|
|
||||||||
Department of Medical Microbiology and Immunology, Medical University of Ohio, Toledo, OH 43614
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Studies using a well-defined murine model of Lyme disease have shown that infected hosts generate potent innate and adaptive immune responses to B. burgdorferi (5, 6, 7, 8). These spirochetes do not possess the LPS or lipoteichoic acid components found in most bacteria (9, 10) that are well-known for their abilities to elicit inflammatory responses via TLR4- and TLR2-mediated interactions (11, 12). However, B. burgdorferi does specify
127 different putative lipoproteins, at least some of which are capable of promoting inflammatory responses (10, 13, 14). The lipoproteins expressed by B. burgdorferi are known to vary widely under the different environmental conditions they encounter during their natural infection cycle between arthropod and vertebrate hosts (15, 16, 17), but all of these proteins are predicted to possess similar triacyl modifications on their N-terminal cysteine residues (18). Studies from a number of laboratories have shown that these triacylated lipoproteins directly activate different host immune cells by signaling through TLR2 (19, 20, 21, 22, 23) and the common intracellular adaptor molecule MyD88 (24, 25). These interactions are further enhanced by the binding of lipoproteins to CD14 (26, 27), which can increase the sensitivity of TLR2-lipoprotein interactions at physiological levels and augment TLR2-mediated activation (28). This lipoprotein-mediated signaling leads to the rapid activation of NF-
B (29, 30)- and MAPK-signaling pathways (31, 32), and the subsequent up-regulation of multiple proinflammatory cytokines and chemokines from many of the cell and tissue types associated with Lyme pathology (33, 34, 35, 36, 37). Deficiencies in these lipoprotein-mediated signaling pathways has significant effects on the ability to control spirochete numbers in multiple target tissues (23, 24, 25, 38), highlighting the importance of these innate immune responses in host control of B. burgdorferi infections.
Abs produced during the course of B. burgdorferi infection are important in controlling spirochete numbers, as infected SCID mice eventually develop high bacterial loads, as well as more extended Lyme pathology (39, 40). Passive transfer of immune serum to naive mice before or shortly after inoculation with B. burgdorferi can prevent infection, as well as tissue pathology, from establishing (41, 42). However, if immune serum is administered at
6 days postinfection, the development of Lyme pathology is greatly diminished, but the spirochetes are able to escape and establish a persistent infection. These data suggest that B. burgdorferi can rapidly adapt within the host to evade Ab-mediated clearance, which is consistent with their known abilities to rapidly alter their surface lipoproteins, both by modulating surface expression of individual lipoproteins (43, 44), as well as the extensive genetic modifications that can occur within the vlsE-expressed lipoprotein (45, 46). Alternatively, these spirochetes may either acquire host proteins (47, 48) or reach an immunoprivileged niche (49, 50, 51) in which B. burgdorferi is protected from the bactericidal effects of Abs developed during the natural course of infection. Given these facts, identifying a single vaccine candidate that would address the heterogeneous nature of B. burgdorferi surface Ags is a daunting task.
It is unclear what constitutes an effective immune response to B. burgdorferi. Passive transfer of purified T cells derived from immunized mice to naive mice provides little protection from subsequent infection, suggesting that T cells do not directly affect protective immunity but are likely important for development of Ab responses (52, 53). Studies using genetically modified mice indicate that manipulation of many host cytokines known to have dramatic effects on clearance of other bacterial pathogens, such as IL-4, IFN-
, and IL-12, did not produce statistically significant effects on spirochetal clearance (54, 55, 56). Similarly, mice deficient in their abilities to generate NO or reactive oxygen intermediates develop tissue pathology and bacterial loads similar to those in wild-type mice (57, 58, 59), suggesting that these vital components of phagocyte-mediated host defenses are not of central importance for controlling B. burgdorferi numbers in vivo.
An earlier study from our group attempted to address whether the relatively severe Lyme pathology exhibited by C3H mouse strains might correlate with a more exuberant inflammatory response against resident spirochetes compared with the relatively arthritis-resistant C57BL/6 (B6) strain (60). Macrophages (M
)3 derived from naive C3H mice did elicit significantly higher levels of the inflammatory mediators TNF-
, IL-6, and NO (in response to the prototypic B. burgdorferi lipoprotein OspA) compared with B6 M
, and these levels were inversely correlated with the production of high levels of the anti-inflammatory cytokine IL-10 by the B6 M
, suggesting that IL-10 might play a key role in suppressing the development of Lyme pathology. Although in vivo studies confirmed that B. burgdorferi-infected IL-10-deficient (IL-10–/–) mice developed significantly greater arthritis compared with wild-type B6 mice, we were surprised to find that ankle and ear tissues from the IL-10–/– mice possessed significantly lower spirochete numbers compared with the B6 tissues. This suggests that IL-10–/– mice may provide an important model for delineating the immune response to Lyme disease, as this represents the only cytokine currently known to exert such a significant effect on B. burgdorferi levels in host tissues.
The immune mechanisms responsible for the increased spirochete clearance exhibited by IL-10–/– mice are currently unknown. IL-10 is known to suppress a number of different immune cell types, and its main biological role appears to involve reducing and eventually terminating inflammatory responses (61). M
responses are potently suppressed by IL-10, and because M
are believed to play a central role in both the innate and adaptive immune responses to B. burgdorferi, it is possible that M
are better able to eradicate spirochetes in the absence of the substantial IL-10 amounts elicited in response to B. burgdorferi by B6 mice (60, 62, 63). Alternatively, our previous studies also showed that infected IL-10–/– mice possessed significantly higher levels of B. burgdorferi-specific, as well as total, Ab levels compared with infected B6 mice (60), so it is possible that much of the increased clearance is mediated by this enhanced Ab response. The experiments outlined in the present study are designed to reveal the relative importance of increased B. burgdorferi-specific Ab levels in mediating the enhanced spirochetal clearance exhibited by IL-10–/– mice. Our results indicate that increased clearance of B. burgdorferi in IL-10–/– mice is predominantly due to differences in innate immune responses rather than increases seen in spirochete-specific Ab levels.
| Materials and Methods |
|---|
|
|
|---|
B6 and IL-10–/– (B6.129P2-Il10tm1Cgn/J) mice were obtained from The Jackson Laboratory; the IL-10–/– strain has been backcrossed 10 generations onto the C57BL/6J background, thus making B6 the appropriate wild-type control. C3H-scid (C3H/Smn.ClCrHsd-Prkdcscid) mice were purchased from Harlan Breeders. Mice were housed in the Department of Laboratory Animal Medicine at the Medical University of Ohio according to National Institutes of Health guidelines for the care and use of laboratory animals. All protocols were reviewed and approved by the Institutional Animal Care and Usage Committee.
Infection of mice with B. burgdorferi
The clonal N40 isolate (64) of B. burgdorferi was provided by S. Barthold (University of California, Davis, CA) as a passage two culture after isolation from the urinary bladder of a Rag-1–/– mouse. For all infections, a passage four culture was grown in BSK-II medium supplemented with 6% rabbit serum (Sigma-Aldrich) for 3–5 days at 33°C and directly enumerated using a Petroff-Hauser chamber and dark field microscopy. B6 and IL-10–/– naive mice were infected with the indicated numbers of B. burgdorferi in a 20-µl volume by intradermal injection into a shaven back. All groups consisted of at least five mice, as this number has been reported to consistently provide statistically significant values for infection studies (65).
Ig quantification
Serum was obtained at the indicated times by either retro-orbital bleeding or exsanguination, and Ig content was assessed using previously described ELISA techniques (60). Briefly, microtiter plates were coated with either sonicated B. burgdorferi or goat Abs to mouse IgG, IgM, and IgA (Southern Biotechnology Associates). Serum dilutions were added to plates for 90 min at 37°C, and bound murine Ig was detected by addition of isotype-specific HRP-conjugated Abs (Southern Biotechnology Associates). Ig content was quantified by comparison to standard curves constructed by using purified Ig of the appropriate isotype (Southern Biotechnology Associates).
Bactericidal activity of B. burgdorferi-specific Abs in vitro
Pooled immune sera were collected from either naive (control) or B. burgdorferi-infected B6 and IL-10–/– mice at 4 wk postinfection. Parallel cultures of 1.5 x 107 spirochetes in BSK-II were opsonized by adding the indicated amounts of immune or control serum for 45 min at 37°C, followed by the addition of freshly reconstituted or heat-inactivated Guinea pig complement (C; MP Biomedicals); heat inactivation (H.I.) of C was performed by incubation at 55°C for 1 h. Treated cultures were incubated at 37°C for 24 h before enumerating the spirochetes by direct counting in a Petroff-Hauser chamber using dark field microscopy. Only spirochetes exhibiting characteristic "spiral motion" were scored as alive. Bactericidal activity is represented as the percentage of live spirochetes recovered from each treatment compared with untreated controls.
DNA preparation
The rear ankle joints, the entire heart, and ear tissues were harvested from experimental animals sacrificed at 7, 10, 14, and 28 days postinfection, and DNA was prepared from each as previously described (66). Briefly, tissue specimens were incubated in 0.1% collagenase A (Roche Diagnostics) at 37°C overnight, followed by the addition of an equal volume of 0.2 mg/ml proteinase K (Invitrogen Life Technologies) and incubation overnight at 55°C. DNA was recovered by phenol-chloroform extractions and ethanol precipitation, and digested in 1 mg/ml DNase-free RNase (Sigma-Aldrich). DNA was again extracted and precipitated in ethanol, and the final sample was resuspended in 1 ml of 10 mM Tris containing 1 mM EDTA (TE buffer; pH 7.5). The DNA content was quantified by absorbance at 260 nm and working samples were diluted to 50 µg/ml for quantitative real-time PCR analyses.
Assessing B. burgdorferi numbers in mouse tissues
The number of spirochetes resident in the different murine target tissues were determined via PCR analyses using a LightCycler (Roche Diagnostics) rapid fluorescence temperature cycler based on our previously described protocols (60, 67). Briefly, amplification was performed on 100 ng of template DNA in a 10-µl final volume containing 50 mM Tris (pH 8.3), 3 mM MgCl2, 4.5 µg of BSA, 200 µM of each deoxynucleoside triphosphate, a 1/20,000 dilution of SYBR Green I (Molecular Probes), 1 µM of each primer (Integrated DNA Technologies), and 0.5 U of Platinum TaqDNA Polymerase (Invitrogen Life Technologies). Copy numbers for the mouse nidogen gene and B. burgdorferi recA present in each sample were calculated by extrapolation to standard curves using LightCycler software (Roche Diagnostics). The reported data represents recA values that were corrected by normalization based on the nidogen gene copy number. The oligonucleotide primers used to detect mouse nidogen were nido.F (5'-CCA GCC ACA GAA TAC CAT CC-3') and nido.R (5'-GGA CAT ACT CTG CTG CCA TC-3'). The oligonucleotide primers used to detect B. burgdorferi recA were nTM17.F (5'-GTC GAT CTA TTG TAT TAG ATG AGG CTC TCG-3') and nTM17.R (5'-GCC AAA GTT CTG CAA CAT TAA CAC CTA AAG-3').
Western blot analysis
One hundred twenty micrograms of sonicated cN40 isolate was electrophoresed in a 4–12% Bis-Tris gel (Invitrogen Life Technologies) containing a single large well, transferred to Immobilon-P membrane (Millipore), and immunoblotted using a Surf Blot apparatus (Idea Scientific). Immune sera used to blot the membrane were obtained from IL-10–/– and B6 mice at day 14 or 28 postinfection. Ab-Ag complexes were detected by addition of HRP-conjugated Abs specific for the indicated murine Ig isotype (Southern Biotechnology Associates) and visualized by chemiluminescence. Multiple film exposure times were acquired for each blot to ensure that all protein bands were recorded irrespective of concentration variances between samples.
Tissue culture and cytokine analyses
Femurs were harvested from naive wild-type and IL-10–/– mice, and the bone marrow was used to expand M
for in vitro analyses using our previously reported techniques (36, 60). Dissociated marrow tissue was cultured for 6 days in RPMI 1640 supplemented with 30% L929-conditioned medium. Adherent M
were scraped from culture dishes using ice-cold PBS, trypan-blue excluding cells were enumerated using a hemacytometer, and replated at 2 x 105 M
/well in 24-well culture dishes in RPMI 1640 containing 5% FBS. M
were incubated overnight at 37°C in 7.5% CO2 and nonadherent cells were aspirated before stimulation. B. burgdorferi were enumerated as indicated above and added to M
monolayers at the indicated multiplicity of infection (MOI). These plates were immediately centrifuged at 300 x g for 10 min to encourage B. burgdorferi contact with the monolayers and the plates were returned to the CO2 incubator. At various times poststimulation, culture supernatants were collected and frozen at –20°C for cytokine analyses. Total RNA was subsequently harvested and pooled from duplicate M
monolayers using the RNeasy kit (Qiagen). Total RNA (1 µg) was reverse transcribed into cDNA using ImProm II Reverse Transcriptase (Promega) and quantified using our real-time PCR techniques (see above) with primers specific for TNF-
, IL-6, and IL-10 (primers are listed below). The reported values reflect the indicated cytokine transcript after normalization to β-actin values from the same sample. M
supernatants were also collected at the indicated time points and cytokine content was assessed by sandwich ELISA using paired mAbs specific to murine TNF-
, IL-6, and IL-10 (BD Biosciences/BD Pharmingen). Bound cytokines were visualized using biotinylated detection Abs and avidin-HRP (Vector Laboratories). Cytokine levels were quantified by comparison to appropriate recombinant cytokine standards (BD Biosciences/BD Pharmingen). The primer sets used for PCR were: TNF-
(forward), TTCTGTCTACTGAACTTCGGGGTGATCGGTCC, TNF-
(reverse), GTATGAGATAGCAAATCGGCTGACGGTGTGGG; IL-6 (forward), GTTCTCTGGGAAATCGTGGA, IL-6 (reverse), TGTACTCCAGGTAGCTATGG; IL-10 (forward), CGGGAAGACAATAACTG, IL-10 (reverse), CATTTCCGATAAGGCTTGG; β-actin (forward), TGGAATCCTGTGGCATCCATGAAAC, β-actin (reverse), TAAAACGCAGCTCAGTAACAGTCCG.
Statistical analyses
The statistical significance of the quantitative differences between the different sample groups was determined by application of the Student two-tailed t test. For the ID50 analyses, the data reflecting the percentage of infected animals in each group were used to generate ID50 values based on the equation of Reed and Muench (68) as previously reported (69). Standard probit analyses were also used to confirm the ID50 values and determine statistical significance using a goodness-of-fit analysis (70).
| Results |
|---|
|
|
|---|
Previous studies by our group revealed that IL-10–/– mice possess lower B. burgdorferi numbers in multiple target tissues compared with wild-type B6 mice when assessed 4 wk postinfection (60). The infected IL-10–/– mice were also found to consistently produce 3- to 4-fold higher levels of B. burgdorferi-specific Ab than B6 mice at 4 wk postinfection. To address the relative effects of increased Ab levels on spirochete clearance, we performed kinetic studies to compare the development of spirochete-specific Abs in IL-10–/– and B6 mice, and to determine whether they correlate with the relative levels of B. burgdorferi seen in different target tissues. At day 7 postinfection, low but significant levels of spirochete-specific IgM could be detected in both B6 and IL-10–/– mice (Fig. 1), however, very few to no spirochetes could be detected in the ankle (Fig. 1), ear, or heart (data not shown) tissues from either mouse strain. By day 10 postinfection, IgM levels had increased significantly and appeared similar between the mouse strains (Fig. 1); IgG levels were only slightly above the detection threshold (data not shown). Substantial spirochete numbers were seen in almost all murine tissues at this time, and the levels in IL-10–/– tissues appeared to be relatively lower than those in B6 tissues; however, these differences were not statistically significant (p = 0.23). As early as 2 wk and up to 4 wk postinfection, target tissues in IL-10–/– mice contained significantly lower B. burgdorferi numbers compared with B6 mice (p < 0.00001 and 0.008, respectively), confirming that IL-10 suppresses immune responses that are important in spirochete clearance (Fig. 1). This increased spirochete clearance corresponded with the appearance of significantly increased levels (p < 0.008) of B. burgdorferi-specific Abs in IL-10–/– mice, which consistently possessed 2- to 3-fold higher Ab concentrations compared with B6 mice at both 2 and 4 wk postinfection. Interestingly, IL-10–/– mice also exhibited similar increases in total Ig compared with B6 mice (data not shown), suggesting that increased Ab levels could be a general trend that is consistent with the known suppressive effects of IL-10 (71) and not specific to B. burgdorferi. Although the data at day 10 is suggestive that IL-10-mediated effects on spirochete clearance can be seen independent of significant differences in Ab levels, the kinetics of disease development do not allow for dissociation of these qualities, and more specific analyses must be performed to address this issue. However, these studies do suggest that IL-10 deficiency had no impact on the kinetics of B. burgdorferi dissemination, as invasion of all tested target tissues appeared at similar times postinfection (Fig. 1 and data not shown).
|
Because mice appear to produce higher levels of B. burgdorferi-specific Abs in the absence of IL-10, it is also feasible that IL-10–/– mice might recognize a greater range of spirochete Ags during the course of infection, and subsequently generate a greater Ab diversity that could lead to enhanced spirochetal clearance. To address this, sera were collected from B6 and IL-10–/– mice at 2 and 4 wk postinfection and used for immunoblot analyses of sonicated fractions prepared from the same B. burgdorferi cultures used to initially infect these mice. Immune sera collected at week 2 postinfection recognized a number of spirochete Ags ranging in size from 19 to 51 kDa (Fig. 2). A similar range of Ags was identified using week 4 immune sera, with the addition of a few lower molecular mass bands not seen at week 2. At both times postinfection, the intensity of the recognized protein bands was greater when assessing IL-10–/– sera (Fig. 2), which is consistent with the higher levels of Abs generated by these mice at 2 and 4 wk postinfection (Fig. 1). However, the diversity of the Ags recognized by sera from B6 and IL-10–/– sera appeared to be similar (Fig. 2), and longer exposure times did not reveal the presence of any Ags that are uniquely recognized by either immune sera (data not shown). Moreover, increased or altered production of Abs to any particular Ag in an individual mouse (Fig. 2) did not correlate to increased clearance of B. burgdorferi from the different tissues of that particular animal (Fig. 1 and data not shown), suggesting that Ab levels alone do not determine B. burgdorferi clearance. These findings indicate that IL-10-deficiency does not augment the ability of the host to elicit Ab responses to unique spirochetal Ags.
|
To assess whether spirochete-specific Abs generated in the absence of IL-10 are more effective at killing B. burgdorferi in vitro, sera was collected from groups of B6 and IL-10–/–mice at 4 wk postinfection, pooled, and the spirochete-specific Ab levels were quantified by ELISA. To best reflect the differences in Ab levels elicited by the different mouse lines (Fig. 3A), equal volumes of the pooled immune sera from B6 and IL-10–/– mice were compared for their ability to mediate spirochetal killing in the presence or absence of complement (C). The addition of C alone had little effect on the viability of the N40 strain in vitro (Fig. 3B), reflecting the known ability of virulent B. burgdorferi strains to resist the alternative pathway of C-mediated killing (72, 73, 74). Immune sera from B6 and IL-10–/– mice were both able to mediate significant spirochete killing at up to 1000-fold dilution in vitro (Fig. 3B), and bactericidal activity was noted at titers greater than 1/1600 for both strains; no immune sera showed bactericidal activity at
1/5000 dilution compared with control sera. At all dilutions showing bactericidal activity, IL-10–/– immune sera appeared to mediate slightly higher spirochetal killing than B6 immune sera, but these differences were not statistically significant (p > 0.05). H.I. of complement did not have a significant effect on the bactericidal activity of either immune serum (Fig. 3B), and parallel studies performed in the absence of exogenous C demonstrated a slightly decreased, but similar, bactericidal activity as immune serum alone (data not shown). The ability of certain B. burgdorferi-specific Abs to mediate spirochetal killing in the absence of C has been previously reported and appears to be somewhat unique to certain spirochetal bacteria (75).
|
|
The innate immune defenses of an immunocompetent host work together to impart an infection barrier that pathogens must overcome to establish residence in host tissues. To address whether IL-10 deficiency affects these innate barriers, groups of five or more B6 and IL-10–/– mice were injected with a range of B. burgdorferi doses to compare the spirochetal numbers necessary to infect these mouse strains; groups of this size have been shown to consistently ensure statistically significant values for ID50 studies (65). Infection was confirmed at 2 wk postinjection by quantitative PCR (Q-PCR) detection of B. burgdorferi DNA in host ankle, ear, and heart tissues, and by the presence of spirochete-specific Ab (Table I). Any animal that possessed B. burgdorferi DNA in one or more of the tested target tissues (Table I; Q-PCR) or the presence of B. burgdorferi-specific IgM in the serum (Table I; ELISA) was considered to be infected; the original inoculum alone is not sufficient to produce a positive ELISA test, as our studies have shown that intradermal injection of
5 x 105 killed spirochetes are required to elicit any notable increase in B. burgdorferi-specific Ab levels, and our "positive" values are >30-fold higher than these levels (data not shown). The ID50 values for wild-type B6 and IL-10–/– mice were calculated as 49 and 396 organisms, respectively (Table I). Statistical analyses of probit curves representing the percentage of mice infected at each inoculum indicates that the difference in the ID50 values between the two mouse strains are significant (p = 0.04). This suggests that IL-10 has suppressive effects on innate immune mechanisms that are important for preventing B. burgdorferi infection of mice. It is notable that a single IL-10–/– mouse was infected at the lowest infectious dose of 16 B. burgdorferi, which may reflect this animal having received a "clump" of bacteria in the inoculum, because this highly virulent low-passage strain forms strong aggregates during culture in BSK medium (Ref. 76 and data not shown).
|
M
are a critical component of the early innate immune responses to B. burgdorferi, as they are resident within the different murine target tissues and respond vigorously to B. burgdorferi. Work by a number of investigators has established that primary M
responses to B. burgdorferi in vitro generally correlate with the antispirochetal immunity exhibited by the mouse strains from which the M
were derived. To determine whether M
might play a major role in mediating the differences seen in spirochetal clearance between B6 and IL-10–/– mice, primary M
were derived from the bone marrow of these two mouse strains and cultured in vitro in the presence of B. burgdorferi. Substantial differences in the up-regulation of proinflammatory cytokine transcript levels between the M
populations were apparent early, as IL-10–/– M
produced higher amounts of TNF-
mRNA by 3 h postinfection and higher IL-6 transcript levels by 9 h postinfection (Fig. 5, left panels). These differences were reflected in cytokine secretion, with IL-10–/– M
releasing significantly higher levels of both TNF-
(p < 0.007) and IL-6 (p < 0.004) at 24 h postinfection compared with B6 M
(Fig. 5, right panels). These distinct trends in cytokine production by M
derived from the two mouse strains were apparent in all four separate experiments, although the overall magnitude of the cytokine responses varied substantially between the different experiments (data not shown). Overall, the decreased levels of proinflammatory cytokine transcripts and protein levels produced by B6 M
appear to correspond to the kinetics of IL-10 production, suggesting that the increases in IL-10 levels suppress production of proinflammatory cytokines by B6 M
. Conversely, the M
derived from IL-10–/– mice produce no IL-10, and are able to generate a significantly higher and more sustained proinflammatory response. These findings suggest that IL-10 does have a significant effect on M
responses to B. burgdorferi that might contribute to the differences in disease development in vivo.
|
Although the B. burgdorferi-specific Abs produced by IL-10–/– mice did not appear to confer significantly greater spirochete clearance/killing in the above assays, it is possible that IL-10–/– M
interactions with Ab-opsonized spirochetes leads to increased activation that could promote the enhanced bacterial clearance exhibited by IL-10–/– mice. To address this, M
derived from B6 and IL-10–/– mice were exposed in vitro to B. burgdorferi that had been preincubated with either control or B. burgdorferi-specific immune serum collected from infected B6 or IL-10–/– mice. Addition of B. burgdorferi to the two M
populations again showed that IL-10–/– M
produce significantly higher levels of TNF-
(p < 0.002) and IL-6 (p < 0.001) than B6 M
in response to B. burgdorferi (Fig. 6). Preincubation of the spirochetes with B. burgdorferi-specific antiserum from either B6 or IL-10–/– mice did not significantly affect cytokine secretion by IL-10–/– M
, and also did not differ from B. burgdorferi preincubated with nonimmune serum (Fig. 6,
). The addition of B. burgdorferi preincubated with either immune serum, if anything, reduced secretion of TNF-
(p < 0.002) and IL-6 (p < 0.015) by B6 M
, though this reduction was not seen on preincubation with nonimmune serum (Fig. 6;
![]()
, as none of the treatments gave significantly different results from those shown by untreated spirochetes. The addition of control serum or antiserum alone did not elicit significant levels of any tested cytokines in the absence of B. burgdorferi stimulation. These findings suggest that the significant differences observed between wild-type and IL-10–/– M
responses to B. burgdorferi can occur independently of Ab influences.
|
| Discussion |
|---|
|
|
|---|
7–10 days postinfection, and differences could be detected between the B. burgdorferi numbers present in the tissues of B6 and IL-10–/– mice by 10–14 days postinfection. Although spirochete-specific Ab levels were similar between these mouse strains as late as day 10 postinfection, the amounts present in IL-10–/– mice had become significantly greater than in B6 mice by day 14, thus making it impossible to delineate whether differences in spirochete numbers occurred previous to the noted differences in Ab production. Immunoblot and ELISA analyses of immune serum collected at 2 and 4 wk postinfection confirmed that IL-10–/– mice produced greater quantities of B. burgdorferi-specific IgM and IgG than infected B6 mice, but these immune sera appear to recognize an identical range of spirochetal Ags, thus making it unlikely that IL-10–/– mice possessed Abs particular to some unique B. burgdorferi Ag(s) that might mediate increased clearance. The addition of B6 and IL-10–/– immune serum directly to B. burgdorferi in vitro produced similar levels of spirochete killing at all dilutions tested, and these levels were not significantly changed by the addition of complement, suggesting that these Abs possessed a similar capacity for direct killing of B. burgdorferi. Passive transfer of equal volumes of B6 and IL-10–/– immune serum into B. burgdorferi-infected C3H-scid mice greatly reduced the spirochete levels in all tissues tested, but no significant differences were detected between animals receiving the different immune sera, indicating that Abs produced by infected IL-10–/– mice did not mediate significantly greater B. burgdorferi killing in vivo. These findings confirm that, while Ab-mediated immunity is certainly important for the long-term control of spirochetal levels during the natural course of Lyme disease, the increased quantities of B. burgdorferi-specific Abs produced by IL-10–/– mice were not solely responsible for the up to 10-fold decreases in tissue spirochete levels for these mice, and imply that other immune mechanisms must be involved. This also complements the findings of other researchers, where these spirochetes can persist in the presence of high levels of B. burgdorferi-specific Abs, confirming that Ab quantities are not the limiting factor in clearing most B. burgdorferi infections. The mechanism of evading Ab-mediated clearance is currently unknown, but may involve these bacteria gaining access to an immunoprivileged site, or potentially down-regulating the production of most outer surface Ags, as is believed to occur in some related spirochetal organisms, i.e., Treponema pallidum (77).
Because IL-10 is known to possess potent anti-inflammatory properties and suppress many activities associated with myeloid immune cells, we were interested in addressing whether enhanced innate immune responses might be responsible for the increased spirochete clearance. Infectious dose studies determined that 8- to 9-fold more B. burgdorferi were needed to initiate infection of IL-10–/– mice, suggesting that these animals possessed significantly increased innate barriers that spirochetes must overcome to establish infection. M
derived from IL-10–/– mice elicited significantly higher levels of TNF-
and IL-6 than B6 M
in response to B. burgdorferi, as measured at both the transcript and protein levels, suggesting that M
can produce/mediate more vigorous inflammatory responses against these spirochetes in the absence of IL-10. The kinetics and magnitude of these in vitro proinflammatory responses inversely corresponded to the production of IL-10 by wild-type M
, consistent with the possibility that IL-10 elicited in response to B. burgdorferi-infection suppresses these immune activities. Preincubation of B. burgdorferi with immune serum derived from B6 and IL-10–/– did not significantly affect the cytokine production elicited by IL-10–/– M
, indicating that the enhanced proinflammatory responses occurs independently of Ab-mediated opsonization of spirochetes. Interestingly, Ab opsonization appeared to decrease cytokine production by wild-type M
in response to spirochete exposure, suggesting that B. burgdorferi-elicited IL-10 might also suppress Fc-mediated signaling by M
. These studies imply that the increased clearance of B. burgdorferi in IL-10–/– mice is largely due to enhanced innate immune mechanisms, and that M
-mediated activities could largely shape these enhanced responses.
The inflammatory events associated with innate immune responses to B. burgdorferi are known to be central to many sequelae related to the development of Lyme disease. Introduction of B. burgdorferi into skin or joint tissues elicits rapid migration of inflammatory cells, primarily PMN and M
into the infected areas (64, 78). In infected humans and some animal species, many develop an erythema migrans skin lesion emanating from the inoculation site, that is believed to represent the tissue reaction to inflammatory mediators produced by host inflammatory cells in response to the disseminating spirochetes (2). Lipoproteins possessed by B. burgdorferi are known to directly initiate these inflammatory responses through signaling pathways mediated via TLR2 and MyD88 (19, 24), which are present on and/or up-regulated by many types of host inflammatory cells, and particularly professional phagocyte lineages (79, 80). The significance of these interactions with B. burgdorferi is consistent with the dysregulated inflammatory responses shown by M
and other innate immune cells derived from mice deficient in either TLR2 or MyD88, as well as the CD14 coreceptor (19, 23, 24, 25, 26, 27). The importance of these lipoprotein-mediated events is confirmed by the severe impairment in spirochete clearance exhibited by these mutant lines both early and late after infection (23, 24, 25, 38). Importantly, each of these mutant lines develop a B. burgdorferi-specific Ab repertoire that is of equal or greater magnitude than that of wild-type mice (23, 24, 25), and these Abs appear capable of prophylactically preventing spirochetal infection (81). However, these mice maintain abnormally high spirochetal loads in multiple tissues well beyond the time when Abs are believed to normally reduce spirochetal numbers during natural infection. Based on these findings, it is feasible that innate immune responses are of central importance for normal control of natural B. burgdorferi infection, and that IL-10 might exert a major influence, as it can significantly suppress the responses of M
and other initiators of inflammatory responses.
Although these studies implicate that innate immune responses are largely responsible for the increased clearance of B. burgdorferi in IL-10–/– mice, the precise mechanism is still unknown. Interestingly, recent studies have identified a number of microbes that can manipulate host IL-10 levels so as to enhance their virulence and/or long-term persistence in vivo. Perhaps the best defined is the secreted virulence Ag of Yersinia species (LcrV) which can activate host M
using a CD14 and TLR2-dependent mechanism and subsequently dysregulate the normal host inflammatory response, in that TNF-
and IFN-
production are severely reduced (82). These TLR2-mediated activities correlate with the rapid induction of IL-10, a trend that was also noted when compared with triacylated lipopeptides (83), and the biological importance was evident in that both TLR2–/– and IL-10–/– mice are significantly protected from Yersinia infection compared with wild-type mice (84). Virulent mycobacteria species associated with leprosy and tuberculosis patients have also been associated with increased IL-10 production in vivo (85) and the ability to enhance IL-10 production by monocytes/macrophages in vitro (86, 87, 88, 89). In addition to its adhesive properties, the filamentous hemagglutinin protein of Bordetella pertussis is known to have immunosuppressive effects on M
in an IL-10-dependent manner by down-regulating IL-12, as well as modulating host innate immune responses and resisting inflammation-mediated clearance (90, 91). A number of different pathogenic viruses have evolved genes that encode IL-10 homologs possessing many of the immunosuppressive properties exhibited by host IL-10, while lacking many other immunostimulatory functions performed by the cellular cytokine (92, 93, 94). Although IL-10 modulating functions can be seen in a wide variety of pathogenic microbes, the underlying mechanism of immune suppression is believed to be largely mediated through increased IL-10 production by M
, which in turn acts to suppress M
and other APCs through a number of different mechanisms, including inhibition of inflammatory clearance via suppression of proinflammatory cytokines and chemokines, suppression of Ag presentation by down-regulating MHC class II expression, inhibition of apoptotic pathways so as to allow persistence of intracellular pathogens, and suppression of phagocytosis and subsequent production of reactive oxygen and nitrogen species (95). Similar mechanisms could feasibly be involved in the inhibition of B. burgdorferi clearance observed in the current study. Future work will involve delineating the specific immune mechanisms affected by B. burgdorferi-elicited IL-10, as well as determining whether infectious spirochetes can preferentially manipulate IL-10 release from host cells.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by Scientist Development Grant 0335148N from the American Heart Association (to R.M.W.) and start-up funds from the Medical University of Ohio (to R.M.W.). ![]()
2 Address correspondence and reprint requests to Dr. R. Mark Wooten, Department of Medical Microbiology and Immunology, Medical University of Ohio, 3055 Arlington Avenue, Toledo, OH 43614. E-mail address: rwooten{at}meduohio.edu ![]()
3 Abbreviations used in this paper: M
, macrophage; H.I., heat inactivation; MOI, multiplicity of infection; Q-PCR, quantitative PCR. ![]()
Received for publication March 31, 2006. Accepted for publication August 30, 2006.
| References |
|---|
|
|
|---|
B and inflammatory activation in human endothelial cells. J. Immunol. 157: 4584-4590. [Abstract]
B and is a potent inducer of chemokine and adhesion molecule gene expression in endothelial cells and fibroblasts. J. Immunol. 158: 3285-3292. [Abstract]
interferon. Infect. Immun. 67: 3329-3333.
interferon and interleukin-10 production in draining lymph nodes from mice infected with Borrelia burgdorferi. Infect. Immun. 68: 7162-7165.
, and interferon-
in human monocytes infected with Mycobacterium tuberculosis H37Ra. J. Infect. Dis. 178: 1105-1114. [Medline]This article has been cited by other articles:
![]() |
L. Sun, R.-F. Guo, M. W. Newstead, T. J. Standiford, D. R. Macariola, and T. P. Shanley Effect of IL-10 on Neutrophil Recruitment and Survival after Pseudomonas aeruginosa Challenge Am. J. Respir. Cell Mol. Biol., July 1, 2009; 41(1): 76 - 84. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Londono, A. Marques, R. L. Hornung, and D. Cadavid Relapsing Fever Borreliosis in Interleukin-10-Deficient Mice Infect. Immun., December 1, 2008; 76(12): 5508 - 5513. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Brown, A. Y.-C. Lai, S. T. Callen, V. A. Blaho, J. M. Hughes, and W. J. Mitchell Adenoviral Delivery of Interleukin-10 Fails To Attenuate Experimental Lyme Disease Infect. Immun., December 1, 2008; 76(12): 5500 - 5507. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Londono, A. Marques, R. L. Hornung, and D. Cadavid IL-10 Helps Control Pathogen Load during High-Level Bacteremia J. Immunol., August 1, 2008; 181(3): 2076 - 2083. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Lazarus, M. A. Kay, A. L. McCarter, and R. M. Wooten Viable Borrelia burgdorferi Enhances Interleukin-10 Production and Suppresses Activation of Murine Macrophages Infect. Immun., March 1, 2008; 76(3): 1153 - 1162. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Iliopoulou, J. Alroy, and B. T. Huber CD28 Deficiency Exacerbates Joint Inflammation upon Borrelia burgdorferi Infection, Resulting in the Development of Chronic Lyme Arthritis J. Immunol., December 15, 2007; 179(12): 8076 - 8082. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hermann Review: Variability of host pathogen interaction Innate Immunity, August 1, 2007; 13(4): 199 - 218. [Abstract] [PDF] |
||||
![]() |
M. E. Woodman, A. E. Cooley, J. C. Miller, J. J. Lazarus, K. Tucker, T. Bykowski, M. Botto, J. Hellwage, R. M. Wooten, and B. Stevenson Borrelia burgdorferi Binding of Host Complement Regulator Factor H Is Not Required for Efficient Mammalian Infection Infect. Immun., June 1, 2007; 75(6): 3131 - 3139. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |