MC FcR engagement is not necessary for the induction of the IC-mediated inflammatory responses (42). Although these short-term acute models provide important mechanistic insights, the spontaneous nephritis model in (NZB x NZW)F1 mice most closely approximates pathogenetic mechanisms mediating human lupus nephritis. We have addressed the role of FcR{gamma} in intrinsic renal cells or hemopoietic cells in the spontaneous NZB/NZW lupus nephritis model and find that mesangial FcR expression is not required for disease development. Furthermore, we have partially reconstituted anti-GBM nephritis in FcR{gamma}–/– by transgenic expression of FcR{gamma} in the monocyte/macrophage compartment, implicating direct activation of this FcR-bearing cellular subset in the initiation of the inflammatory phase of IC-mediated nephritis. Thus, direct activation of FcR-bearing monocyte/macrophages is sufficient to induce inflammatory responses in response to glomerular IC deposition.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Mice

(NZB x NZW)F1 FcR{gamma}–/– mice were generated from an intercross of NZB FcR{gamma}–/– male and NZW FcR{gamma}–/– female mice (18). To generate BM chimeras, 10 x 106 BM cells obtained from 3-wk-old (NZB x NZW)F1 FcR{gamma}–/– and FcR{gamma}+/+ mice (The Jackson Laboratory) were injected i.v. into the tail vein of lethally irradiated recipients (1000 rad x 1 dose). Chimeric mice were given oral ciprofloxacin in the water ad libitum for 14 days after reconstitution and followed for the development of proteinuria weekly for 9 mo. Proteinuria was read using Urostix for the NZB/NZW mice and scored positive if 2+ measurements (>250 mg/dl) were recorded for two successive readings. A subset of mice was sacrificed at 6 mo for histopathological analysis of the kidney. These studies were reviewed and approved by the Institution Animal Care and Use Committee of Columbia University.

CD11b-{gamma} Tg+ mice were generated after injection of oocytes obtained from FcR{gamma}–/– mice. The transgenic construct was generated by insertion of the murine FcR{gamma} cDNA (550-bp fragment) as an EcoRI fragment (43) into pB203 (a gift from Dr. D. G. Tenen, Harvard Medical School, Boston, MA; see Ref44) containing the 1.7-kb 5'-flanking sequences of the mouse CD11b promoter and the 3'-flanking region from the human growth hormone gene. A NotI/HindIII fragment (containing 5'-CD11bpromoter-FcR{gamma} cDNA-hGH-3') was injected into the oocytes and three founder lines harboring the transgene were further analyzed for expression. Of these three founders, only one (line 14) expressed the FcR{gamma} chain in peritoneal macrophages.

Accelerated anti-GBM nephritis

Mice were immunized with 100 µg of sheep IgG in CFA 3 days before i.v. injection of 150 µl of specific sheep anti-mouse GBM sera. Urine was obtained daily and blood obtained on the day before injection with anti-GBM sera and then at the time of sacrifice 7 days later. Urine samples were diluted in PBS and protein quantified by the Bradford method (Bio-Rad) using an ELISA plate reader at OD570.

Anti-dsDNA and soluble immune complex ELISAs

Diluted serum (1/100) from 6- to 7-mo-old NZB/NZW-{gamma}–/– and NZB/NZW-{gamma}+/+ mice were added to ELISA plates coated with C1q (Sigma-Aldrich) for detection of ICs (45, 46) and to dsDNA-coated plates (United Biotech) for detection of Abs to chromatin. After washing away unbound serum, rat anti-mouse IgG (BD Pharmingen) was added. Alkaline phosphatase-conjugated AKP polyclonal anti-rat IgG (BD Pharmingen) was used as secondary Ab. After incubation with p-nitrophenyl phosphate substrate, the samples were read spectrophotometrically at 405 nm with an ELISA reader (Molecular Devices).

Immunofluorescence and immunohistochemistry

For histological analysis, formalin-fixed sections were stained with H&E or periodic acid-Schiff (PAS). To detect IC deposition, paraformaldehyde- or acetone-fixed cryosections were stained with (1/1000 diluted) FITC goat anti-mouse C3 and IgG (Valeant Pharmaceuticals). To detect FcR{gamma}, a polyclonal anti-FcR{gamma} rabbit IgG (gift from Dr. J. Ravetch, The Rockefeller University) or rat anti-Mac-1 (clone C71/16; BD Pharmingen) followed by rabbit anti-rat IgG Alexa594 (Molecular Probes). Biotinylated goat anti-rabbit IgG, followed by either streptavidin-FITC or streptavidin-HRP was used for detection. A Nikon Eclipse 600 microscope equipped with a RT Spot digital camera was used for imaging.

Renal pathological assessment

PAS sections were prepared from WT, FcR{gamma}–/–, and FcR{gamma}–/– CD11b-{gamma} Tg+ kidneys on day 7 after induction of accelerated glomerulonephritis (five per group). Slides were examined in a blinded fashion by one of us (V. d’A.). Severity of the following seven categories of histological activity were semiquantitatively graded as follows: glomerular fibrinoid necrosis 0–4, endocapillary hypercellularity 0–4, glomerular leukocyte infiltration 0–4, crescents 0–4, tubular degeneration 0–4, casts 0–4, and interstitial inflammation 0–4.The cumulative pathological score is the sum of all seven categories and has a possible range of 0–28.

MC and NK culture

Glomeruli were isolated with successive sieving (47). Kidneys were minced with scissors and tissue fragments were passed through a no. 60 mesh sieve (Fisher Scientific) and then sequentially passed through no. 100 and no. 200 sieves. Glomeruli were digested with 0.1% collagenase type IV (Sigma-Aldrich) and 0.1% trypsin (Invitrogen Life Technologies) for 30 min at 37°C before plating in 24 wells in DMEM/10% FCS. Cells were passaged in D-valine-substituted medium to eliminate fibroblasts. After 2 wk in culture, cells exhibited a stellate morphology and were replated. Immunostains were smooth muscle actin-positive, weakly 2.4G2+ and Mac-1–, confirming their MC origin. RNA was prepared from MCs using TRIzol and cDNA was generated using the cloned avian myeloblastosis virus first-strand synthesis kit according to the manufacturer’s protocol (Invitrogen Life Technologies). Primer sequences for RT-PCR amplification (30 cycles) of FcR{gamma} were as follows: 5'-CCAGGATGATCTCAGCCG-3' and 5'-ACAGTAGAGTAGGGTAAG-3'. These primers amplify a 137-bp band corresponding to exons 1 and 2 of the {gamma} subunit. The band is not amplified in genomic DNA due to intervening intronic sequences. The housekeeping gene, HPRT, was amplified from cDNA using the following primer sequences: 5'-AGCTACTGTAATGATCAGTCAACG-3' and 5'-AGAGGTCCTTTTCACCAGCA-3'. For assessing MC chimerism, genomic DNA was subjected to PCR analysis using the following primer sequences: neo, CTCGTGCTTTACGGTATCGCC; {gamma}-1, ACCCTACTCTACTGTCGACTCAAG; {gamma}-2, and TCACGGCTGGCTATAGCTGCCTT. Annealing temperature was 62°C. Knockout and WT-amplified products were 260 and 224 bp, respectively.

Hemopoietic chimerism was assessed in cultured NK cells obtained after isolation of the adherent cell population from a 14-day culture of nylon wool nonadherent splenocytes grown in IL-2 (10,000 U/ml). Flow cytometric analysis used anti-NK1.1 PE and 2.4G2-FITC (BD Pharmingen). Murine NK cells do not express FcRIIb (48) and thus the anti-FcRII/III mAb (2.4G2) recognizes only FcRIII on these cells.

Western blot analysis of FcR{gamma} expression

Protein extracts were obtained from B cells, T cells, NK cells, and neutrophils were immunoblotted with polyclonal rabbit anti-mouse FcR{gamma} chain IgG and anti-β-actin Abs. Neutrophils were obtained from thioglycolate- elicited peritoneal exudates (4 h after i.p. injection of thioglycolate) after GR-1+ bead selection (Miltenyi Biotec). Adherent peritoneal macrophages were obtained from thioglycolate-elicited exudates (72 h after i.p. injection). B and T cells were obtained from CD43– and CD3+ splenocyte populations, respectively. All cell populations were lysed in TBS buffer that contained 1% Triton X-100, 2 mM EDTA, and complete mini-protease inhibitors (Roche).

Phagocytosis assays

Rabbit IgG-opsonized SRBCs were prepared with subagglutinating quantities of rabbit anti-sheep RBC IgG (MP Biomedicals). After washing away free Ab, IgG-opsonized RBCs were added to adherent macrophages for 1 h at 37°C. Unphagocytosed RBCs were removed by osmotic lysis, and phagocytosis plates were fixed with PBS/0.25% glutaraldehyde before microscopic examination.

Blood albumin and urea nitrogen measurements

Blood samples were read by the Clinical Chemistry Laboratory of the Irving Clinical Research Center at Columbia-Presbyterian Hospital.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
BM chimeric NZB/NZW mice reveal a requirement for FcR{gamma}-expressing hemopoietic cells for nephritis development

(NZB x NZW)F1 female mice develop a uniformly fatal rapidly progressive IC nephritis heralded by the serological appearance of anti-chromatin IgG autoantibodies at 4–6 mo of age. Disease progression is swift, with a median survival of 180 days. However, in (NZB x NZW)F1 FcR {gamma}–/– female mice, IgG autoantibodies occur with equivalent titers and are deposited similarly in the kidney, but induce little subsequent inflammation (18). Disease progression is markedly attenuated with median survival of >400 days with many animals living a normal life span. To distinguish the role of FcR-bearing hemopoietic cells from FcR-bearing renal cell in the development of the effector response in (NZB x NZW)F1 nephritis, BM transplants between FcR{gamma}+/+ and FcR{gamma}–/– mice were performed.

Hemopoietic reconstitution of lethally irradiated recipients was assessed by immunophenotypic analysis of NK populations from representative mice 4 mo postreconstitution. NK populations from WT BM recipients uniformly expressed Fc{gamma}RIII, whereas FcR{gamma}–/– recipients were Fc{gamma}RIII negative, consistent with complete or near-complete hemopoietic reconstitution by donor marrow (Fig. 1A). Glomerular expression of FcR{gamma} was seen in FcR{gamma}–/–->FcR{gamma}+/+ but not in FcR{gamma}+/+-> FcR{gamma}–/– reciprocal chimeric mice, indicating that intrinsic glomerular cells in the kidney, presumably MC, remained recipient derived (Fig. 1B) 4 mo after transplant. As previously seen in nontransplanted NZB/NZW, FcR{gamma} deficiency has little impact on the development of autoantibodies and their glomerular deposition when assessed 6 mo after transplant. All experimental groups developed anti-chromatin autoantibodies and anti-C1q-binding activity (indicative of the presence of circulating ICs and/or anti-C1q autoantibodies (45, 46)) regardless of the FcR{gamma} genotype status of the host or recipient (Fig. 2, A and B). Circulating ICs were deposited in the glomeruli in a similar fashion as assessed by immunofluorescence studies demonstrating equivalent IgG and complement glomerular deposition in all experimental groups (Fig. 2C).


Figure 1
View larger version (88K):
[in this window]
[in a new window]

  		FIGURE 1. (NZB x NZW)F1 BM chimeras show complete donor hemopoietic reconstitution whereas intrinsic renal cells remain recipient derived. A, Six- to 8-wk-old irradiated (1000 cGy) NZB/NZW {gamma}+/+ and {gamma}–/– mice were reconstituted with 5 x 106 BM cells obtained from either NZB/NZW {gamma}+/+ or {gamma}–/– 3-wk-old mice. Hemopoietic reconstitution was assessed by immunophenotyping NK cell populations of mixed chimeras ({gamma}+/+->{gamma}–/– and {gamma}–/–->{gamma}+/+). Murine NK cells express FcRIII as their sole Fc receptor and thus anti-FcRII/III mAb 2.4G2 binding reflects expression of the FcR{gamma}-dependent FcRIII. NK cells were >98% donor derived. B, Frozen renal sections of mice in A were stained with a polyclonal rabbit anti-FcR{gamma} IgG and counterstained with hematoxylin. FcR{gamma} was detected in {gamma}–/–->{gamma}+/+ but not in {gamma}+/+->{gamma}–/– BM chimeras, indicating that intrinsic renal cells remained predominantly recipient-derived 4 mo after BM transfer.

 

Figure 2
View larger version (22K):
[in this window]
[in a new window]

  		FIGURE 2. NZB/NZW BM chimeras develop similar levels of anti-chromatin autoantibodies, circulating IC, and glomerular IC deposition regardless of FcR{gamma} status. A and B, Anti-dsDNA IgG and circulating IC detected in 1/100 dilutions of sera from BM chimeric mice 6 mo after transplant. Anti-chromatin IgG, IgMs, and circulating IC were similar in all groups (ANOVA, p values of 0.404, 0.517, and 0.240, respectively). Notably, however, {gamma}–/–->{gamma}+/+ trended toward higher titers than that of {gamma}+/+->{gamma}–/– (in all cases, except for IgG1 antichromatin, data not shown). C, Immunostains of fixed frozen renal sections using anti-mouse IgG and anti-mouse complement revealed glomerular deposition in both mixed BM chimeras. Representative examples of five mice per group are shown.

 
Although the afferent limb of autoimmunity was intact regardless of the FcR{gamma} genotype, the efferent response required activating FcR-expressing hemopoietic cells. Proteinuria occurred in 90–100% of the NZB/NZW recipients of WT BM regardless of the host genotype, whereas proteinuria occurred in only 10–20% of recipients of NZB/NZW FcR{gamma}–/– marrow (Fig. 3A). Thus, WT hemopoietic cells can transfer disease susceptibility to FcR{gamma}–/– hosts and conversely FcR{gamma}–/– BM-derived cells limit disease development in WT NZB/NZW hosts, indicating that hemopoietic expression of activating FcRs is both necessary and sufficient for the development of nephritis.


Figure 3
View larger version (62K):
[in this window]
[in a new window]

  		FIGURE 3. Lupus nephritis requires activating FcR expression in the hemopoietic compartment but not in renal intrinsic MC. A, Urinary protein measurements were recorded weekly in BM chimeric mice posttransplant. All recipients of FcR{gamma}+/+ BM developed proteinuria by 12 mo posttransplant, regardless of FcR{gamma} genotypic status of the recipient ({gamma}+/+->{gamma}–/– (n = 17); {gamma}+/+ into {gamma}+/+ (n = 10), mean age of onset, respectively, 198 ± 40 days and 186 ± 40 days). Conversely, proteinuria occurred rarely in recipients of FcR{gamma}–/– BM during the 12-mo observation period (3 of 23 {gamma}–/–->{gamma}+/+ mice and in 1 of 10 {gamma}–/–->{gamma}–/– mice]. Two-sided Fisher’s exact {gamma}–/–->{gamma}+/+ vs {gamma}+/+->{gamma}–/–, p = 2.5 x 10–8. B, H&E-stained sections demonstrate glomerulosclerosis and crescent formation in {gamma}+/+->{gamma}–/– and {gamma}+/+->{gamma}+/+ kidneys. Glomerular hypertrophy and end-stage fibrotic changes were consistently found in this group of mice when proteinuria became evident. Histological changes in {gamma}–/–->{gamma}+/+ and {gamma}–/–->{gamma}–/– mice 6 mo posttransplant were minimal and included mesangial thickening but little sclerosis and minimal increased cellularity. C, {gamma}–/–->{gamma}+/+ chimeras: immunofluorescence staining for Mac-1 (red) and FcR{gamma} (green) reveals persistent FcR{gamma} expression and lack of infiltrating Mac-1+ cells in non-nephritic animals at 9 mo posttransplant. Inset, PCR analysis of isolated DNA from MC populations isolated from glomeruli reveal persistence of host FcR{gamma}+ alleles. {gamma}+/+->{gamma}–/–chimeras: infiltrating dual-positive FcR{gamma}+, Mac-1+ cells are seen in nephritic animals at 6 mo posttransplant, consistent with monocyte/macrophage infiltration of glomeruli. Inset, PCR analysis of MC DNA reveals persistence of the disrupted host-derived FcR{gamma} allele in FcR{gamma}–/– recipients. D, Enriched MC cultures were obtained from five chimeric mice and two control nontransplanted C57BL/6 {gamma}+/+ and {gamma}–/– mice are shown. {gamma}–/–->{gamma}+/+ and {gamma}+/+->{gamma}–/– chimeric mice were sacrificed at 9 and 6 mo, respectively. The {gamma}+/+->{gamma}–/– MC PCRs indicate a predominance of host-derived MC, whereas by 9 mo PCR evi dence for replacement by donor-derived sources became more evident.

 
Histological analysis revealed fulminant glomerulonephritis in recipients of WT BM with glomerular hypertrophy, mesangial and endocapillary hypercellularity, neutrophilic and monocytic infiltration, necrosis, crescent formation, and sclerosis (Fig. 3B). In contrast, disease protection was seen in {gamma}–/– BM recipients with histological changes limited to mesangial expansion and mild endocapillary and mesangial hypercellularity.

These data suggest that FcR expression by resident cells of the kidney does not critically contribute to the initiation of the effector response in IC-triggered nephritis. The immunohistochemical analysis of FcR{gamma} expression in Fig. 1 was performed on mice 4 mo posttransplant and before disease onset. To confirm that MC remained genotypically host derived at 6–9 mo, the time point when proteinuria became evident, MC were isolated and additional immunostains were performed (Fig. 3C). In nephritic FcR{gamma}+/+->FcR{gamma}–/– chimeric mice at 6 mo posttransplant, many dual-positive FcR{gamma}+ Mac-1+ cells were present, indicative of infiltrating myeloid lineage cells. In healthy FcR{gamma}–/–->FcR{gamma}+/+ chimeric mice sacrificed 9 mo posttransplant, immunostaining demonstrated persistent glomerular {gamma} expression, presumably in Mac-1– MC. In an additional experimental approach to establish the donor vs host FcR{gamma} status of MC, MC populations were enriched from disrupted glomeruli of chimeric mice at 6 mo posttransplant in nephritic FcR{gamma}+/+->FcR{gamma}–/– mice and at 9 mo from non-nephritic FcR{gamma}–/–->FcR{gamma}+/+ mice and assessed for the presence of WT and knockout FcR{gamma} alleles by genomic PCR. Enriched MC populations exhibited typical stellate morphology and were smooth-muscle actin positive (data not shown). PCR analysis of genomic DNA of these MC populations (Fig. 3, C, insets, and D) at 6 mo indicated that genotypically these populations continued to include predominantly host-derived MC. Notably, however, in glomerular cultures obtained from FcR{gamma}–/–->FcR{gamma}+/+ mice at 9 mo posttransplant, there was also PCR evidence for donor-derived contributions consistent with replacement of some MC with BM-derived precursors, although this was not evident by immunohistochemistry. One possible explanation for the discrepancy between the immunohistochemical data and the PCR data are that the enriched MC populations might have included other cells, including contaminating leukocytes that were detectable by these sensitive PCR assays. Taken together, these data indicate that FcR expression of MC is neither necessary nor sufficient to initiate an inflammatory nephritic response to IC. Rather, inflammation occurs in NZB/NZW as a direct consequence of FcR engagement on circulatory cells.

Lineage-specific transgenic reconstitution of FcR{gamma} in monocytes/macrophages partially restores the ability to develop nephritis in FcR{gamma}–/– mice

To genetically determine the role of myeloid cells by transgenic manipulation of FcR{gamma}–/– mice, we turned to the anti-GBM nephritis model in the C57BL/6 FcR{gamma}–/– background. In previous studies in the autologous anti-GBM disease model, activating FcRs expressed on hemopoietic cells were found to be required for disease development (42). To assess the specific contributions of FcR-bearing myeloid cells, transgenic mice expressing FcR{gamma} driven by the CD11b promoter (Fig. 4A) were generated in FcR{gamma}–/– C57BL/6 mice (CD11b-{gamma} Tg+). Three Tg+ founder mice were analyzed for functional expression of FcR{gamma} in peritoneal macrophages. One of theses transgenic founder lines (line 14) exhibited FcR{gamma} expression in peritoneal macrophages, but not in B cells, T cells, NK cells, or neutrophils (Fig. 4B). Functional expression in peritoneal macrophages was shown by restored FcR-mediated phagocytosis in CD11b-{gamma} Tg+ (Fig. 4C). Lack of expression of FcR{gamma} in MC of CD11b-{gamma} Tg+ was demonstrated by RT-PCR analysis of RNA obtained from cultured MC. CD11b-{gamma} Tg+ MC did not express detectable FcR{gamma} at the RNA level neither in the resting state nor after stimulation with IC or IFN-{gamma} for either 6 h (data not shown) or 24 h (Fig. 4D).


Figure 4
View larger version (76K):
[in this window]
[in a new window]

  		FIGURE 4. Targeted re-expression of FcR{gamma} by the human CD11b promoter reconstitutes Ab-mediated phagocytosis in FcR{gamma}–/– macrophages (M{phi}). A, CD11b-FcR{gamma} construct: the murine FcR{gamma} cDNA was inserted between the 1.7-kb 5'-flanking sequences of the human CD11b promoter and the 3'-flanking region from the human growth hormone gene. Three founder mice were generated, of which one expressed FcR{gamma} in macrophages. B, Western blot analysis of FcR{gamma} expression in CD11b{gamma} Tg+ mice: whole-cell extracts were run on denaturing gels and blotted, and the FcR{gamma} chain was detected with a rabbit anti-mouse FcR{gamma} polyclonal Abs. Blots were stripped and reprobed with anti-β-actin polyclonal Abs for loading controls. FcR{gamma} expression in CD11b-{gamma} Tg+ mice was seen in peritoneal macrophages but not in neutrophils, NK cells, B cells, or T cells. C, Phagocytosis assays: rabbit IgG-opsonized SRBCs were added to adherent peritoneal macrophages from FcR{gamma}–/– and CD11b-{gamma} Tg+ mice. No phagocytosis was observed by FcR{gamma}–/– macrophages after 1 h, whereas most CD11b-{gamma} Tg+ macrophages had ingested several RBCs. D, FcR{gamma} expression in cultured MC: RT-PCR analysis using cDNA from WT, CD11b-{gamma} Tg+, and FcR{gamma}–/– MC demonstrates lack of FcR{gamma} RNA expression in both FcR{gamma}–/– and CD11b-{gamma} Tg+ mice in resting cells or after 24 h of stimulation with either IFN-{gamma} (1000 U/ml) or IC (50/10 µg/ml rabbit anti-OVA/OVA). HPRT served as a housekeeping gene control. PMN, Polymorphonuclear cells.

 
The transgenic CD11b-{gamma} Tg+ mice provided a unique opportunity to address the singular role of FcR-bearing monocytes/macrophages to the development of nephritis. Mice were immunized with sheep IgG in CFA 3 days before i.v. administration of specific sheep anti-GBM sera (Fig. 5). Severe proteinuria, hypoalbuminemia, and uremia developed in all WT C57BL/6 mice by day 7 whereas FcR{gamma}–/– mice, as expected, were completely protected from disease development (Fig. 5). In contrast, CD11b-{gamma} Tg+ mice developed moderate proteinuria and consequent hypoalbuminemia. Histopathological assessment of H&E-stained renal sections was consistent with the induction of mild glomerulonephritis in CD11b-{gamma} Tg+, with increased glomerular cellularity noted (Fig. 6, A and B). This likely reflects myeloid cell expression of FcR{gamma} rather than IC-induced activation of the CD11b-{gamma} promoter in MC as cultured CD11b-{gamma} Tg+. MC did not demonstrate IFN-{gamma}- or IC-induced FcR{gamma} expression (Fig. 4D). Severity of histological activity was semiquantitatively graded using seven criteria (glomerular fibrinoid necrosis, 0–4; endocapillary hypercellularity, 0–4; glomerular leukocyte infiltration, 0–4; crescents, 0–4; tubular degeneration, 0–4; casts, 0–4; and interstitial inflammation, 0–4). Average scores for the groups for each of the seven categories were, respectively: WT (2.8, 3.6, 3.6, 0.6, 4.0, 4.0, 1.0); CD11b-{gamma} Tg+ (0, 2.1, 1.5, 0, 2.1, 1.9, 0); and FcR{gamma}–/– (0, 0.3, 0, 0, 0, 0.2, 0). Cumulative pathological scores were 20 ± 1.2 (mean ± SD), 2.6 ± 1.3, and 6.6 ± 1.5, for WT, FcR{gamma}–/–, and CD11b-{gamma} Tg+ animals, respectively. Thus, CD11b-{gamma} Tg+ animals developed an intermediate level of glomerulonephritis manifested as increased proteinuria and histological evidence of mildly increased glomerular endocapillary cellularity and leukocyte infiltration.


Figure 5
View larger version (27K):
[in this window]
[in a new window]

  		FIGURE 5. Lineage-restricted expression of FcR{gamma} in macrophages is sufficient for induction of accelerated glomerulonephritis. A, Proteinuria, urinary protein content was quantified daily and mean values of five animals per group are shown. Proteinuria differed significantly among the groups (ANOVA, p = 0.009). By day 7, significantly elevated proteinuria was seen in CD11b-{gamma} Tg+ mice but not in FcR{gamma}–/–, *, p = 0.016, CD11b-{gamma} Tg+ vs FcR{gamma}–/–, two-sample t test (two-tailed). B, Serum albumin levels, serum obtained at day 7 was analyzed for serum albumin content. Serum albumin was significantly different between groups (ANOVA, p = 0.004). Relative hypoalbuminemia occurs in CD11b-{gamma}+ Tg mice but not in FcR{gamma}–/–. The t test p values (two-sample, two-tailed) are shown. Normal mouse albumin is 1.6 mg/ml. Blood urea nitrogen levels, serum obtained at day 7 was analyzed for serum urea nitrogen content. Uremia occurs in WT mice but not in CD11b-{gamma}+ Tg mice or in FcR{gamma}–/–. Uremia differed significantly between groups (ANOVA, p < 0.0001). The t test p values (two-sample, two-tailed) are shown. Normal mouse blood urea nitrogen levels were 17.3.

 

Figure 6
View larger version (43K):
[in this window]
[in a new window]

  		FIGURE 6. Cd11b-{gamma} Tg+ mice exhibit macrophage glomerular infiltration and mild glomerulonephritis. A and B, Histological assessment of glomerulonephritis with cumulative pathological scores: formalin-fixed sections were PAS stained and assessed in a blinded fashion. Pathological changes were significantly different (ANOVA, p < 0.0001) between groups. In CD11b-{gamma} Tg+ animals, there was evidence of increased endocapillary and MC hypercellularity, glomerular leukocyte infiltration, tubular degeneration, and cast formation. These changes were markedly more severe in WT mice and none of these changes were noted in FcR{gamma}–/– mice (two-sample, two-tailed t test p = 0.002, CD11b-{gamma}+ Tg vs FcR{gamma}–/–). C and D, Mac-1 immunostaining of glomeruli: immunofluorescent images are shown in C and numbers of Mac-1+ cells/glomerulus are quantified in D. Anti-mouse IgG stains show equivalent amounts of IgG deposition in all three genotypes of mice. However, numbers of infiltrating Mac-1+ cells varied between the groups (ANOVA, p = 0.001). Increased macrophage infiltration was seen in WT and CD11b-{gamma} Tg+ mice but not in FcR{gamma}–/–. Mac-1+ cells were counted in 50 total glomeruli/mouse and the average numbers of Mac-1+ cells/glomerulus for each mouse are shown (p values determined by a two-sample, two-tailed t test are shown).

 
To determine whether the increased cellularity and leukocyte infiltration were due to the glomerular recruitment of Mac-1+-circulating monocytes/macrophages, immunostaining of renal sections was performed (Fig. 6, C and D). All three groups of mice showed similar levels of glomerular mouse anti-sheep IgG deposition, confirming that the failure to develop fulminant nephritis in FcR{gamma}–/– was not due to differences in the production and deposition of anti-sheep IgG in the kidney. In the absence of activating FcR in FcR{gamma}–/–, there was no evidence of infiltrating Mac-1+ macrophages despite deposition of ICs. In WT mice, Mac-1+-infiltrating cells were prominent. Macrophage influx was evident as well in CD11b-{gamma} Tg+ animals, indicating that reconstitution of activating FcR expression in CD11b/Mac-1+ cells was sufficient to restore their direct recruitment and activation in glomeruli, with injurious consequences manifested by proteinuria.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
These studies provide the rationale for the systemic delivery of FcR-targeted therapeutics in lupus. Previous work has shown that activating FcRs are required for nephritis pathogenesis in the autologous and heterologous anti-GBM models and in spontaneous disease in NZB/NZW. FcR{gamma}–/– animals fail to develop proteinuria and inflammatory responses despite persistent glomerular IgG and C3 deposition (18, 19, 49, 50). In this study, we have determined the FcR-mediated contributions of intrinsic renal cells vs circulating hemopoietic cells in disease pathogenesis. NZB/NZW mice harboring either FcR{gamma}–/– or FcR{gamma}+/+ BM populations developed comparable serological levels of antichromatin IgGs and IgG/complement glomerular deposition. However inflammatory responses and disease development were abrogated in mice containing FcR{gamma}–/– BM, suggesting that blockade of FcR activation on circulating leukocytes is sufficient to limit effector responses in lupus nephritis despite the persistence of mesangial IC deposition. The absence of FcR{gamma} expression in recipient cells, including renal resident cells, did not limit the incidence or severity of nephritis development in mice bearing WT FcR{gamma} BM populations. Thus, development of nephritis in NZB/NZW required FcR{gamma} expression on hemopoietic cells, establishing these cells as therapeutic targets, whereas FcR{gamma} in MC was dispensable.

To confirm that MC remained recipient derived at the time of disease onset and progression, two experimental approaches were used. Immunohistochemical staining of renal sections obtained at 5 and 9 mo posttransplant demonstrated persistent expression of recipient FcR{gamma} genes and a lack of expression of donor FcR{gamma} in MC populations. Using sensitive PCR genomic DNA assays of short-term, enriched MC cultures obtained from mice 6 mo posttransplant also showed that genotypically MC remained predominantly of recipient origin. By 9 mo posttransplant, however, genetic PCR-based evidence for replacement of some MC by BM precursors was seen. Recent reports using GFP-expressing BM chimeras have suggested that mesangial cell populations are replaced by hemopoietic precursors. However, one of these studies involved an injury model using Thy1 Abs and in both studies only a small fraction of MC was replaced during the observation periods (51, 52). In our studies, it is unclear whether the PCR detection of donor FcR{gamma} alleles of enriched MC cultures resulted from replacement of recipient MC with hemopoietic precursors between 6 and 9 mo or resulted instead from contaminating leukocytes in these enriched glomerular cultures. MC populations remained mostly, if not completely, of recipient origin throughout the observation period, implying that FcRs on MC do not contribute dominantly to the initiation of NZB/NZW lupus nephritis.

Our data are consistent with the notion that ICs deposited in glomeruli may be directly accessible to circulating cells (15, 53, 54). In the skin and lung, by contrast, adoptive transfer studies have demonstrated that FcR-mediated activation of tissue-resident leukocytes in these tissues (3, 22) was sufficient to initiate inflammatory responses and to recruit FcR-deficient neutrophils. In the kidney, however, the specialized endothelium in the renal glomeruli is fenestrated, enabling transit of plasma out of the vascular space (55, 56). This same property also provides glomeruli the anatomic distinction of permitting circulatory cells direct access to tissue ICs deposited in the GBM. Thus, unlike the situation in the skin and lung, this may permit direct initiation of the glomerular inflammatory response by bloodborne leukocytes without a requirement for resident cell-derived recruitment signals.

To determine the singular importance of activating FcR expression in monocyte/macrophage lineage cells as opposed to other BM-derived cells in the induction of nephritis, we targeted FcR{gamma} expression to the CD11b+ compartment in FcR{gamma}–/– animals. FcR{gamma} expression by monocytes/macrophages partially reconstituted the ability to develop nephritis in the anti-GBM model, such that significant levels of proteinuria occurred in CD11b-{gamma} Tg+ mice. The presence of activating FcRs on macrophages in CD11b-{gamma} Tg+ mice was sufficient to induce their accumulation in renal glomeruli, presumably as a result of direct FcR activation by glomerular ICs. Histological inflammatory changes were significantly more intense in CD11b-{gamma} Tg+ than those seen in FcR{gamma}–/–. Thus, activating FcR expression on circulating macrophage CD11b+ subsets is sufficient to induce their direct recruitment into renal glomeruli with injurious consequences manifested by proteinuria. Because the inflammatory response remained of mild intensity as compared with WT animals, other FcR-bearing hemopoietic lineage cells must also contribute to the IC-mediated inflammatory nephritis, including granulocytes and CD11b– subsets of monocytes/macrophages cell types not specifically targeted by the CD11b-{gamma} transgene. Taken together, these studies show that among possible FcR-bearing cell types, expression on myeloid effector cells is sufficient to convey disease susceptibility. Other proinflammatory mediators contribute ultimately to disease (cytokines, chemokines, reactive oxygen, and nitrogen species, etc.); however, FcR engagement is likely a key proximal step in this inflammatory cascade.

Our studies underscore other recent studies in the anti-GBM model (41, 42), which suggest that direct activation of hemopoietic FcR-bearing effectors is central to the induction of IC-triggered nephritis. Depletion studies have demonstrated that macrophages are critical effectors in anti-GBM nephritis (54, 57). Our data with CD11b-{gamma} Tg+ mice also support the notion that activating FcRs, specifically on monocyte/macrophages, are pivotal to the development of nephritis. Thus, the relative expression/function of activating and inhibitory FcRs (16, 17, 19, 58) on monocyte lineage cells likely modulates IC-triggered glomerulonephritis. FcR-bearing monocytes and macrophages may contribute directly to injury as effectors and also indirectly by modulating IC-mediated Ag presentation and/or by facilitating recruitment and activation of lymphocyte effectors to the tissue site.

Systemic lupus erythematosus (SLE) is characterized by the activation of polyclonal B and T cell self-reactive populations that promote tissue destruction through the recruitment and activation of inflammatory cells. In many regards, the NZB/NZW lupus nephritis model shares pathogenetic features with human SLE, including the hallmark of anti-chromatin IgG autoantibodies, female predominance, and shared genetic disease susceptibility loci, including the Fc{gamma}R region on chromosome 1q23, which is syntenic in mouse and humans.

Our studies suggest that down-modulation of activating FcR function on bloodborne leukocytes would be predicted to abrogate the inflammatory response in human SLE potentially providing an adjunct therapy or replacement for lymphocyte-targeted immunosuppression. Interestingly however, the ambiguous results of some population studies in human SLE (reviewed in Ref. 59) suggest discordantly that disease is associated with polymorphisms conveying reduced functionality of activating FcRs (Fc{gamma}RIIA-R131(60)), Fc{gamma}RIIIA-158F (61)), or enhanced inhibitory FcR function (FcRIIB-232Thr (62)). However, the concept that SLE is associated paradoxically with enhanced FcR signaling is not supported by all studies, including that of Blank et al. (63), which noted an association between SLE and an inhibitory FcRIIB promoter polymorphism (–343 C/C promoter) with reduced expression. It is unclear whether these polymorphic alleles are merely markers of other closely linked genetic contributors on chromosome 1 or rather indicative of hidden challenges of Fc{gamma}R-targeted therapy that might have pleiotrophic modulatory effects on FcR function in Ag presentation, IC catabolism, B cell regulation, as well as myeloid effector cell-triggered inflammation.


   Acknowledgments
 
We gratefully acknowledge the Transgenic Core Facility of the Herbert Irving Cancer Center, Columbia University Medical Center and specifically Dr. Victor Lin for his help and expertise in oocyte injections and transfers.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the Immunology Training Program (T32 AI 07525 (to A.B.), the National Institutes of Health/National Institute of Allergy and Infectious Diseases RO3AR45764, and by an Investigator Award of the Arthritis Foundation (to R.C.). Back

2 Address correspondence and reprint requests to Dr. Raphael Clynes, Columbia University, College of Physicians and Surgeons, P & S Building, Room 8-510, 630 West 168th Street, New York, NY 10032. E-mail address: rc645{at}columbia.edu Back

3 Abbreviations used in this paper: IC, immune complex; MC, mesangial cell; GBM, glomerular basement membrane; WT, wild type; BM, bone marrow; PAS, periodic acid-Schiff; SLE, systemic lupus erythematosus. Back

Received for publication December 20, 2005. Accepted for publication September 1, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Sylvestre, D. L., J. V. Ravetch. 1994. Fc receptors initiate the Arthus reaction: redefining the inflammatory cascade. Science 265: 1095-1098. [Abstract/Free Full Text]
  2. Hazenbos, W. L., J. E. Gessner, F. M. Hofhuis, H. Kuipers, D. Meyer, I. A. Heijnen, R. E. Schmidt, M. Sandor, P. J. Capel, M. Daeron, et al 1996. Impaired IgG-dependent anaphylaxis and Arthus reaction in Fc{gamma}RIII (CD16) deficient mice. Immunity 5: 181-188. [Medline]
  3. Sylvestre, D. L., J. V. Ravetch. 1996. A dominant role for mast cell Fc receptors in the Arthus reaction. Immunity 5: 387-390. [Medline]
  4. Sylvestre, D., R. Clynes, M. Ma, H. Warren, M. C. Carroll, J. V. Ravetch. 1996. Immunoglobulin G-mediated inflammatory responses develop normally in complement-deficient mice. J. Exp. Med. 184: 2385-2392. [Abstract/Free Full Text]
  5. Yuasa, T., S. Kubo, T. Yoshino, A. Ujike, K. Matsumura, M. Ono, J. V. Ravetch, T. Takai. 1999. Deletion of Fc{gamma} receptor IIB renders H-2b mice susceptible to collagen-induced arthritis. J. Exp. Med. 189: 187-194. [Abstract/Free Full Text]
  6. Kleinau, S., P. Martinsson, B. Heyman. 2000. Induction and suppression of collagen-induced arthritis is dependent on distinct Fc{gamma} receptors. J. Exp. Med. 191: 1611-1616. [Abstract/Free Full Text]
  7. van Lent, P. L., A. J. van Vuuren, A. B. Blom, A. E. Holthuysen, L. B. van de Putte, J. G. van de Winkel, W. B. van den Berg. 2000. Role of Fc receptor {gamma} chain in inflammation and cartilage damage during experimental antigen-induced arthritis. Arthritis Rheum. 43: 740-752. [Medline]
  8. Ji, H., K. Ohmura, U. Mahmood, D. M. Lee, F. M. Hofhuis, S. A. Boackle, K. Takahashi, V. M. Holers, M. Walport, C. Gerard, et al 2002. Arthritis critically dependent on innate immune system players. Immunity 16: 157-168. [Medline]
  9. Nandakumar, K. S., M. Andren, P. Martinsson, E. Bajtner, S. Hellstrom, R. Holmdahl, S. Kleinau. 2003. Induction of arthritis by single monoclonal IgG anti-collagen type II antibodies and enhancement of arthritis in mice lacking inhibitory Fc{gamma}RIIB. Eur. J. Immunol. 33: 2269-2277. [Medline]
  10. Kagari, T., D. Tanaka, H. Doi, T. Shimozato. 2003. Essential role of Fc{gamma} receptors in anti-type II collagen antibody-induced arthritis. J. Immunol. 170: 4318-4324. [Abstract/Free Full Text]
  11. Nabbe, K. C., A. B. Blom, A. E. Holthuysen, P. Boross, J. Roth, S. Verbeek, P. L. van Lent, W. B. van den Berg. 2003. Coordinate expression of activating Fc{gamma} receptors I and III and inhibiting Fc{gamma} receptor type II in the determination of joint inflammation and cartilage destruction during immune complex-mediated arthritis. Arthritis Rheum. 48: 255-265. [Medline]
  12. Corr, M., B. Crain. 2002. The role of Fc{gamma}R signaling in the K/B x N serum transfer model of arthritis. J. Immunol. 169: 6604-6609. [Abstract/Free Full Text]
  13. Clynes, R., J. S. Maizes, R. Guinamard, M. Ono, T. Takai, J. V. Ravetch. 1999. Modulation of immune complex-induced inflammation in vivo by the coordinate expression of activation and inhibitory Fc receptors. J. Exp. Med. 189: 179-185. [Abstract/Free Full Text]
  14. Clynes, R., N. Calvani, B. P. Croker, H. B. Richards. 2005. Modulation of the immune response in pristane-induced lupus by expression of activation and inhibitory Fc receptors. Clin. Exp. Immunol. 141: 230-237. [Medline]
  15. Coxon, A., X. Cullere, S. Knight, S. Sethi, M. W. Wakelin, G. Stavrakis, F. W. Luscinskas, T. N. Mayadas. 2001. Fc{gamma}RIII mediates neutrophil recruitment to immune complexes: a mechanism for neutrophil accumulation in immune-mediated inflammation. Immunity 14: 693-704. [Medline]
  16. Tarzi, R. M., K. A. Davies, J. W. Claassens, J. S. Verbeek, M. J. Walport, H. T. Cook. 2003. Both Fc{gamma} receptor I and Fc{gamma} receptor III mediate disease in accelerated nephrotoxic nephritis. Am. J. Pathol. 162: 1677-1683. [Abstract/Free Full Text]
  17. Radeke, H. H., I. Janssen-Graalfs, E. N. Sowa, N. Chouchakova, J. Skokowa, F. Loscher, R. E. Schmidt, P. Heeringa, J. E. Gessner. 2002. Opposite regulation of type II and III receptors for immunoglobulin G in mouse glomerular mesangial cells and in the induction of anti-glomerular basement membrane (GBM) nephritis. J. Biol. Chem. 277: 27535-27544. [Abstract/Free Full Text]
  18. Clynes, R., C. Dumitru, J. V. Ravetch. 1998. Uncoupling of immune complex formation and kidney damage in autoimmune glomerulonephritis. Science 279: 1052-1054. [Abstract/Free Full Text]
  19. Suzuki, Y., I. Shirato, K. Okumura, J. V. Ravetch, T. Takai, Y. Tomino, C. Ra. 1998. Distinct contribution of Fc receptors and angiotensin II-dependent pathways in anti-GBM glomerulonephritis. Kidney Int. 54: 1166-1174. [Medline]
  20. Godau, J., T. Heller, H. Hawlisch, M. Trappe, E. Howells, J. Best, J. Zwirner, J. S. Verbeek, P. M. Hogarth, C. Gerard, et al 2004. C5a initiates the inflammatory cascade in immune complex peritonitis. J. Immunol. 173: 3437-3445. [Abstract/Free Full Text]
  21. Heller, T., J. E. Gessner, R. E. Schmidt, A. Klos, W. Bautsch, J. Kohl. 1999. Cutting edge: Fc receptor type I for IgG on macrophages and complement mediate the inflammatory response in immune complex peritonitis. J. Immunol. 162: 5657-5661. [Abstract/Free Full Text]
  22. Skokowa, J., S. R. Ali, O. Felda, V. Kumar, S. Konrad, N. Shushakova, R. E. Schmidt, R. P. Piekorz, B. Nurnberg, K. Spicher, et al 2005. Macrophages induce the inflammatory response in the pulmonary Arthus reaction through G{alpha}i2 activation that controls C5aR and Fc receptor cooperation. J. Immunol. 174: 3041-3050. [Abstract/Free Full Text]
  23. Shushakova, N., J. Skokowa, J. Schulman, U. Baumann, J. Zwirner, R. E. Schmidt, J. E. Gessner. 2002. C5a anaphylatoxin is a major regulator of activating versus inhibitory Fc{gamma}Rs in immune complex-induced lung disease. J. Clin. Invest. 110: 1823-1830. [Medline]
  24. Baumann, U., J. Kohl, T. Tschernig, K. Schwerter-Strumpf, J. S. Verbeek, R. E. Schmidt, J. E. Gessner. 2000. A codominant role of Fc{gamma}RI/III and C5aR in the reverse Arthus reaction. J. Immunol. 164: 1065-1070. [Abstract/Free Full Text]
  25. Kaplan, C. D., S. K. O’Neill, T. Koreny, M. Czipri, A. Finnegan. 2002. Development of inflammation in proteoglycan-induced arthritis is dependent on Fc{gamma}R regulation of the cytokine/chemokine environment. J. Immunol. 169: 5851-5859. [Abstract/Free Full Text]
  26. Wipke, B. T., Z. Wang, W. Nagengast, D. E. Reichert, P. M. Allen. 2004. Staging the initiation of autoantibody-induced arthritis: a critical role for immune complexes. J. Immunol. 172: 7694-7702. [Abstract/Free Full Text]
  27. Lee, D. M., D. S. Friend, M. F. Gurish, C. Benoist, D. Mathis, M. B. Brenner. 2002. Mast cells: a cellular link between autoantibodies and inflammatory arthritis. Science 297: 1689-1692. [Abstract/Free Full Text]
  28. Taube, C., A. Dakhama, Y. H. Rha, K. Takeda, A. Joetham, J. W. Park, A. Balhorn, T. Takai, K. R. Poch, J. A. Nick, E. W. Gelfand. 2003. Transient neutrophil infiltration after allergen challenge is dependent on specific antibodies and Fc{gamma}III receptors. J. Immunol. 170: 4301-4309. [Abstract/Free Full Text]
  29. Zhang, Y., B. F. Ramos, B. A. Jakschik. 1992. Neutrophil recruitment by tumor necrosis factor from mast cells in immune complex peritonitis. Science 258: 1957-1959. [Abstract/Free Full Text]
  30. Ramos, B. F., Y. Zhang, R. Qureshi, B. A. Jakschik. 1991. Mast cells are critical for the production of leukotrienes responsible for neutrophil recruitment in immune complex-induced peritonitis in mice. J. Immunol. 147: 1636-1641. [Abstract]
  31. Gomez-Guerrero, C., O. Lopez-Franco, G. Sanjuan, P. Hernandez-Vargas, Y. Suzuki, G. Ortiz-Munoz, J. Blanco, J. Egido. 2004. Suppressors of cytokine signaling regulate Fc receptor signaling and cell activation during immune renal injury. J. Immunol. 172: 6969-6977. [Abstract/Free Full Text]
  32. Gomez-Guerrero, C., O. Lopez-Franco, Y. Suzuki, G. Sanjuan, P. Hernandez-Vargas, J. Blanco, J. Egido. 2002. Nitric oxide production in renal cells by immune complexes: role of kinases and nuclear factor-{kappa}B. Kidney Int. 62: 2022-2034. [Medline]
  33. Gomez-Guerrero, C., P. Hernandez-Vargas, O. Lopez-Franco, G. Ortiz-Munoz, J. Egido. 2005. Mesangial cells and glomerular inflammation: from the pathogenesis to novel therapeutic approaches. Curr. Drug Targets 4: 341-351.
  34. Lopez-Armada, M. J., C. Gomez-Guerrero, J. Egido. 1996. Receptors for immune complexes activate gene expression and synthesis of matrix proteins in cultured rat and human mesangial cells: role of TGF-β. J. Immunol. 157: 2136-2142. [Abstract]
  35. Morcos, M., G. M. Hansch, M. Schonermark, S. Ellwanger, M. Harle, B. Heckl-Ostreicher. 1994. Human glomerular mesangial cells express CD16 and may be stimulated via this receptor. Kidney Int. 46: 1627-1634. [Medline]
  36. Uciechowski, P., M. Schwarz, J. E. Gessner, R. E. Schmidt, K. Resch, H. H. Radeke. 1998. IFN-{gamma} induces the high-affinity Fc receptor I for IgG (CD64) on human glomerular mesangial cells. Eur. J. Immunol. 28: 2928-2935. [Medline]
  37. Hora, K., J. A. Satriano, A. Santiago, T. Mori, E. R. Stanley, Z. Shan, D. Schlondorff. 1992. Receptors for IgG complexes activate synthesis of monocyte chemoattractant peptide 1 and colony-stimulating factor 1. Proc. Natl. Acad. Sci. USA 89: 1745-1749. [Abstract/Free Full Text]
  38. Singhal, P. C., S. Gupta, P. Sharma, H. Shah, N. Shah, P. Patel. 2000. Receptor mediated endocytosis by mesangial cells modulates transmigration of macrophages. Inflammation 24: 519-532. [Medline]
  39. Gomez-Guerrero, C., M. J. Lopez-Armada, E. Gonzalez, J. Egido. 1994. Soluble IgA and IgG aggregates are catabolized by cultured rat mesangial cells and induce production of TNF-{alpha} and IL-6, and proliferation. J. Immunol. 153: 5247-5255. [Abstract]
  40. Kovalenko, P., H. Fujinaka, Y. Yoshida, H. Kawamura, Z. Qu, A. G. El-Shemi, H. Li, A. Matsuki, V. Bilim, E. Yaoita, et al 2004. Fc receptor-mediated accumulation of macrophages in crescentic glomerulonephritis induced by anti-glomerular basement membrane antibody administration in WKY rats. Int. Immunol. 16: 625-634. [Abstract/Free Full Text]
  41. Suzuki, Y., C. Gomez-Guerrero, I. Shirato, O. Lopez-Franco, J. Gallego-Delgado, G. Sanjuan, A. Lazaro, P. Hernandez-Vargas, K. Okumura, Y. Tomino, et al 2003. Pre-existing glomerular immune complexes induce polymorphonuclear cell recruitment through an Fc receptor-dependent respiratory burst: potential role in the perpetuation of immune nephritis. J. Immunol. 170: 3243-3253. [Abstract/Free Full Text]
  42. Tarzi, R. M., K. A. Davies, M. G. Robson, L. Fossati-Jimack, T. Saito, M. J. Walport, H. T. Cook. 2002. Nephrotoxic nephritis is mediated by Fc{gamma} receptors on circulating leukocytes and not intrinsic renal cells. Kidney Int. 62: 2087-2096. [Medline]
  43. Wirthmueller, U., T. Kurosaki, M. S. Murakami, J. V. Ravetch. 1992. Signal transduction by Fc{gamma}RIII (CD16) is mediated through the {gamma}-chain. J. Exp. Med. 175: 1381-1390. [Abstract/Free Full Text]
  44. Dziennis, S., R. A. Van Etten, H. L. Pahl, D. L. Morris, T. L. Rothstein, C. M. Blosch, R. M. Perlmutter, D. G. Tenen. 1995. The CD11b promoter directs high-level expression of reporter genes in macrophages in transgenic mice. [Published erratum appears in 1995 Blood 85: 1983.]. Blood 85: 319-329. [Abstract/Free Full Text]
  45. Hogarth, M. B., P. J. Norsworthy, P. J. Allen, P. K. Trinder, M. Loos, B. J. Morley, M. J. Walport, K. A. Davies. 1996. Autoantibodies to the collagenous region of C1q occur in three strains of lupus-prone mice. Clin. Exp. Immunol. 104: 241-246. [Medline]
  46. Uwatoko, S., M. Mannik, I. R. Oppliger, M. Okawa-Takatsuji, S. Aotsuka, R. Yokohari, G. Seki, S. Taniguchi, K. Suzuki, K. Kurokawa. 1995. C1q-binding immunoglobulin G in MRL/l mice consists of immune complexes containing antibodies to DNA. Clin. Immunol. Immunopathol. 75: 140-146. [Medline]
  47. Luo, Y., C. Lloyd, J. C. Gutierrez-Ramos, M. E. Dorf. 1999. Chemokine amplification in mesangial cells. [Published erratum appears in 2000 J. Immunol. 164: 5332.]. J. Immunol. 163: 3985-3992. [Abstract/Free Full Text]
  48. Takai, T., M. Li, D. Sylvestre, R. Clynes, J. V. Ravetch. 1994. FcR {gamma} chain deletion results in pleiotrophic effector cell defects. Cell 76: 519-529. [Medline]
  49. Wakayama, H., Y. Hasegawa, T. Kawabe, T. Hara, S. Matsuo, M. Mizuno, T. Takai, H. Kikutani, K. Shimokata. 2000. Abolition of anti-glomerular basement membrane antibody-mediated glomerulonephritis in FcR{gamma}-deficient mice. Eur. J. Immunol. 30: 1182-1190. [Medline]
  50. Park, S. Y., S. Ueda, H. Ohno, Y. Hamano, M. Tanaka, T. Shiratori, T. Yamazaki, H. Arase, N. Arase, A. Karasawa, et al 1998. Resistance of Fc receptor- deficient mice to fatal glomerulonephritis. J. Clin. Invest. 102: 1229-1238. [Medline]
  51. Ito, T., A. Suzuki, E. Imai, M. Okabe, M. Hori. 2001. Bone marrow is a reservoir of repopulating mesangial cells during glomerular remodeling. J. Am. Soc. Nephrol. 12: 2625-2635. [Abstract/Free Full Text]
  52. Imasawa, T., Y. Utsunomiya, T. Kawamura, Y. Zhong, R. Nagasawa, M. Okabe, N. Maruyama, T. Hosoya, T. Ohno. 2001. The potential of bone marrow-derived cells to differentiate to glomerular mesangial cells. J. Am. Soc. Nephrol. 12: 1401-1409. [Abstract/Free Full Text]
  53. Tang, T., A. Rosenkranz, K. J. Assmann, M. J. Goodman, J. C. Gutierrez-Ramos, M. C. Carroll, R. S. Cotran, T. N. Mayadas. 1997. A role for Mac-1 (CDIIb/CD18) in immune complex-stimulated neutrophil function in vivo: Mac-1 deficiency abrogates sustained Fc{gamma} receptor-dependent neutrophil adhesion and complement-dependent proteinuria in acute glomerulonephritis. J. Exp. Med. 186: 1853-1863. [Abstract/Free Full Text]
  54. Ikezumi, Y., L. A. Hurst, T. Masaki, R. C. Atkins, D. J. Nikolic-Paterson. 2003. Adoptive transfer studies demonstrate that macrophages can induce proteinuria and mesangial cell proliferation. Kidney Int. 63: 83-95. [Medline]
  55. Lea, P. J., M. Silverman, R. Hegele, M. J. Hollenberg. 1989. Tridimensional ultrastructure of glomerular capillary endothelium revealed by high-resolution scanning electron microscopy. Microvasc. Res. 38: 296-308. [Medline]
  56. Drumond, M. C., W. M. Deen. 1994. Structural determinants of glomerular hydraulic permeability. Am. J. Physiol. 266: F1-F12. [Medline]
  57. Huang, X. R., P. G. Tipping, J. Apostolopoulos, C. Oettinger, M. D’Souza, G. Milton, S. R. Holdsworth. 1997. Mechanisms of T cell-induced glomerular injury in anti-glomerular basement membrane (GBM) glomerulonephritis in rats. Clin. Exp. Immunol. 109: 134-142. [Medline]
  58. Fujii, T., Y. Hamano, S. Ueda, B. Akikusa, S. Yamasaki, M. Ogawa, H. Saisho, J. S. Verbeek, S. Taki, T. Saito. 2003. Predominant role of Fc{gamma}RIII in the induction of accelerated nephrotoxic glomerulonephritis. Kidney Int. 64: 1406-1416. [Medline]
  59. Takai, T.. 2005. Fc receptors and their role in immune regulation and autoimmunity. J. Clin. Immunol. 25: 1-18. [Medline]
  60. Salmon, J. E., S. Millard, L. A. Schachter, F. C. Arnett, E. M. Ginzler, M. F. Gourley, R. Ramsey-Goldman, M. G. Peterson, R. P. Kimberly. 1996. Fc{gamma}RIIA alleles are heritable risk factors for lupus nephritis in African Americans. J. Clin. Invest. 97: 1348-1354. [Medline]
  61. Wu, J., J. C. Edberg, P. B. Redecha, V. Bansal, P. M. Guyre, K. Coleman, J. E. Salmon, R. P. Kimberly. 1997. A novel polymorphism of Fc{gamma}RIIIa (CD16) alters receptor function and predisposes to autoimmune disease. J. Clin. Invest. 100: 1059-1070. [Medline]
  62. Li, X., J. Wu, R. H. Carter, J. C. Edberg, K. Su, G. S. Cooper, R. P. Kimberly. 2003. A novel polymorphism in the Fc{gamma} receptor IIB (CD32B) transmembrane region alters receptor signaling. Arthritis Rheum. 48: 3242-3252. [Medline]
  63. Blank, M. C., R. N. Stefanescu, E. Masuda, F. Marti, P. D. King, P. B. Redecha, R. J. Wurzburger, M. G. Peterson, S. Tanaka, L. Pricop. 2005. Decreased transcription of the human FCGR2B gene mediated by the –343 G/C promoter polymorphism and association with systemic Lupus Erythematosus. Hum. Genet. 117: 220-227. [Medline]



This article has been cited by other articles:


Home page
 Am. J. Pathol.Home page
S. Guo, A. S. Muhlfeld, T. A. Wietecha, C. J. Peutz-Kootstra, J. Kowalewska, K. Yi, M. Spencer, W. Pichaiwong, F. Nimmerjahn, K. L. Hudkins, et al.
Deletion of Activating Fc{gamma} Receptors Does Not Confer Protection in Murine Cryoglobulinemia-Associated Membranoproliferative Glomerulonephritis
Am. J. Pathol., July 1, 2009; 175(1): 107 - 118.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
C. N. Paiva, R. H. Arras, E. S. Magalhaes, L. S. Alves, L. P. Lessa, M. H. Silva, R. Ejzemberg, C. Canetti, and M. T. Bozza
Migration inhibitory factor (MIF) released by macrophages upon recognition of immune complexes is critical to inflammation in Arthus reaction
J. Leukoc. Biol., May 1, 2009; 85(5): 855 - 861.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. M. Verhagen, M. E. Wallace, A. Goradia, S. A. Jones, H. A. Croom, D. Metcalf, J. E. Collinge, M. J. Maxwell, M. L. Hibbs, W. S. Alexander, et al.
A Kinase-Dead Allele of Lyn Attenuates Autoimmune Disease Normally Associated with Lyn Deficiency
J. Immunol., February 15, 2009; 182(4): 2020 - 2029.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
T. Kobayashi, K. Takahashi, Y. Nagai, T. Shibata, M. Otani, S. Izui, S. Akira, Y. Gotoh, H. Kiyono, and K. Miyake
Tonic B cell activation by Radioprotective105/MD-1 promotes disease progression in MRL/lpr mice
Int. Immunol., July 1, 2008; 20(7): 881 - 891.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bergtold, A.
Right arrow Articles by Clynes, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bergtold, A.
Right arrow Articles by Clynes, R.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS