The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harman, A. N.
Right arrow Articles by Cunningham, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harman, A. N.
Right arrow Articles by Cunningham, A. L.
The Journal of Immunology, 2006, 177: 7103-7113.
Copyright © 2006 by The American Association of Immunologists, Inc.

HIV Induces Maturation of Monocyte-Derived Dendritic Cells and Langerhans Cells1

Andrew N. Harman, John Wilkinson, Chris R. Bye, Lidija Bosnjak, J. Lewis Stern, Monique Nicholle, Joey Lai and Anthony L. Cunningham2

Centre for Virus Research, Westmead Millennium Institute, Sydney, Australia


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
In HIV infection, dendritic cells (DCs) may play multiple roles, probably including initial HIV uptake in the anogenital mucosa, transport to lymph nodes, and subsequent transfer to T cells. The effects of HIV-1 on DC maturation are controversial, with several recent conflicting reports in the literature. In this study, microarray studies, confirmed by real-time PCR, demonstrated that the genes encoding DC surface maturation markers were among the most differentially expressed in monocyte-derived dendritic cells (MDDCs), derived from human blood, treated with live or aldrithriol-2-inactivated HIV-1BaL. These effects translated to enhanced cell surface expression of these proteins but differential expression of maturation markers was only partial compared with the effects of a conventional potent maturation stimulus. Such partially mature MDDCs can be converted to fully mature cells by this same potent stimulus. Furthermore, live HIV-1 stimulated greater changes in maturation marker surface expression than aldrithriol-2-inactivated HIV-1 and this enhanced stimulation by live HIV-1 was mediated via CCR5, thus suggesting both viral replication-dependent and -independent mechanisms. These partially mature MDDCs demonstrated enhanced CCR7-mediated migration and are also able to stimulate interacting T cells in a MLR, suggesting DCs harboring HIV-1 might prepare CD4 lymphocytes for transfer of HIV-1. Increased maturation marker surface expression was also demonstrated in native DCs, ex vivo Langerhans cells derived from human skin. Thus, HIV initiates maturation of DCs which could facilitate subsequent enhanced transfer to T cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Dendritic cells (DCs)3 are potent APCs that form a direct link between the innate and the adaptive immune systems (1, 2, 3). In their immature state, DCs are peripheral sentinels awaiting contact with microbial glycoprotein Ags which bind to C-type lectin receptors (CLR) such as DC-SIGN, mannose receptor (MR), and probably Langerin on their surface (4). These Ags are then rapidly endocytosed, digested throughout the endolysosomal pathway, and the resulting peptide fragments are loaded onto MHC class II molecules and transported to the cell surface for Ag presentation (2). Danger signals released from associated inflammatory foci trigger DC maturation and migration to the draining lymph nodes. Maturing DCs down-regulate the surface expression of CLRs, CCR5, and CD1a and also their endocytic capacity, and up-regulate CD40, the costimulatory molecules, CD80 and CD86, MHC class II, adhesion molecules such as CD54, CXCR4, and express the key marker maturation CD83 de novo. Upon arrival at the lymph node, mature DCs interact with and present Ag to naive or memory T cells. This process is assisted by an initial interaction between CD40L and CD28 on the T cell surface and CD40, and CD80 or CD86, respectively, on the DC surface (5).

A network of epidermal Langerhans cells (LCs) is distributed throughout anogenital skin and mucosae including the vagina and ectocervix as well as the male foreskin (6, 7, 8). Deep to this is a layer of dermal or lamina propria DCs. These cells appear to be one of the first cell types to be infected upon vaginal exposure of macaques to SIV (6). HIV may use DCs as a "Trojan horse" for transport to and possibly activation of CD4 lymphocytes in the lamina propria/submucosa and lymph nodes (9). Currently, there is intense investigation of the role of DCs in SIV/HIV entry, how these viruses traffic in DCs, and how they are transferred to T cells (10, 11, 12). Recently, we have demonstrated that after binding to surface CLRs, HIV is either endocytosed and degraded by acid proteolytic digestion or transferred to CD4 and CCR5 followed by neutral fusion and de novo replication. The former is the major pathway. HIV can be transferred to CD4 lymphocytes via either pathway but in sequential phases, i.e., de novo replication results in late transfer (11).

Many viruses are able to infect DCs and a proportion of these have evolved mechanisms of interfering with DC function thus impairing the immune response against them. These mechanisms include induction of apoptosis, (13, 14) inhibition of maturation of DCs (12, 15, 16, 17, 18, 19, 20, 21), or by unknown mechanisms (22, 23, 24, 25). Conversely, some viruses enhance DC maturation after infection (26, 27, 28) and others have little affect on DC function (29, 30, 31).

Some recent reports suggest that HIV-infected DC cultures show impaired stimulation in the MLR, correlated with the level of IL-10 produced (32). Impaired secretion of IL-12 from HIV-1-infected DCs has also been reported (33). However, the effect of HIV-1 on DC maturation is controversial. Some studies indicate that HIV-treated or -infected DCs fail to up-regulate cell surface markers, (32, 33) and that this effect is mediated by Vpr (34) or that they are refractory to maturation stimuli (24). Conversely, other studies demonstrate abnormal or partial up-regulation of cell maturation markers and that this effect and subsequent DC migration is triggered by signaling events induced by the binding of the virus surface glycoprotein gp120 to monocyte-derived dendritic cells (MDDCs) (35, 36).

However, in most of the studies described above, unpurified virus stocks were used and with the exception of one of theses studies (35), low titer virus stocks were used. Many of these studies did not investigate the full complement of surface markers indicative of DC maturation. As part of a study on HIV-induced global gene expression in MDDCs using a high titer, highly purified HIV-1 virus stock in comparison with a chemically inactivated virus and recombinant gp120, we found up-regulation of the genes encoding maturation markers CD83 and CD80 to be two of the genes whose expression was most altered. These results were followed up by quantitative PCR and flow cytometry to investigate the cell surface expression and broaden the study to include most DC maturation markers on both MDDCs and ex vivo LCs, finally examining their functional effects in the model MDDCs.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Preparation of MDDCs

CD14+ monocytes derived from PBMC using CD14 magnetic beads (Miltenyi Biotec) were converted to immature MDDCs (iMDDCs) by culture in GM-CSF and IL-4 for 6 days as described previously (11, 37, 38) (high CD1a, MR, DC-SIGN, HLA-DR, moderate to low CD40, CD80, CD86, CXCR4, and negative for CD14 and CD83). At day 6, fresh medium and cytokines were added before experiments were performed. To obtain mature MDDCs, cells were cultured for 2 additional days in a maturation mixture of PGE2 (10–6 M; Sigma-Aldrich), TNF{alpha}, IL-1β, and IL-6 (10 ng/ml; R&D Systems). Mature DCs up-regulate CD40, CD80, CD86, CXCR4, and HLA-DR, express CD83 de novo, and down-regulate CD1a, MR, and DC-SIGN.

Isolation of LCs from skin

Apronectomy and breast skin samples from healthy donors were obtained from the Royal North Shore Private Hospital (Sydney, Australia) under informed consent and Sydney West Area Health Service Research Ethics Committee approval. All adipose tissue was removed from the skin, which was then sectioned into 5-mm2 pieces and incubated for 1 h in RPMI 1640 containing 250 µg/ml gentamicin (Invitrogen Life Technologies) at 4°C before incubation overnight in 5 mg/ml dispase II (Roche Biochemicals) and 25 µg/ml gentamicin in RPMI 1640. Epidermal layers were separated from the dermis and incubated in 5 mg/ml collagenase (Sigma-Aldrich) for 2 h at 37°C. Dissociated cells were collected, filtered, washed, and subjected to flow cytometric analysis and/or HIV infection. For measurement, surface marker expression on LC populations were gated for CD1a and langerin expression and also confirmed to express HLA-DR.

Preparation of high titer purified HIV (BaL) virus stocks

A purified high titer HIV-1 stock in the order of 5 x 1010 50% tissue culture infectious dose (TCID50)/ml was produced as described previously (11, 39). Briefly, HIV-1BaL was grown in PHA (5 µg/ml; Sigma-Aldrich) activated PBMC/PM1 (AIDS Research and Reference Reagent Program, National Institutes of Health, Rockville, MD) cocultures, and concentrated using tangential filter concentration (Millipore). Half the virus pellet was inactivated with aldrithriol-2 (AT-2; Sigma-Aldrich) at 1 mM for 18 h at 4°C (38). During subsequent preparation of the two stocks, volumes were adjusted to maintain equal concentrations of virus particles. Both live and AT-2-inactivated virus was loaded onto and spun through a 6–18% w/v Optiprep (Axis-Shield) gradient for purification (40). One-milliliter fractions of HIV-1BaL were harvested from the top of the column, realiquoted in volumes of 5 µl and stored at –80°C for further use. Virus content of each of the purified, concentrated fractions was determined by p24 gag ELISA (Beckman Coulter) and as TCID50 value generated in TZM-b1 cells (AIDS Research and Reference Reagent Program, National Institutes of Health, contributed by J. Kappes and X. Wu) measured by luciferase reporter gene expression after a single round of infection (41). TCID50 values were generated using the Spearman-Karber formula. The endotoxin levels of these virus stocks were below the detectable limit of 0.005 U/ml or 0.0005 ng/ml (Limulus amebocyte lysate assay; Sigma-Aldrich). Soluble proteins including cytokines would be excluded from the inoculum by pelleting, gradient purification, and washing steps. Testing for residual TNF-{alpha} by ELISA was negative.

Cell treatment with virion particles or gp120

Day 6 MDDCs or freshly isolated LCs were seeded at 1 x 106 cells/ml and treated with either live HIVBaL (at 0.01–100 µg/106 cells equivalent to a multiplicity of infection (MOI) 0.03–300 TCID50/cell) or the equivalent amount of AT-2-treated HIV (BaL) as determined by p24 gag ELISA and serial dilution Western blot and densitometry, or with recombinant monomeric gp120 at 50 ng/ml-5 µg/ml (purified from laboratory adapted BaL strain from AIDS Research and Reference Reagent Program, National Institutes of Health, or SLCA-1 primary R5 strain courtesy of Dr. J. Arthos, National Institutes of Health, Bethesda, MD (42)), or mock treated.

Biotinylated gp120-binding assay

Both gp120 species were biotinylated and added to day 6 MDDCs suspended in binding buffer (RPMI 1640, 10 mM HEPES, 1% BSA (pH 7.4) at 1 x 107 cells/ml to final concentrations ranging from 2.5 to 120 µg/ml gp120 and incubated at 4°C for 30 min as previously described (37). After washing in FACS wash (PBS, 0.1% BSA, 0.1% sodium azide), the cells were incubated 4°C for 30 min in the presence of streptavidin-PE 0.5 µg/ml (BD Pharmingen) before being analyzed by flow cytometry.

Determination of HIV-1 infectivity by real-time PCR

HIV-1 DNA in the lysate was quantified by real-time PCR for HIV-1 LTR-gag DNA in an ABI 7700 (Applied Biosystems/PerkinElmer) using primers and molecular beacon as previously described (11, 43). Cell numbers were estimated by albumin DNA using the primers 5'-TGCATGAGAAAACGCCAGTAA-3' and 5'-ATGGTCGCCTGTTCACCAA-3' and the molecular beacon: 5'-FAM CGCCATGACAGAGTCACCAAATGCTGCACAGAATGGCC Dabcyl-3'.

Preparation of labeled cDNA and hybridization to microarrays

Total RNA from four independent experiments was extracted from frozen cell pellets using the RNAqueous-Midi kit (Ambion), quantified by UV spectroscopy and the integrity confirmed by gel electrophoresis. The mRNA was subsequently amplified using the messageAMP kit (Ambion) before the SuperScript Indirect cDNA Labeling Core kit (Invitrogen Life Technologies) was used to reverse transcribe the amplified RNA in the presence of aminoallyl and aminohexyl modified dNTPs followed by incorporation of Cy3 or Cy5 (Amersham Biosciences) fluorochromes into the cDNA. Combinations of fluorescently labeled amplified RNAs were then hybridized (in a closed loop design, see Fig. 1) to Human ResGen 8k (Australian Genome Research Facility) glass microarrays containing 8000 human cDNAs spotted in duplicate. The list of genes spotted onto each of the microarrays is available at <www.agrf.org.au>.


Figure 1
View larger version (10K):
[in this window]
[in a new window]

 
FIGURE 1. Diagrammatic representation of the combinations of fluorescently labeled cDNAs that were hybridized to the 8 K microarrays.

 
Analysis of microarray data

The hybridized microarrays were scanned using an Axon GenePix 4000B scanner and images were processed using GenePix 5.0 software. Following data extraction, all analyses were undertaken using the R (version 2.0.0) statistical computing environment and BioConductor (version 1.5). Following subtraction of the mean of the local background, low quality spots were weighted as 0.1. A weighted normalization was applied using the robust splines technique (limma package) and low quality spots and controls removed from further analysis. The M value, or log2 of the ratio of Cy5 to Cy3 background-subtracted intensities was used as a measure of relative expression (44). We used Bayesian linear modeling methods (limma package) for ranking genes based on their probability of being differentially expressed (45, 46). The empirical Bayes approach applies linear modeling to derive "B" values for each transcript, which were used to rank genes most likely to be differentially expressed. As illustrated below, a linear model was fitted for each time point and transcripts generating a B value >0 (50% odds of differential expression) and containing a change in expression of >1.5-fold (arbitrary estimate of change required for a biological effect) were defined as differentially expressed (Table I).


View this table:
[in this window]
[in a new window]

 
Table I. Linear model applied to microarray expression set

 
Real-time PCR

Real-time RT-PCR was used to determine the expression levels of genes encoding MDDC cell surface markers. Total unamplified RNA was DNase I treated (Promega), reverse transcribed using oligo d(T) and Superscript III followed by RNase H treatment (Invitrogen Life Technologies). The cDNA was then subject to quantitative PCR using defined primers and SYBR Green (Invitrogen Life Technologies) and PCR amplicons measured in an ABI 7700 (Applied Biosystems/PerkinElmer). The relative quantitation method ({Delta}{Delta} cycle threshold) (47) was used to evaluate the expression of selected genes with the GAPDH, β-actin, and β2-microglubulin 2m) amplicons as an internal control and the normalizer for all data. PCR assays were performed for a total of five experiments. The primers used were as follows: CD1a (forward (F)) CCACGTTTCATCTTGGGTCT; CD1a (reverse (R)) ATCCTGAGACATGGCACACA; CD40(F) CTGTTTGCCATCCTCTTGGT; CD40(R) TCGGGAAAATTGATCTCCTG; CD80(F) AGGGAACATCACCATCCAAG; CD80(R) CATTGTGACCACAGGACAGC; CD83(F) GGTTCCCTACACGGTCTCCT; CD83(R) AGAACCATTTTGCCCCTTCT; CCR7 (F) GGGGAAACCAATGAAAAGC; CCR7 (R) CCTCATCTTGACACAGGCATAC CD86(F) AGCACAGACACACGGATGAG; CD86(R) GGAAGGCCATCACAAAGAGA; CXCR4(F) CAGCAGGTAGCAAAGTGACG; CXCR4(R) ATAGTCCCCTGAGCCCATTT; DC-SIGN(F) TTCACCTGGATGGGACTTTC; DC-SIGN(R) CTAAATTCCGCGCAGTCTTC; MR(F) CAGCAACGTCACCAAAGAAA; MR(R) CTGTGCCTCTGACCACTTCA; GAPDH(F) CCACATCGCTCAGACACCAT; GAPDH(R) CCAGGCGCCCAATACG; β-actin(F) CTCTTCCAGCCTTCCTTCCT; β-actin(R) AGCACTGTGTTGGCGTACAG; β2m(F) GTGCTCGCGCTACTCTCTCT; β2m(R) TCAATGTCGGATGGATGAAA.

Abs and flow cytometry

PE- and FITC-conjugated IgG1,{kappa} mouse mAbs for were obtained from Sigma-Aldrich. Mouse monoclonal allophycocyanin-conjugated IgG1,{kappa} and allophycocyanin-conjugated Abs specific for human CD1a and CD86, FITC-conjugated CD1a, CD40, and DC-SIGN, and PE-conjugated CD86 were obtained from BD Pharmingen. Unconjugated mouse mAb specific for human CCR5 (clone 2D7), PE-conjugated CD80 and HLA-DR as well as PerCP-conjugated HLA-DR were obtained from BD Biosciences. mAbs for MR-PE, langerin-PE, and CD83-FITC were obtained from Immunotech. For all experiments IgG1,{kappa} isotype control Abs were incubated with cells to control for nonspecific binding. Cells were then analyzed with FACSCalibur and CellQuest software (BD Biosciences).

Stimulation of allogeneic T lymphocytes by MDDCs

PBMCs were labeled with CFSE using the CellTrace CFSE Cell Proliferation kit (Invitrogen Life Technologies) as per the manufacturer’s instructions. A total of 1.5 x 106 CFSE-labeled PBMCs (at 1.5 x 106/ml) was either treated with 5 µg/ml PHA or mixed with iMDDCs, mature MDDCs or iMDDCs that had been pretreated with live or AT-2-inactivated HIV-1BaL at a ratio of 1:10. After 5 days in culture, the CFSE fluorescence was determined by flow cytometry with FACSCalibur and CellQuest software (BD Biosciences).

CCL21 chemotaxis assay

Day 6 iMDDCs were pretreated with live or AT-2-inactivated HIV-1BaL or maturation mixture for 48 h before being washed and resuspended in RPMI 1640 (+10% FCS) and transferred into the upper chamber of 8-µm pore size polycarbonate filters in 12-well transwell chambers (Corning; Costar). The lower chambers contained 600 µl of RPMI 1640 supplanted with 100 ng/ml CCL21 (R&D Systems). Lower chambers with RPMI 1640 only served as controls for spontaneous migration. After 2 h, the migrated cells from the bottom chamber were spun and fixed in PBS/4% formaldehyde and counted. The total number of cells migrated due to CCL21 was divided by the number of spontaneously migrated cells, and values are given as fold migration.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Treatment of MDDCs with HIV-1

iMDDCs were either mock treated or treated with highly concentrated, purified viable R5 HIV-1BaL strain at MOI 10 (3.5 µg of p24/106 cells) or the equivalent concentration of AT-2-inactivated virus. The high MOI was designed to expose all the cells to the virus in a one-step growth curve and reduce domination of results by bystander effects. High purity maximizes specific effects due to exposure to HIV-1 rather than cell debris, cytokines, or other contaminants. MDDCs were also exposed to recombinant monomeric gp120BaL at 50 ng/ml, which provided a different source of gp120 and different set of potential contaminants to AT-2-inactivated HIV-1 (48, 49). The percentage of HIV-1-infected cells was determined at 6, 24, and 48 h posttreatment by real-time PCR for HIV DNA, which was only detected in those cells treated with live HIV-1BaL and ranged from 8 to 30% of cells infected after 48 h. However, previous confocal microscopy studies of MDDCs infected by a similar concentration of this HIV-1BaL showed >95% of MDDCs to be p24 Ag positive at 2 h after completion of the HIV pulse (11), suggesting that only a proportion of MDDCs initially positive for p24 Ag show evidence of infection at 48 h.

Genes encoding DC maturation markers are some of the most highly differentially expressed cellular genes in HIV-exposed MDDCs

To determine the genes differentially expressed in MDDCs in response to HIV-1 binding, entry, and replication, labeled cDNAs derived from MDDCs treated with medium alone, live HIV-1BaL, AT-2 treated HIV-1BaL, or recombinant gp120 for 6, 24, and 48 h were cross-hybridized in various combinations to 8 K cDNA microarrays as illustrated in Fig. 1. For cellular genes differentially expressed in response to the full virus replication cycle cDNA derived from MDDCs treated with HIV-1BaL was compared with medium. To dissect which genes from this list were differentially expressed as result of binding, entry, or later stages of replication, three additional comparisons were conducted: medium with gp120 for HIV-1 binding; AT-2-inactivated HIV-1 with gp120 for postbinding viral entry; and AT-2-inactivated HIV-1 with live HIV-1 for events in the later stages of the replication cycle. As four independent experiments each from an independent donor were conducted at each time point, a total of 48 combinations of microarrays were hybridized. Differential expression data for genes encoding proteins associated with DC maturation is presented in Table II. In MDDCs infected with live virus for 48 h, 334 genes were significantly up-regulated and the gene-encoding CD83, which is expressed de novo during maturation, was ranked first, with an 8-fold increase compared with medium-treated cells. Genes encoding two other DC maturation markers were also significantly up-regulated, CD80 showing a 2.3-fold increase (ranking 67 of 334) and CD40 showing a 1.8-fold increase (ranking 144 of 334). Furthermore, the gene encoding CXCR4, known to be up-regulated on maturing DCs, was also up-regulated 4.3-fold (ranking 15 of 659). Finally, there was a 1.9-fold decrease (ranking 74 of 324) in the expression of the CD1a gene, all providing evidence that live HIV-1 influences the expression of DC maturation genes. Interestingly, AT-2-treated virions that can bind to and enter cells also significantly influenced the expression of DC maturation markers, though not to the same extent as live virus. Thus, CD83 was the most up-regulated marker showing a 3.9-fold increase (ranking 7 of 162) and CD80, CD40, and CXCR4 were also up-regulated showing a 1.4-, 1.9-, and 1.4-fold increase, respectively. Finally, CD1a was down-regulated 1.6-fold. Interestingly, cells treated with gp120 (at 50 ng/ml) showed no differential expression of any DC maturation genes. For all treatments, similar patterns were seen at the 24 h time point though fold changes were lower. Taken together, this data indicates that HIV-1-treated DCs alter the expression of genes encoding maturation markers and that this may be as a result of virus entry and/or binding, and is enhanced by viral replication. This hypothesis was supported by the fact that the difference in maturation marker gene expression between cells treated with live and AT-2-inactivated HIV-1 within each experiment was significantly associated with the percentage of cells infected in the live sample (Spearman correlation = 1, p < 0.01 for CD83 and CXCR4); e.g., CD83 was up-regulated 25-, 15-, 5-, and 3-fold when 30, 22, 10, and 8% of the total cells were infected, respectively. In contrast, in cells treated with AT-2-inactivated HIV-1 CD83 was up-regulated 2-, 3-, 5-, and 3-fold in the same experiments, respectively. Microarray results for the other functional groups of differentially expressed genes are being prepared in a separate manuscript.


View this table:
[in this window]
[in a new window]

 
Table II. Microarray derived differential expression data for genes encoding maturation markersa

 
HIV-1 leads to partial but significant differential expression of DC maturation genes compared with a potent maturation stimulus

Real-time PCR was used to confirm the altered expression levels of the DC maturation genes and also included four genes encoding maturation markers not represented on the microarrays, CD86 and CCR7 (up-regulated by maturing DCs and involved in T cell activation and DC migration, respectively), and two CLRs DC-SIGN and MR, which are down-regulated on mature DCs (50). The effects of live and inactivated HIV-1 and gp120 were compared with a positive control "maturation mixture" containing PGE2, TNF-{alpha}, IL-1β, and IL-6, using total RNA from all four microarray experiments and from an additional fifth experiment. In view of the recent concerns regarding the use of "housekeeping genes" to normalize real-time PCR data (51, 52), we used three standard genes; GAPDH, β-actin, and β2m. There was a strong correlation between the gene expression data obtained from microarrays and that obtained from real-time PCR (Table III). Thus, treatment with gp120 showed no detectable differences in DC maturation gene expression levels (data not shown) whereas exposure to either live or inactivated HIV-1BaL altered the expression of all the previously studied maturation genes spotted on the microarrays. In addition, the expression of the genes encoding CCR7 and CD86 were up-regulated, although in the case of CD86 to a much lesser degree than the other up-regulated markers. The gene expression of DC-SIGN and MR was significantly down-regulated. In almost every case (24 of 27), maturation genes were differentially expressed to a greater degree in cells treated with live rather than inactivated virus. The probability of this result occurring purely by chance is <0.001 (sign test). However, in a gene-by-gene comparison the difference in gene expression levels between viable and inactivated HIV-1-treated cells was only statistically significant for CXCR4 and CD1a (p < 0.05 paired t test). In concordance with the microarray data, the magnitude of differences between live and inactivated HIV-1 was proportional to the percentage of cells infected (data not shown). The HIV-1-induced change in maturation marker gene expression was only partial compared with treatment with the cytokine maturation mixture. Furthermore, with the cytokine mixture, among the three housekeeping genes, only GAPDH proved reliable, whereas with live or inactivated HIV-1, all three were reliable normalizers. As fully maturing DCs significantly change their morphology and MHC class I expression, it is not surprising that the genes encoding β-actin and β2m were also altered in their expression levels.


View this table:
[in this window]
[in a new window]

 
Table III. Real-time PCR derived differential expression data for genes encoding DC maturation markersa

 
Differential expression of genes encoding DC maturation markers results in a parallel change in surface expression

Changes in surface expression of the DC maturation markers after exposure to either maturation mixture, gp120BaL, gp120SLCA-1, live HIV-1BaL, AT-2-inactivated HIV-1BaL, or mock for 48 h were studied by flow cytometry using fluorophore-conjugated mAbs to CD1a, CD40, CD80, CD83, CD86, CXCR4, DC-SIGN, and MR (Fig. 2A). No significant changes were detected in cells treated with either source of purified gp120 ranging from 50 ng/ml to 5 µg/ml (data not shown), despite the fact that both biotinylated gp120s in parallel with biotinylated mannan, a natural CLR ligand, demonstrated specific binding to MDDCs at this range of concentrations (data not shown). As previously shown, gp120SLCA-1 was able to bind soluble CD4 as demonstrated by immunoprecipitation (42). In response to live or inactivated HIV-1 differential surface expression of the maturation markers correlated with changes at the mRNA level, with the exception of CD86 which showed the least change in mRNA levels (Table III) but greatest in surface expression. As with the gene expression studies, HIV-1 induced partial yet significant changes in gene expression of cell surface markers when compared with a potent maturation stimulus. Furthermore, the live virus-induced significantly greater alterations in the surface expression of maturation markers than the inactivated virus (Fig. 2 and see Fig. 6). In addition only a subset of viable HIV-1-treated cells expressed increased surface levels of maturation markers compared with cells treated with the maturation mixture, correlating with the fact that only 8–30% of the cells were infected with the virus (Fig. 2B). In contrast to another report (36), similar results were obtained from all blood donors used.


Figure 2
View larger version (17K):
[in this window]
[in a new window]

 
FIGURE 2. HIV-1 treatment induces phenotypic maturation of DCs. iMDDCs were treated with live or AT-2-inactivated HIV-1BaL (3.5 µg of p24/106 cells/MOI 10) or with a cytokine maturation mixture. After 48 h, cells were collected and analyzed by flow cytometry. A, The histogram illustrates the fold change in surface expression of maturation markers on treated cells compared with mock-treated cells. The data from 10 experiments are shown with SE bars. Those markers that show a statistically significant difference in differential expression between cells treated with viable and AT-2-inactivated HIV-1 after Bonferroni correction for multiple comparisons are marked with * (p < 0.03). B, FACS plots from a representative experiment illustrate that only a subset of HIV-1-treated cells show increased CD83 and CD86 expression compared with cells treated with a maturation mixture.

 

Figure 6
View larger version (18K):
[in this window]
[in a new window]

 
FIGURE 6. Anti-CCR5 Ab (clone 2D7) blocks additional DC maturation attributed to live but not AT-2-inactivated HIV-1. iMDDCs were treated with either live or AT-2-inactivated HIV-1BaL (3.5 µg of p24/106 cells/MOI 10) in the presence or absence of anti-CCR5 Ab at 2.5 mg/ml. After 48 h, the cells were collected and (A) the percentage of infected cells was determined by real-time PCR (representative data from one experiment shown), and (B) the cell surface expression levels of CD40, CD80, CD83, and CD86 were determined by flow cytometry (expression levels are presented as the percentage of cell surface expression compared with cells treated with live HIV-1 at MOI 10 and are the mean of three independent experiments ± SE). As indicated by * for each maturation marker, the difference in surface expression in live HIV-1-treated cells in the presence vs absence of anti-CCR5 Ab was statistically significant (p < 0.05 least significant difference multiple comparison).

 
Increased surface expression is dependent on the concentration of HIV-1

The effect of varying concentrations of inactivated and viable virus on the altered cell surface expression of DC maturation markers was investigated. DCs were treated with a range of live HIV-1 concentrations (MOI 0.03, 0.3, 3, 30, or 300 as determined by TCID50 in PM1 cells) and the equivalent dose of AT-2 inactivated HIV. Cell surface marker expression increased with increased MOI of either live or AT-2 inactivated virus particles (especially at MOI ≥3, Fig. 3).


Figure 3
View larger version (13K):
[in this window]
[in a new window]

 
FIGURE 3. The effect of live and AT-2-inactivated HIV-1BaL on DC maturation is dose dependent. iMDDCs were treated with different concentrations of (A) live or (B) AT-2-inactivated HIV-1BaL ranging from 100 to 0.01 µg of p24/106 cells corresponding to an MOI of 300-0.03. After 48 h, cells were collected and the expression of cell surface molecules was determined by flow cytometry. This experiment was repeated three times and the data from one representative experiment are shown.

 
DCs exposed to HIV-1 can still undergo full maturation

Using a low viral inoculum, reports on the ability to further up-regulate the surface maturation markers on HIV-1-treated MDDCs by a potent maturation stimulus are contradictory (32, 33). Therefore, we repeated these studies using our purified high titer virus stock. DCs were either mock treated or exposed to live HIV-1 or AT-2-inactivated HIV-1 (at MOI 10), in the presence or absence of a cytokine maturation mix and the level of cell surface expression of maturation markers determined 48 h posttreatment. In addition, a cytokine maturation mix was added to MDDCs 48 h after HIV-1/mock treatment and marker levels determined another 24 h later. In both experimental designs, HIV-1-treated DCs are fully able to mature (Fig. 4). Thus, treatment with high titer purified HIV-1BaL does not inhibit further DC maturation after exposure to a more potent stimulus.


Figure 4
View larger version (16K):
[in this window]
[in a new window]

 
FIGURE 4. HIV-1 does not inhibit the ability of immature DCs to undergo maturation. A, iMDDCs were treated with either live or AT-2-inactivated HIV-1BaL alone (3.5 µg of p24/106 cells/MOI 10), or in the presence of a cytokine maturation mix. After 48 h, cells were collected and the expression of cell surface molecules was determined by flow cytometry. B, Immature DCs were mock treated or treated with live HIV-1BaL, or inactivated HIV-1BaL (3.5 µg of p24/106 cells/MOI 10) or a cytokine maturation mix. Forty-eight hours posttreatment, a cytokine maturation mix was added to half the live HIV-1- and AT-2-inactivated HIV-1-treated DCs. Twenty-four hours later, the cells were collected and the expression of cell surface molecules was determined by flow cytometry. The data presented are from one of three representative experiments.

 
HIV-1-treated MDDCs can stimulate T cell proliferation in a MLR

To determine whether HIV-1-treated, partially mature DCs could stimulate T cells in a MLR, CFSE-labeled PBMCs were mixed with MDDCs pretreated with varying doses of live or AT-2-inactivated HIV-1 virions or with a cytokine maturation mixture. After 5 days, the proportion of T cells that had proliferated was determined by measuring CFSE dilution by flow cytometry. Live/inactivated HIV-1 induction of partial maturation of DCs was associated with by an increased ability to induce T cell proliferation (Fig. 5A). Consistent with the effects on maturation markers, live HIV-1 was more efficient at T cell stimulation than the AT-2-inactivated virus and the effect was concentration dependent.


Figure 5
View larger version (19K):
[in this window]
[in a new window]

 
FIGURE 5. HIV-1-treated MDDCs show enhanced CCR7-mediated migration and are able to stimulate T cells in a MLR. A, iMDDCs were treated with 5 mg/ml PHA, a cytokine maturation mixture or with different concentrations of live or AT-2-inactivated HIV-1BaL ranging from 30 to 0.03 µg of p24/106 cells corresponding to a MOI of 30–0.03. After 48 h, 1 x 105 treated MDDCs were mixed with 9 x 105 CFSE-labeled PBMCs and were cultured for an additional 5 days. Cells were then collected and the degree of T cell proliferation was determined by comparing the CFSE dilution by flow cytometry. B, iMDDCs were treated with a cytokine maturation mixture or with live or AT-2-inactivated HIV-1BaL (3.5 µg of p24/106 cells/MOI 10) for 48 h before being transferred to the upper chamber of a Transwell plate. Media either supplemented with 100 ng/ml CCL21 or unsupplemented was placed in the lower chamber. After 2 h, any cells that had migrated to the lower chamber were removed, fixed in 4% formaldehyde, and counted. For each treatment, the total number of cells that migrated in the presence of CCL21 was divided by the number of migrated cells in the absence of CCL21. The data from three experiments are shown with SE bars.

 
HIV-1-treated MDDCs show enhanced migration toward CCL21

To investigate whether HIV-1 treatment of iMDDCs resulted in enhanced CCR7-mediated chemotaxis, iMDDCs were either pretreated with viable or AT-2-inactivated HIV-1 or a cytokine maturation mixture or untreated and compared in their ability to migrate toward the CCR7 agonist CCL21 or medium alone, using Transwell chambers. In concordance with the data presented thus far, CCL21 induced a 15-, 8-, 5-, and 3-fold increase in migration of maturation mixture, viable HIV-1, AT-2-inactivated HIV-1 or medium only treated MDDCs, respectively (Fig. 5B).

Inhibition of maturation effects induced by live but not inactivated HIV by a CCR5 Ab

The consistently greater degree of MDDC maturation induced by live virus compared with inactivated virus suggests that HIV-1-associated DC maturation occurs by at least two mechanisms, especially as the AT-2-inactivated virus was derived from the same stock as the live virus and adjusted to the same concentration of viral particles. Such mechanisms might occur during endocytosis and subsequent trafficking or in the alternative minor pathway, binding/fusion via CD4/CCR5 and additional steps in the replication cycle. To distinguish mechanisms associated with these two pathways, we compared the effects of both live and inactivated HIV-1 on DC maturation in the presence or absence of an Ab directed against CCR5 (clone 2D7) that will block virus entry and therefore replication, but that will have no effect on Ag uptake via CLR-mediated endocytosis. Treatment of MDDCs with anti-CCR5 had no significant effect on the ability of AT-2-inactivated HIV-1 to induce DC maturation but it significantly reduced the effect on maturation caused by live HIV-1 by at least 20–40%, for CD40, CD80, CD83, and CD86 (p < 0.05) (Fig. 6B) and reduced the infection of MDDCs by 50% (Fig. 6A). This shows that a proportion of the enhanced effects on maturation by live HIV-1 are mediated via CCR5 but live HIV-1 also induces non-CCR5-mediated effects on maturation, whereas the effects of inactivated HIV-1 are mostly non-CCR5 mediated.

HIV-1 also leads to partial maturation of LCs

Finally, to determine whether the effect of HIV-1 on MDDC maturation could also be demonstrated on native ex vivo DCs, we exposed LCs freshly isolated from human skin to HIV-1 at high MOI of 10. The LCs were examined for maturation markers at 24 h postinfection because longer durations (48 h) resulted in spontaneous maturation and higher backgrounds (e.g., mean CD80 and CD83 levels were 4 and 3% at 0 h, 8 and 10% at 24 h and at 16 and 20% at 48 h, respectively). At 24 h postinfection, there was a marked and significant increase in CD40, CD80, CD83, and CD86 expression on HIV-1-treated LCs compared with mock infection. The HIV-induced effects were only marginally less than that induced by the maturation mixture (Fig. 7), probably reflecting the less marked effect of the mixture in inducing maturation of LCs compared with MDDCs after 24 h of exposure (data not shown).


Figure 7
View larger version (9K):
[in this window]
[in a new window]

 
FIGURE 7. HIV-1 treatment induces phenotypic maturation of LCs. Ex vivo LCs were treated with live HIV-1BaL (3.5 µg of p24/106 cells MOI 10), a cytokine maturation mixture or mock treated with medium only. After 24 h, cells were collected and the percentage of cells that expressed cell surface molecules was determined by flow cytometry. The results are presented as a mean with the SE bars from three independent experiments shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The investigation of the effect of HIV-1 on the maturation of iMDDCs and epidermal LCs in this study was stimulated by the findings of rigorous microarray experiments using the MDDC model. In these experiments, the effects of recombinant soluble monomeric HIV-1BaL gp120 as well as high concentrations of highly purified HIV-1BaL live and AT-2-inactivated virus stocks were compared with mock-treated MDDCs. AT-2-treated virus particles, which retain normal structure and function of envelope proteins, can bind to and enter cells but are blocked in their life cycle at the stage of reverse transcription (53). The AT-2-inactivated viral inocula were derived from the live virus preparations and volume adjusted according to p24 content to ensure the concentration of virus particles, viable or nonviable was equivalent. The microarray experiments were designed to extract the most biologically interesting information with the maximum accuracy and statistical efficiency possible across a series of time points. In particular, the experiments were analyzed with a linear model using empirical Bayes methods to identify differences in expression of transcripts between, live HIV-1 vs medium, live vs inactivated HIV-1, inactivated HIV-1 vs gp120 and gp120 vs medium, and the secondary (indirect) comparisons, inactivated HIV-1 vs medium and gp120 vs HIV-1. Thus, comparison of live HIV-1 with inactivated HIV-1 allowed for similarities in the early part of the replication cycle (up to reverse transcription) and differences thereafter; comparison of inactivated HIV-1 with gp120 allows similarities with binding to CD4 and CCR5 but differences thereafter. Comparisons of results with live and inactivated viruses vs medium and then live vs inactivated viruses also provides corroborative data. Furthermore, the use of both inactivated virus and soluble recombinant gp120 provide different sources of potential contaminants and strengthens any similarities obtained with the two different reagents.

Such rigor is important in investigating the effects of HIV-1 on MDDCs where two different processes are occurring at different kinetics. First, most virus (probably >90%) is taken up via endocytosis after binding to DC-SIGN and mannose receptor (37) and, in the absence of T cells, degraded almost completely within 12 h (11). A lesser proportion of the virus bound to CLRs (probably <10%) is transferred to CD4/CCR5, probably at the cell surface, and enters the DC cytoplasm via viral fusion with the cell membrane, followed by de novo replication. HIV-1 DNA levels then increase over 48 h as previously shown (11). Thus, inactivated HIV-1 or gp120 may influence the host cell gene expression by signaling through the CLRs on the cell surface, via TLRs in the endosome, or after transfer from CLRs to CD4 and CCR5 on the surface. In addition, live HIV-1 may influence gene expression via these mechanisms or at later stages of the replication cycle.

Somewhat surprisingly, CD83 was found to be the gene whose expression was most changed by live virus in comparison with medium (8-fold increase). Other maturation markers, including CXCR4, CD80, and CD40, were also found to be significantly increased (4.3- to 1.8-fold changes) and the magnitude of these changes was significantly correlated with the extent of infection. Inactivated virus also led to significant changes in most of these maturation markers but to a lesser extent and no correlation with the infectability of the donor cells (as assessed in the parallel treatments using live virus). In contrast, monomeric gp120 induced no significant changes. Most of the changes in MDDCs were significant at 24 h but more marked at 48 h. These findings were confirmed and extended by real-time PCR where down-regulation of the CLRs, MR, and DC-SIGN, up-regulation of CCR7 and a minor up-regulation of CD86, were also observed. Similar findings were observed with flow cytometry and a strong correlation between transcriptional and posttranscriptional changes was observed except for the marked increase in CD86 which was posttranscriptional only. With both live and inactivated virus, the effects were found to be highly concentration dependent with the most marked effects on CD83 and CD86 being demonstrated above an MOI ≥3. Purity of the virus preparations is also highly likely to be important as contaminating cytokines may have variable effects on DC maturation. Cytokines would be excluded by the highly purified, high titer preparations used in these experiments and no residual TNF-{alpha} was detected in any virus stocks, though they may still have contained some contaminating microvesicles. However, the differences induced by very similar concentrations of AT-2-inactivated and live virus and the partial but significant inhibition of the live virus effects by an anti-CCR5 Ab demonstrated that the virus is clearly mediating the effect.

The reported effects of HIV-1 or gp120 on maturation of MDDCs are contradictory and confusing (32, 33, 35, 36). Our study of the model MDDCs places such changes in the context of the effects of HIV-1 on global gene expression. The published reports used widely differing conditions which probably explain the widely differing results. In particular, three of the four studies used quite low titers of HIV-1 (32, 35, 36) and the failure of two reports (32, 33) to demonstrate effects on maturation markers may be due to these low titers and low purities, as strongly suggested by our results on the concentration dependence of the HIV-1 inoculum. None examined the full complement of maturation markers and only surface expression of proteins was examined, not RNA. The induction of partial maturation of blood myeloid DCs (especially CD86 expression) by live HIV-1 (54) showed marked similarities to our own results using high titer viruses on MDDCs. We were unable to duplicate a report of high titer R5 strain gp120 induction of MDDC maturation (35) despite using soluble recombinant gp120 from both laboratory adapted (BaL) and primary (SLCA-1) R5 strains at similar or higher concentrations (as immature MDDCs express CCR5 rather than CXCR4, and are preferentially infected by R5 strains, the use of R5 rather than X4 strain gp120 is appropriate). Both gp120 species bound normally to MDDCs even after biotinylation demonstrating that their conformation was preserved. The failure of gp120 to induce stimulation of any of the maturation markers, compared with the effects of inactivated or live virus in our study suggest that either oligomeric gp120 in its native conformation is required for the stimuli or, more likely, that endosomal uptake or entry of inactivated virus and/or replication of live virus are the key stimulatory steps. The marked concentration dependence of live HIV-induced maturation may be partly explained by the predominance of CLR-mediated endosomal uptake and degradation over entry by fusion with the plasma membrane. Relatively high MOI (≥3) may be required to achieve infection of a significant proportion of the cell sheet, sufficient to induce the observed changes in host gene expression This agrees with the observed correlation between the extent of infection of DCs from different donors (despite equivalent exposure to virus) and the magnitude of maturation marker differential gene expression in response to live HIV-1. Furthermore, these high concentrations of inactivated virus may be required to overcome the high proportion (probably >90%) of bound virus which undergoes CLR-mediated endosomal uptake and degradation. This may explain some of the differences in findings between the published reports with MDDCs. The loss of virus through endolysosomal degradation and the fact that HIV-1-infected activated T cells are present in semen and may have burst sizes of over 1000 virions per cell (55) justify the concentration of virus used in this study. The local HIV-1 concentrations in vivo could well deliver such MOI to epithelial LCs across "microabraded" noncornified mucosal epithelium. Interestingly, if the concentration dependence of live HIV-induced maturation is indeed due to the fact that most virus is lost through CLR-mediated uptake and degradation, the absence of DC-SIGN and MR expression on myeloid DCs may allow viruses to exclusively induce maturation of these cells via CD4/CCR5 (54) and a direct comparison with MDDCs would therefore be interesting.

Comparison of the effects of the virus on MDDCs with maximal maturation stimuli (a mixture of TNF-{alpha}, IL-1, IL-6, and PGE2) showed that virus-induced maturation was only partial. Is this virus-induced maturation aberrant or just partial? Why does the virus induce CD83 and CD80 mRNA and proteins differently to the maturation mixture? Furthermore, some of the previous studies mentioned above demonstrate that HIV-1-infected DCs either could not be induced to maximal maturation (higher expression of maturation markers) (32, 33, 35, 36) and/or were functionally deficient (32, 35) and/or produced low levels of Th1 cytokines (32, 33). However, our studies with relatively high titer pure virus showed the ability of conventional maturation stimuli to enhance the (partial) maturation and migration of HIV-1-infected DCs and demonstrated that effects of HIV-1 are not mediated through an aberrant "dead end" pathway. Furthermore, this partial maturation was functionally important as these DCs had an increased ability to stimulate T cell proliferation in a MLR and this was also enhanced with live virus. This data complements and supports the results of two other studies: one showed that such HIV-1 treatment of MDDCs induced migration (36) and the other showed that HIV-induced partial maturation of blood myeloid DCs which could still be induced to complete maturation by the TLR7/8 agonist R846 (54).

Thus, these results resolve the conflict in the literature about the effect of HIV-1 on maturation markers in MDDCs and demonstrate the reason that the conflict is probably due to the use of different titers and purities of virus inocula as well as individual variation in the susceptibility of MDDCs to infection. Our studies also indicate that these changes are some of the most important transcriptional changes in DCs induced by HIV-1 and show that the changes occur mostly at a transcriptional level, with the exception of CD86 where they are mostly posttranscriptional. Furthermore, the experiments on concentration dependence, comparison between live and inactivated virus and gp120 and inhibition by anti-CCR5 mAb strongly suggest that these effects are partly due to steps in the viral replication cycle beyond binding and entry.

The next step was to determine whether the effects of HIV infection on the model MDDCs were also observed in native dendritic cells, especially those exposed to HIV at the site of viral entry, immature epidermal LCs. To obtain these cells in the immature state, they were dissociated from epidermal explants using collagenase. Whether purified or not, these LCs slowly up-regulated maturation markers spontaneously over 48 h of observation, as previously reported in a study that used trypsin dissociation, which may cleave surface molecules (56). Nevertheless, such maturation was observed in both laboratories whether collagenase or trypsin digestion of cell sheets was used and whether unpurified, partially affinity purified, or density gradient purified LCs were used. Thus, it seems likely that LC maturation proceeds when these cells are exposed to dissection or deprived of contact with surrounding keratinocytes. Therefore, our experiments with HIV were conducted as early as possible, at 24 h postinfection, to determine whether HIV may accelerate this process. There was a marked and significant increase in all maturation markers including CD83. As with MDDCs, basal CD86 expression was much higher than the rest but still significantly up-regulated. This acceleration of maturation by HIV in both MDDCs and LCs is likely to be important in transfer of HIV from such infected cells to CD4 lymphocytes resident in the underlying submucosa or in the lymph nodes after migration. Thus, immature LCs which express high levels of CLRs, including langerin, and are highly endocytic, in the upper layers of the epidermis or genital tract mucosa are well-designed for maximal HIV binding and uptake. Initiation or acceleration of maturation through up-regulation of maturation markers by HIV infection augmented by HIV induced migration as suggested by the complementary results of Wilflingseder et al. (36) (now confirmed here) and/or danger signals from surrounding keratinocytes subjected to trauma or coinfection may all facilitate this process. Mature DCs have been well shown to more efficiently transfer virus and immature MDDCs up to contact to T cells probably through stronger and more stable attachments at "viral synapses" (57, 58). Furthermore, such HIV-1-induced maturation of myeloid or interstitial DCs may contribute to the characteristic T cell activation in HIV-1 infection and to transfer of HIV-1 to HIV-specific T cells.

The exact mechanisms of virus induction of these maturation stimuli need to be further dissected. Our results showing greater effects by live virus and partial inhibition by anti-CCR5 and those of Wilflingseder et al. (36) suggest there may be two mechanisms, one triggered by HIV-1 Ag endocytosis and conventional MAPK 38 pathways as for TNF-{alpha}, and the other induced by virus replication, probably beyond viral entry. Recent findings of up-regulation of DC maturation markers after gag RNA transfection (59) are consistent with the latter, suggesting an effect via TLRs. In addition, the effects that HIV-1 exerts on these DCs need to be confirmed in epithelial DCs in vivo. Nevertheless, the microarray results suggest these HIV-1-induced effects on maturation are important adaptations likely to assist the virus in its dissemination.


    Acknowledgments
 
We thank Claire Wolczak for help with manuscript preparation, Karen Byth for help with statistical analysis throughout the manuscript, Heather Donaghy for help with flow cytometry, Eleanor Hitchen for help in isolating LCs from skin, and Jim Arthos for providing the SLCA-1 strain of monomeric gp120.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by a National Health and Medical Research Council Program Grant ID 358399. Back

2 Address correspondence and reprint requests to Dr. Anthony L. Cunningham, Centre for Virus Research, Westmead Millennium Institute, Sydney, Australia. E-mail address: tony_cunningham{at}wmi.usyd.edu.au Back

3 Abbreviations used in this paper: DC, dendritic cell; CLR, C-type lectin receptor; MR, mannose receptor; LC, Langerhans cell; MDDC, monocyte-derived DC; iMDDC, immature MDDC; AT-2, aldrithriol-2; TCID50, 50% tissue culture infectious dose; MOI, multiplicity of infection; β2m, β2-microglobulin. Back

Received for publication May 25, 2006. Accepted for publication September 1, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Lanzavecchia, A., F. Sallusto. 2001. Regulation of T cell immunity by dendritic cells. Cell 106: 263-266. [Medline]
  2. Mellman, I., R. M. Steinman. 2001. Dendritic cells: specialized and regulated antigen processing machines. Cell 106: 255-258. [Medline]
  3. Banchereau, J., R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392: 245-252. [Medline]
  4. Turville, S., J. Wilkinson, P. Cameron, J. Dable, A. L. Cunningham. 2003. The role of dendritic cell C-type lectin receptors in HIV pathogenesis. J. Leukocyte Biol. 74: 710-718. [Abstract/Free Full Text]
  5. Schoenberger, S. P., R. E. Toes, E. I. van der Voort, R. Offringa, C. J. Melief. 1998. T-cell help for cytotoxic T lymphocytes is mediated by CD40-CD40L interactions. Nature 393: 480-483. [Medline]
  6. Hu, J., M. B. Gardner, C. J. Miller. 2000. Simian immunodeficiency virus rapidly penetrates the cervicovaginal mucosa after intravaginal inoculation and infects intraepithelial dendritic cells. J. Virol. 74: 6087-6095. [Abstract/Free Full Text]
  7. Knight, S. C.. 2001. Dendritic cells and HIV infection; immunity with viral transmission versus compromised cellular immunity?. Immunobiology 204: 614-621. [Medline]
  8. Sewell, A. K., D. A. Price. 2001. Dendritic cells and transmission of HIV-1. Trends Immunol. 22: 173-175. [Medline]
  9. Zhang, Z. Q., S. W. Wietgrefe, Q. Li, M. D. Shore, L. Duan, C. Reilly, J. D. Lifson, A. T. Haase. 2004. Roles of substrate availability and infection of resting and activated CD4+ T cells in transmission and acute simian immunodeficiency virus infection. Proc. Natl. Acad. Sci. USA 101: 5640-5645. [Abstract/Free Full Text]
  10. McDonald, D., L. Wu, S. M. Bohks, V. N. KewalRamani, D. Unutmaz, T. J. Hope. 2003. Recruitment of HIV and its receptors to dendritic cell-T cell junctions. Science 300: 1295-1297. [Abstract/Free Full Text]
  11. Turville, S. G., J. J. Santos, I. Frank, P. U. Cameron, J. Wilkinson, M. Miranda-Saksena, J. Dable, H. Stossel, N. Romani, M. Piatak, Jr, et al 2004. Immunodeficiency virus uptake, turnover, and 2-phase transfer in human dendritic cells. Blood 103: 2170-2179. [Abstract/Free Full Text]
  12. Garcia, E., M. Pion, A. Pelchen-Matthews, L. Collinson, J. F. Arrighi, G. Blot, F. Leuba, J. M. Escola, N. Demaurex, M. Marsh, V. Piguet. 2005. HIV-1 trafficking to the dendritic cell-T-cell infectious synapse uses a pathway of tetraspanin sorting to the immunological synapse. Traffic 6: 488-501. [Medline]
  13. Bosnjak, L., M. Miranda-Saksena, D. M. Koelle, R. A. Boadle, C. A. Jones, A. L. Cunningham. 2005. Herpes simplex virus infection of human dendritic cells induces apoptosis and allows cross-presentation via uninfected dendritic cells. J. Immunol. 174: 2220-2227. [Abstract/Free Full Text]
  14. Engelmayer, J., M. Larsson, M. Subklewe, A. Chahroudi, W. I. Cox, R. M. Steinman, N. Bhardwaj. 1999. Vaccinia virus inhibits the maturation of human dendritic cells: a novel mechanism of immune evasion. J. Immunol. 163: 6762-6768. [Abstract/Free Full Text]
  15. Moutaftsi, M., A. M. Mehl, L. K. Borysiewicz, Z. Tabi. 2002. Human cytomegalovirus inhibits maturation and impairs function of monocyte-derived dendritic cells. Blood 99: 2913-2921. [Abstract/Free Full Text]
  16. Beck, K., U. Meyer-Konig, M. Weidmann, C. Nern, F. T. Hufert. 2003. Human cytomegalovirus impairs dendritic cell function: a novel mechanism of human cytomegalovirus immune escape. Eur. J. Immunol. 33: 1528-1538. [Medline]
  17. Abendroth, A., G. Morrow, A. L. Cunningham, B. Slobedman. 2001. Varicella-zoster virus infection of human dendritic cells and transmission to T cells: implications for virus dissemination in the host. J. Virol. 75: 6183-6192. [Abstract/Free Full Text]
  18. Morrow, G., B. Slobedman, A. L. Cunningham, A. Abendroth. 2003. Varicella-zoster virus productively infects mature dendritic cells and alters their immune function. J. Virol. 77: 4950-4959. [Abstract/Free Full Text]
  19. Mikloska, Z., L. Bosnjak, A. L. Cunningham. 2001. Immature monocyte-derived dendritic cells are productively infected with herpes simplex virus type 1. J. Virol. 75: 5958-5964. [Abstract/Free Full Text]
  20. Jones, C. A., M. Fernandez, K. Herc, L. Bosnjak, M. Miranda-Saksena, R. A. Boadle, A. Cunningham. 2003. Herpes simplex virus type 2 induces rapid cell death and functional impairment of murine dendritic cells in vitro. J. Virol. 77: 11139-11149. [Abstract/Free Full Text]
  21. Salio, M., M. Cella, M. Suter, A. Lanzavecchia. 1999. Inhibition of dendritic cell maturation by herpes simplex virus. Eur. J. Immunol. 29: 3245-3253. [Medline]
  22. Fugier-Vivier, I., C. Servet-Delprat, P. Rivailler, M. C. Rissoan, Y. J. Liu, C. Rabourdin-Combe. 1997. Measles virus suppresses cell-mediated immunity by interfering with the survival and functions of dendritic and T cells. J. Exp. Med. 186: 813-823. [Abstract/Free Full Text]
  23. Grosjean, I., C. Caux, C. Bella, I. Berger, F. Wild, J. Banchereau, D. Kaiserlian. 1997. Measles virus infects human dendritic cells and blocks their allostimulatory properties for CD4+ T cells. J. Exp. Med. 186: 801-812. [Abstract/Free Full Text]
  24. Schnorr, J. J., S. Xanthakos, P. Keikavoussi, E. Kampgen, V. ter Meulen, S. Schneider-Schaulies. 1997. Induction of maturation of human blood dendritic cell precursors by measles virus is associated with immunosuppression. Proc. Natl. Acad. Sci. USA 94: 5326-5331. [Abstract/Free Full Text]
  25. Kakimoto, M., A. Hasegawa, S. Fujita, M. Yasukawa. 2002. Phenotypic and functional alterations of dendritic cells induced by human herpesvirus 6 infection. J. Virol. 76: 10338-10345. [Abstract/Free Full Text]
  26. Cella, M., M. Salio, Y. Sakakibara, H. Langen, I. Julkunen, A. Lanzavecchia. 1999. Maturation, activation, and protection of dendritic cells induced by double-stranded RNA. J. Exp. Med. 189: 821-829. [Abstract/Free Full Text]
  27. Ho, L. J., J. J. Wang, M. F. Shaio, C. L. Kao, D. M. Chang, S. W. Han, J. H. Lai. 2001. Infection of human dendritic cells by dengue virus causes cell maturation and cytokine production. J. Immunol. 166: 1499-1506. [Abstract/Free Full Text]
  28. Raftery, M. J., A. A. Kraus, R. Ulrich, D. H. Kruger, G. Schonrich. 2002. Hantavirus infection of dendritic cells. J. Virol. 76: 10724-10733. [Abstract/Free Full Text]
  29. Bhardwaj, N., A. Bender, N. Gonzalez, L. K. Bui, M. C. Garrett, R. M. Steinman. 1994. Influenza virus-infected dendritic cells stimulate strong proliferative and cytolytic responses from human CD8+ T cells. J. Clin. Invest. 94: 797-807. [Medline]
  30. Tavakoli, S., W. Schwerin, A. Rohwer, S. Hoffmann, S. Weyer, R. Weth, H. Meisel, H. Diepolder, M. Geissler, P. R. Galle, et al 2004. Phenotype and function of monocyte derived dendritic cells in chronic hepatitis B virus infection. J. Gen. Virol. 85: 2829-2836. [Abstract/Free Full Text]
  31. Longman, R. S., A. H. Talal, I. M. Jacobson, M. L. Albert, C. M. Rice. 2004. Presence of functional dendritic cells in patients chronically infected with hepatitis C virus. Blood 103: 1026-1029. [Abstract/Free Full Text]
  32. Granelli-Piperno, A., A. Golebiowska, C. Trumpfheller, F. P. Siegal, R. M. Steinman. 2004. HIV-1-infected monocyte-derived dendritic cells do not undergo maturation but can elicit IL-10 production and T cell regulation. Proc. Natl. Acad. Sci. USA 101: 7669-7674. [Abstract/Free Full Text]
  33. Smed-Sorensen, A., K. Lore, L. Walther-Jallow, J. Andersson, A. L. Spetz. 2004. HIV-1-infected dendritic cells up-regulate cell surface markers but fail to produce IL-12 p70 in response to CD40 ligand stimulation. Blood 104: 2810-2817. [Abstract/Free Full Text]
  34. Muthumani, K., D. S. Hwang, A. Y. Choo, S. Mayilvahanan, N. S. Dayes, K. P. Thieu, D. B. Weiner. 2005. HIV-1 Vpr inhibits the maturation and activation of macrophages and dendritic cells in vitro. Int. Immunol. 17: 103-116. [Abstract/Free Full Text]
  35. Fantuzzi, L., C. Purificato, K. Donato, F. Belardelli, S. Gessani. 2004. Human immunodeficiency virus type 1 gp120 induces abnormal maturation and functional alterations of dendritic cells: a novel mechanism for AIDS pathogenesis. J. Virol. 78: 9763-9772. [Abstract/Free Full Text]
  36. Wilflingseder, D., B. Mullauer, H. Schramek, Z. Banki, M. Pruenster, M. P. Dierich, H. Stoiber. 2004. HIV-1-induced migration of monocyte-derived dendritic cells is associated with differential activation of MAPK pathways. J. Immunol. 173: 7497-7505. [Abstract/Free Full Text]
  37. Turville, S. G., J. Arthos, K. M. Donald, G. Lynch, H. Naif, G. Clark, D. Hart, A. L. Cunningham. 2001. HIV gp120 receptors on human dendritic cells. Blood 98: 2482-2488. [Abstract/Free Full Text]
  38. Frank, I., M. Piatak, Jr, H. Stoessel, N. Romani, D. Bonnyay, J. D. Lifson, M. Pope. 2002. Infectious and whole inactivated simian immunodeficiency viruses interact similarly with primate dendritic cells (DCs): differential intracellular fate of virions in mature and immature DCs. J. Virol. 76: 2936-2951. [Abstract/Free Full Text]
  39. Chertova, E., J. W. Bess, Jr, B. J. Crise, I. R. Sowder, T. M. Schaden, J. M. Hilburn, J. A. Hoxie, R. E. Benveniste, J. D. Lifson, L. E. Henderson, L. O. Arthur. 2002. Envelope glycoprotein incorporation, not shedding of surface envelope glycoprotein (gp120/SU), is the primary determinant of SU content of purified human immunodeficiency virus type 1 and simian immunodeficiency virus. J. Virol. 76: 5315-5325. [Abstract/Free Full Text]
  40. Dettenhofer, M., X. F. Yu. 1999. Highly purified human immunodeficiency virus type 1 reveals a virtual absence of Vif in virions. J. Virol. 73: 1460-1467. [Abstract/Free Full Text]
  41. Montefiori, D.. 2004. Evaluating neutralizing antibodies against HIV, SIV and SHIV in a luciferase reporter gene assays. J. E. Coligan, Jr, and A. Kruisbeek, Jr, and M. Margulies, Jr, and D. H. Shevach, Jr, and E. M. Strober, Jr, and W. Coico, Jr, eds. In Current Protocols in Immunology Vol. 64: Wiley, New York.
  42. Mossman, S. P., F. Bex, P. Berglund, J. Arthos, S. P. O’Neil, D. Riley, D. H. Maul, C. Bruck, P. Momin, A. Burny, et al 1996. Protection against lethal simian immunodeficiency virus SIVsmmPBj14 disease by a recombinant Semliki Forest virus gp160 vaccine and by a gp120 subunit vaccine. J. Virol. 70: 1953-1960. [Abstract]
  43. Lewin, S. R., M. Vesanen, L. Kostrikis, A. Hurley, M. Duran, L. Zhang, D. D. Ho, M. Markowitz. 1999. Use of real-time PCR and molecular beacons to detect virus replication in human immunodeficiency virus type 1-infected individuals on prolonged effective antiretroviral therapy. J. Virol. 73: 6099-6103. [Abstract/Free Full Text]
  44. Yang, Y. H., S. Dudoit, P. Luu, D. M. Lin, V. Peng, J. Ngai, T. P. Speed. 2002. Normalization for cDNA microarray data: a robust composite method addressing single and multiple slide systematic variation. Nucleic Acids Res. 30: e15[Abstract/Free Full Text]
  45. Lonnstedt, I., T. Speed. 2002. Replicated microarray data. Stat. Sinica 12: 31-46.
  46. Smyth, G.. 2004. Linear models and empirical Bayes methods for assessing differential expression in microarray experiments. In Statistical Applications in Genetics and Molecular Biology Vol. 3:
  47. Livak, K. J., T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(–{Delta}{Delta}C(T)) method. Methods 25: 402-408. [Medline]
  48. Trubey, C. M., E. Chertova, L. V. Coren, J. M. Hilburn, C. V. Hixson, K. Nagashima, J. D. Lifson, D. E. Ott. 2003. Quantitation of HLA class II protein incorporated into human immunodeficiency type 1 virions purified by anti-CD45 immunoaffinity depletion of microvesicles. J. Virol. 77: 12699-12709. [Abstract/Free Full Text]
  49. Esser, M. T., D. R. Graham, L. V. Coren, C. M. Trubey, J. W. Bess, Jr, L. O. Arthur, D. E. Ott, J. D. Lifson. 2001. Differential incorporation of CD45, CD80 (B7-1), CD86 (B7-2), and major histocompatibility complex class I and II molecules into human immunodeficiency virus type 1 virions and microvesicles: implications for viral pathogenesis and immune regulation. J. Virol. 75: 6173-6182. [Abstract/Free Full Text]
  50. Turville, S. G., P. U. Cameron, A. Handley, G. Lin, S. Pohlmann, R. W. Doms, A. L. Cunningham. 2002. Diversity of receptors binding HIV on dendritic cell subsets. Nat. Immunol. 3: 975-983. [Medline]
  51. Bas, A., G. Forsberg, S. Hammarstrom, M. L. Hammarstrom. 2004. Utility of the housekeeping genes 18S rRNA, β-actin and glyceraldehyde-3-phosphate-dehydrogenase for normalization in real-time quantitative reverse transcriptase-polymerase chain reaction analysis of gene expression in human T lymphocytes. Scand. J. Immunol. 59: 566-573. [Medline]
  52. Bustin, S. A.. 2002. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J. Mol. Endocrinol. 29: 23-39. [Abstract]
  53. Gorelick, R. J., R. E. Benveniste, T. D. Gagliardi, T. A. Wiltrout, L. K. Busch, W. J. Bosche, L. V. Coren, J. D. Lifson, P. J. Bradley, L. E. Henderson, L. O. Arthur. 1999. Nucleocapsid protein zinc-finger mutants of simian immunodeficiency virus strain mne produce virions that are replication defective in vitro and in vivo. Virology 253: 259-270. [Medline]
  54. Smed-Sorensen, A., K. Lore, J. Vasudevan, M. K. Louder, J. Andersson, J. R. Mascola, A. L. Spetz, R. A. Koup. 2005. Differential susceptibility to human immunodeficiency virus type 1 infection of myeloid and plasmacytoid dendritic cells. J. Virol. 79: 8861-8869. [Abstract/Free Full Text]
  55. Eckstein, D. A., M. L. Penn, Y. D. Korin, D. D. Scripture-Adams, J. A. Zack, J. F. Kreisberg, M. Roederer, M. P. Sherman, P. S. Chin, M. A. Goldsmith. 2001. HIV-1 actively replicates in naive CD4+ T cells residing within human lymphoid tissues. Immunity 15: 671-682. [Medline]
  56. Berthier-Vergnes, O., F. Bermond, V. Flacher, C. Massacrier, D. Schmitt, J. Peguet-Navarro. 2005. TNF-{alpha} enhances phenotypic and functional maturation of human epidermal Langerhans cells and induces IL-12 p40 and IP-10/CXCL-10 production. FEBS Lett. 579: 3660-3668. [Medline]
  57. Frank, I., J. J. Santos, E. Mehlhop, L. Villamide-Herrera, C. Santisteban, A. Gettie, R. Ignatius, J. D. Lifson, M. Pope. 2003. Presentation of exogenous whole inactivated simian immunodeficiency virus by mature dendritic cells induces CD4+ and CD8+ T-cell responses. J. Acquir. Immune Defic. Syndr. 34: 7-19. [Medline]
  58. Cavrois, M., J. Neidleman, J. F. Kreisberg, D. Fenard, C. Callebaut, W. C. Greene. 2006. Human immunodeficiency virus fusion to dendritic cells declines as cells mature. J. Virol. 80: 1992-1999. [Abstract/Free Full Text]
  59. Weissman, D., H. Ni, D. Scales, A. Dude, J. Capodici, K. McGibney, A. Abdool, S. N. Isaacs, G. Cannon, K. Kariko. 2000. HIV gag mRNA transfection of dendritic cells (DC) delivers encoded antigen to MHC class I and II molecules, causes DC maturation, and induces a potent human in vitro primary immune response. J. Immunol. 165: 4710-4717. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
BloodHome page
A. N. Harman, M. Kraus, C. R. Bye, K. Byth, S. G. Turville, O. Tang, S. K. Mercier, N. Nasr, J. L. Stern, B. Slobedman, et al.
HIV-1-infected dendritic cells show 2 phases of gene expression changes, with lysosomal enzyme activity decreased during the second phase
Blood, July 2, 2009; 114(1): 85 - 94.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Nascimbeni, L. Perie, L. Chorro, S. Diocou, L. Kreitmann, S. Louis, L. Garderet, B. Fabiani, A. Berger, J. Schmitz, et al.
Plasmacytoid dendritic cells accumulate in spleens from chronically HIV-infected patients but barely participate in interferon-{alpha} expression
Blood, June 11, 2009; 113(24): 6112 - 6119.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
B. Liu, A. M. Woltman, H. L. A. Janssen, and A. Boonstra
Modulation of dendritic cell function by persistent viruses
J. Leukoc. Biol., February 1, 2009; 85(2): 205 - 214.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Trapp, N. R. Derby, R. Singer, A. Shaw, V. G. Williams, S. G. Turville, J. W. Bess Jr., J. D. Lifson, and M. Robbiani
Double-Stranded RNA Analog Poly(I:C) Inhibits Human Immunodeficiency Virus Amplification in Dendritic Cells via Type I Interferon-Mediated Activation of APOBEC3G
J. Virol., January 15, 2009; 83(2): 884 - 895.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. van Montfort, A. A. M. Thomas, G. Pollakis, and W. A. Paxton
Dendritic Cells Preferentially Transfer CXCR4-Using Human Immunodeficiency Virus Type 1 Variants to CD4+ T Lymphocytes in trans
J. Virol., August 15, 2008; 82(16): 7886 - 7896.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Harman, A. N.
Right arrow Articles by Cunningham, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Harman, A. N.
Right arrow Articles by Cunningham, A. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS