|
|
||||||||
to Increase Cytokine Production by Resident Murine and Human Alveolar Macrophages1
,


,
* Pulmonary and Critical Care Medicine Section, and Research Service, Department of Veterans Affairs Health System, Ann Arbor, MI 48105; and
Division of Pulmonary and Critical Care Medicine, Department of Internal Medicine and
Graduate Program in Immunology, University of Michigan Health System, Ann Arbor, MI 48109
| Abstract |
|---|
|
|
|---|
) were exposed, in the presence or absence of the appropriate rIFN-
, to synthetic lipopeptides corresponding to the triacylated N-terminal fragments of three outer membrane proteins (OMP) (PCP, P4, and P6) that are highly conserved among different NTHi strains. Synthetic OMP elicited strong release of IL-6, the principal inducer of airway mucin genes, and induced CCL5 and CXCL10 from murine AM
only when IFN-
was also present. Surprisingly, combined stimulation by OMPs and IFN-
also markedly enhanced TNF-
release by murine AM
. Stimulation with PCP plus IFN-
induced IFN-regulatory factor 1 expression and sustained STAT1 activation, but did not alter the activation of MAPKs or NF-
B. AM
derived from STAT1-deficient mice did not demonstrate increased production of TNF-
in response to PCP plus IFN-
. Analysis of wild-type and STAT1-deficient AM
using real-time PCR showed that increased TNF-
production depended on transcriptional up-regulation, but not on mRNA stabilization. The synergistic effect of synthetic OMP and IFN-
was conserved between murine AM
and human AM
for IL-6, but not for TNF-
. Thus, IFN-
, which is produced by virally infected respiratory epithelial cells, converts normally innocuous NTHi OMP into potent inflammatory stimulants, but does so via different mechanisms in mice and humans. | Introduction |
|---|
|
|
|---|
NTHi succeeds as a colonizer and pathogen largely because it has multiple means by which it evades the adaptive immune response. NTHi comprises heterogeneous populations of distinct strains with extreme interstrain antigenic variation. Rapid succession of NTHI strains is one mechanism for persistence in the lower airways in COPD. Individual strains of NTHi can also vary the antigenicity of their outer membrane lipoproteins (OMP) under immunological pressure (2). NTHi secrete any of three IgA1 proteases; individual NTHi strains can alter their IgA protease, so that it not only cleaves IgA1 at a different site but also changes its antigenic properties (2). The microorganism can survive both extracellularly in biofilms (6) and within respiratory epithelial cells and macrophages (M
) (7, 8), in each site remaining relatively safe from host defenses. These factors have so far thwarted attempts to develop effective vaccines against NTHi.
Nevertheless, NTHi can activate innate immune defenses, whose stereotypic pathogen recognition receptors are less susceptible to such antigenic trickery. Although NTHi appears to evade TLR4 stimulation in part by incorporating host-derived sialic acid into its lipo-oligosaccharide (9), crude extract of NTHi organisms or whole lipoprotein P6 induce IL-8 and TNF-
production by human mononuclear phagocytes purified from peripheral blood, and activate the NF-
B and p38 MAPK pathways in human epithelial cells via TLR2 (10, 11). The capacity of innate immune receptors to recognize NTHi led us to ask whether alveolar M
(AM
), the principal innate immune effector of the lower respiratory tract, might contribute to the inflammatory response induced by NTHi during AECB.
Based on the known association between viral respiratory infections and AECB (3, 12, 13, 14), we postulated that any such AM
contribution to NTHi-induced inflammation would depend on stimulation with type I IFN (IFN-
/IFN-
). In addition to their well-established role in containing viral infections, type I IFNs have more recently been shown to be centrally involved in both innate and adaptive immunity to Gram-negative bacteria (reviewed in Refs. 15 and 16). IFN-
null mice are resistant to LPS-induced lethality through a mechanism involving the IFN-
/IFN-
R'-associated kinase Tyk2 and the transcription factor STAT1 (17). Importantly, we have recently shown that murine AM
cannot activate STAT1 in response to stimulation via TLR4 or TLR3, due to a block in the autocrine secretion of IFN-
seen in other M
subtypes (18). Nevertheless, murine AM
respond vigorously to exogenous IFN-
or IFN-
(18). Collectively, these facts imply that production of type I IFNs by virally infected respiratory epithelial cells might overcome the apparent ability of NTHi to evade immune detection.
The goal of this study was to determine whether IFN-
modulates the AM
response to NTHi-derived pathogen-associated molecular patterns. Triacylated lipopeptides, such as NTHI OMP, are known to stimulate TLR2 in combination with TLR1 (19, 20). For this purpose, we stimulated resident murine and human AM
in vitro using three different synthetic tripalmitoylated peptides derived from the invariant N terminus of three OMP, PCP, P4, and P6, that are common to all strains of NTHi (2, 11). As a positive control, we used the well-known TLR2 agonist (20) Escherichia coli-derived lipopeptide Pam3CysSK4 (LP), which we have previously shown induces substantial TNF-
production by both murine AM
and peritoneal M
(PM
) (18). As outcomes, we assayed cytokines and chemokines theorized to be responsible for the cardinal symptoms of AECB, exaggerated mucous production, and inflammatory cell recruitment (21, 22, 23). Our results indicate that type I IFN combines with OMP-mediated stimulation via TLR2 to elicit a strong inflammatory response by resident murine and human AM
. We also provide data showing that IFN-
contributes to transcriptional increased induction of TNF-
via a novel STAT1-dependent mechanism in murine AM
but not human AM
.
| Materials and Methods |
|---|
|
|
|---|
We purchased the following specific pathogen-free female mice from the indicated vendors: C57BL/6 mice from Charles River Laboratories; B6.129-Tlr2tm1Kir/j (TLR2/) mice from The Jackson Laboratory; and 129S6/SvEv-Stattm1Rds (STAT1/) and control 129S6/SvEv mice from Taconic Farms. Resident AM
and PM
were harvested as previously described (18). This study followed a protocol approved by the Animal Care Committee of the local institutional review board.
Synthetic bacterial lipoprotein analogs, other reagents, and M
cell lines
The following synthetic bacterial lipoprotein analogs were purchased from EMC Microcollections: Pam3Cys-Ala-Asn-Thr-Asp-Ile-Phe-Ser-Gly-Asp-Val-Tyr-Ser-Ala-Ser-Gln (abbreviated as PCP); Pam3Cys-Gly-Ser-His-Gln-Met-Lys-Ser-Glu-Gly-His-Ala-Asn-Met-Gln-Leu (abbreviated as P4); Pam3Cys-Ser-Ser-Ser-Asn-Asn-Asp-Ala-Ala-Gly-Asn-Gly-Ala-Ala-Gln-Thr (abbreviated as P6); and Pam3Cys-Ser-Lys-Lys-Lys-Lys-OH (also known as Pam3CysSK4) (abbreviated as LP). LPS (E. coli 0111:B4, Sigma-Aldrich) was repurified as described previously (18). Recombinant murine and human IFN-
were purchased from R&D Systems. The murine MH-S M
cell line and the human M
cell line THP-1 were purchased from American Type Culture Collection and grown in complete medium (RPMI 1640 containing 10% heat-inactivated FBS, 20 mM HEPES, 2 mM L-glutamine, 1 mM sodium pyruvate, 100 U/ml penicillin/streptomycin (all from Invitrogen Life Technologies)) in a 5% CO2 environment at 37°C. Before use in experiments, THP-1 were differentiated using 80 nM vitamin D3 (Calbiochem) to induce expression of CD14, which contributes to TLR2-mediated responses (24, 25).
Human subjects
Human AM
were isolated from five male subjects undergoing clinically indicated fiberoptic bronchoscopy as part of the diagnostic evaluation of solitary pulmonary nodules. Subjects (age 71.2 ± 10.0 years) (mean ± SD) all had COPD (forced expiratory volume, 1 second 49.3 ± 16.7% predicted) and had a smoking history of >20 packs per year, although only one actively smoked. No subjects had pulmonary abnormalities thought to be due to infectious, interstitial, or systemic disease. The study was approved by the institutional review board of the Ann Arbor Veterans Affairs Healthcare System, and all the subjects gave their signed consent. Bronchoalveolar lavage (BAL) was collected from the radiographically normal lung contralateral to the nodule, using 30-ml aliquots of normal saline to 180-ml total.
Isolation of human M
BAL cells were centrifuged (500 x g for 10 min) and washed twice with HBSS. Cell viability was assessed by trypan blue exclusion; BAL macrophages were isolated by plastic adherence. PBMC were obtained from the same donors and monocytes were isolated by plastic adherence as previously described (26). This method of purification results in >95% pure M
populations, as determined by morphological and surface marker analysis. After removal of nonadherent cells, M
were grown before stimulation in complete medium in a 5% CO2 environment at 37°C.
M
stimulation
Murine or human M
or M
cell lines were seeded at 8 x 105 cells/well in 24-well tissue culture plates (Costar) for Western blot analysis, or at 5 x 104 cells/well in 96-well plates (Costar) for ELISA and real-time PCR and incubated for the indicated times in complete medium alone, or complete medium containing 100 ng/ml of each of the three NTHI OMPs (PCP, P4, and P6), or 100 ng/ml LP, without or with the addition of 1000 U/ml rIFN-
of the appropriate species. In some experiments, M
were also cultured in medium containing 100 ng/ml OMP-free LPS.
Cytokine/chemokine ELISAs
The supernatants concentrations of TNF-
, IL-6, CCL5 (RANTES), and CXCL10 (IFN-
-inducible protein 10 (IP-10)) were determined by ELISA, using Duo Set Development Systems (R&D Systems).
Cell extracts, Western blot analysis, and gel documentation
Cell extract protein analysis and gel documentation was conducted as previously described (18). Primary Abs anti-STAT1, anti-phospho-STAT1 Y701, anti-p38, and anti-p-p38 were all from Cell Signaling Technology. The anti-IFN-regulatory factor-1 (IRF-1) Ab was from Santa Cruz Biotechnology. Densitometric analysis of films was performed using Gel Expert hardware and software (Nucleo Tech).
Real-time PCR and comparative quantitation analysis of murine mRNAs
For real-time analysis, total RNA was prepared from control and stimulated cells using the Absolutely RNA RT-PCR miniprep kit (Stratagene). DNase-treated total RNA was converted to cDNA and subsequently to specific PCR products using Brilliant SYBR Green QRT-PCR master mix kit, 1 step (Stratagene). cDNA conversion, amplification, and data analysis were performed using a Mx3000P Real-Time PCR System computerized cycler from Stratagene. We used the following primers, designed using software available at
http://biotools.idtdna.com/Primerquest/
(IDT), and synthesized and HPLC purified by Invitrogen Life Technologies: TNF-
sense, AGCCGATGGGTTGTACCTTGTCTA; TNF-
antisense, TGAGATAGCAAATCGGCTGACGGT; IL-6 sense, ATCCAGTTGCCTTCTTGGGACTGA; IL-6 antisense TAAGCCTCCGACTTGTGAAGTGGT; GAPDH sense, TATGTCGTGGAGTCTACTGGT; GAPDH antisense, GAGTTGTCATATTTCTCGTGG. Primers were used at 75 nM each in 25-µl reactions; cycle parameters were: 40 s at 55°C for the reverse transcription step, followed by a denaturation step at 95°C for 10 min and 36 cycles, each consisting of 30 s denaturation at 95°C, 1 min annealing at 60°C and 30 s at 72°C polymerization. Fluorescence data were collected and analyzed as previously described (18). For use in mRNA stability analysis, actinomycin D was obtained from EMD Biosciences.
Statistical analysis
Data were expressed as the mean ± SD of replicates in single experiments, or mean ± SEM. Samples were compared by two-tailed Student t test analyses. Statistical calculations were performed using Statview version 5.0 and Super ANOVA version 1.11 software (SAS Institute) on a Macintosh PowerPC G4 computer. Significant differences were defined as p < 0.05.
| Results |
|---|
|
|
|---|
and NTHi-derived OMPs synergize to up-regulate inflammatory cytokine and chemokine production by resident murine AM
To verify that M
stimulation by the synthetic NTHi OMP analogs PCP, P4, and P6 depended strictly on TLR2, we first tested each at doses up to 100 ng/ml on AM
from TLR2/ mice. As a known TLR2 agonist, we used E. coli-derived LP (20), which we have previously shown induces substantial TNF-
production by both murine AM
and PM
(18). In these experimental conditions, neither the three NTHi OMP nor LP showed any ability to induce TNF-
, whereas OMP-free LPS, a pure TLR4 stimulus, evoked a strong TNF-
production (Fig. 1), as anticipated (18). PM
from TLR2/ mice also showed a similar response (data not shown). Thus, the stimuli used throughout the remainder of this study depend strictly on TLR2.
|
modulates the AM
response to NTHi-derived TLR2 OMPs, we stimulated resident murine AM
from wild-type C57BL/6 mice with each of the three synthetic NTHi OMPs or the positive control LP, in the presence or absence of murine IFN-
. ELISA analysis of the AM
supernatants disclosed two major findings. First, AM
production of IL-6 in response to the NTHi OMPs depended almost entirely on combined stimulation with IFN-
(Fig. 2A). Treatment with IFN-
alone showed no effect. Second, addition of IFN-
strongly enhanced TNF-
release by AM
, relative to each of the three synthetic OMPs alone (Fig. 2B). Treatment with IFN-
alone did not induce TNF-
production. These results did not depend on the strain of mice, because similar findings were obtained using the AM
cell line MH-S, of BALB/c origin (data not shown), and another inbred strain (see below).
|
might result from an inadequate period of AM
stimulation. To exclude such a kinetic explanation, we next stimulated murine AM
overnight and assayed production of IL-6, as well as the chemokines CCL5 (RANTES) and CXCL10 (IP-10), which are thought to play pathogenetic roles in AECB (22, 23). Enhancement of IL-6 release by the simultaneous treatment with the different OMPs and IFN-
was even more pronounced, although IL-6 was just detectable in wells stimulated with the OMPs alone (Fig. 3A). Combinatorial stimulation also abundantly induced CCL5 and CXCL10, which were not seen on stimulation with the OMPs or LP alone (Fig. 3, B and C). Using the same combinatorial stimulations, comparable observations were made with resident PM
(data not shown). Hence, exogenous type I IFN can increase murine AM
production of inflammatory mediators central to the pathogenesis of AECB in humans on stimulation with otherwise ineffective concentrations of NTHi-derived products.
|
stimulation
Increased IL-6 and induction of CCL5 and CXCL10 by IFN-
results from the presence in the murine and human promoters of these proinflammatory genes of specific sequences that bind such IFN-regulated transcription factors as IFN-inducible transcription factor IRF-1, IRF-3, or the IFN-stimulated gene factor 3 (ISGF3) complex (27, 28, 29, 30, 31, 32). Significantly, we found that stimulation of AM
by the synthetic OMP PCP plus IFN-
induced rapid synthesis of IRF-1 (Fig. 4, A and B, top). We also found that the combined stimulation induced phosphorylation of STAT1 on Y701 (Fig. 4, A and B, second from top), indicative of ISGF3 activity (18). AM
abundantly expressed IRF-3 protein at steady state (data not shown).
|
stimulation on TNF-
production (Fig. 2B) was unanticipated from the literature. Accordingly, we next analyzed known activation pathways resulting from the triggering of either TLR2 or IFN-
receptors to gain an understanding of potential mechanisms. For these experiments, we used only the PCP-derived lipopeptide, which had shown the greatest effects on resident AM
(Figs. 2 and 3). As expected (15, 33), we found activation or strong induction of the transcription factors IRF-1 (Fig. 4, A and B, top), STAT1 (Fig. 4, A and B, second from top), and STAT2 (data not shown) only when AM
were stimulated with IFN-
. Addition of IFN-
to AM
stimulated with PCP did not alter the pattern of activation of p38 (Fig. 4B, fourth from top) or of JNK, ERK MAPKs, or NF-
B p65 (data not shown). Treatment of AM
with IFN-
alone for up to 4 h did not activate JNK or NF-
B p65 (data not shown), and had very minimal effect on induction of phospho-p38 (Fig. 4A, fourth from top) and phospho-ERK (data not shown).
Interestingly, the presence of PCP during IFN-
stimulation increased IRF-1 protein (Fig. 4A, top, C, and E) and markedly sustained phosphorylation of STAT1 at Y701 through 4 h, relative to stimulation by IFN-
alone (Fig. 4A, second from top, and D). As anticipated, TLR2 stimulation alone by PCP did not induce STAT1 phosphorylation (Fig. 4B, second from top).
Based on these results, and on the observation that TLR2 stimulation likewise does not induce activation of the IRF-3 complex (34, 35), we speculated that the augmented TNF-
production we found on combined stimulation by IFN-
and NTHi OMP (Fig. 2B) might reflect a transcriptional mechanism by which signals emanating from the IFN-
R and signals from the TLR2 pathway might converge on target inflammatory genes.
A specific transcriptional role for IFN-
in the increased production of TNF-
by murine AM
To address this possibility, murine resident AM
were treated for 3 or 6 h with IFN-
, PCP, or both simultaneously, and the levels of TNF-
mRNA were determined by real-time PCR. Confirming our hypothesis, the combination rapidly and strongly increased TNF-
mRNA concentrations above those seen on treatment with PCP alone (Fig. 5A). As expected, IFN-
treatment alone had minimal effect on TNF-
mRNA induction.
|
on induction of IL-6 mRNA, because increased mRNA levels of that cytokine have been found on combined treatment of HeLa cells with IFN-
and the TLR3 stimulant dsRNA (36). Strong and persistent induction of IL-6 was also seen only when both stimuli were given (Fig. 5B). Similar results were obtained using the murine AM
cell line MH-S (data not shown). These results indicate that IFN-
, when it is present during TLR2 stimulation, regulates the transcription of both TNF-
and IL-6 in murine AM
.
A well-known mechanism to control TNF-
mRNA expression relies on its destabilization due to A + U-rich elements in the 3' untranslated region of the gene (37). To test whether the observed increase in TNF-
mRNA amounts could be ascribed to increased mRNA stability, we used the transcriptional inhibitor actinomycin D (10 µg/ml) and using real-time PCR, analyzed mRNA turnover in murine AM
treated with PCP or PCP plus IFN-
. We found that TNF-
mRNA underwent rapid turnover regardless of IFN-
, i.e., with either treatment, >90% of the specific TNF-
mRNA was lost after incubation of the stimulated AM
with the drug (Fig. 6). Thus, increased mRNA stability does not appear to be responsible for increased production of TNF-
by IFN-
in murine M
.
|
mRNA is dependent on the transcription factor STAT1
All our previous results pointed to a direct transcriptional role for IFN-
in the observed increase in TNF-
mRNA by IFN-
cotreatment. Because IFN-
treatment can elicit both STAT1-dependent and STAT1-independent mechanisms (15, 33), we next analyzed TNF-
protein production in supernatants of AM
of wild-type or STAT1-gene targeted mice stimulated by PCP or PCP plus IFN-
. Increased production of TNF-
was detected only in AM
of wild-type mice (Fig. 7A). As anticipated from our results and Ref. 38 , IL-6 up-regulation was also STAT1 dependent (Fig. 7B).
|
mRNA levels of resident AM
from both strains of mice after 3 or 6 h of incubation with PCP or PCP plus IFN-
showed that STAT1, directly or indirectly, is indispensable for the up-regulated TNF-
mRNA levels observed on combined TLR2 and IFN-
stimulation (Fig. 7C).
Combined stimulation of human IFN-
and NTHi-derived OMP up-regulates IL-6 but not TNF-
production by human AM
Because NTHi is a human pathogen, we wanted to test whether the findings obtained using murine M
could be extended to human M
. To this purpose, we examined cytokine production by primary resident human AM
, which we exposed to human IFN-
, NTHi OMP analogs or both. The TLR2 agonist LP was used as a positive control, as it has been shown to stimulate human M
(39). We assessed both TNF-
and IL-6 production, because published data indicated that in humans as in mice, IL-6 gene expression involves both NF-
B activation (27, 28) and STAT1-dependent IRF-1 synthesis (38).
Adherence-purified human AM
responded to PCP and P6 (but not to P4) by releasing substantial amounts of IL-6 only in the presence of human IFN-
(Fig. 8A). However, AM
production of TNF-
was not significantly up-regulated by costimulation in any of the donors (Fig. 8B). Similar responses were seen using M
isolated from PBMC of two of the same donors and using the vitamin D3-differentiated THP-1 M
cell line (data not shown). We considered the possibility that chronic lower respiratory infections might blunt the responsiveness of COPD patients to exogenous IFN-
. The increased IL-6 production on simultaneous treatment with IFN-
and PCP or P6 (Fig. 8A) argues that any such effect is incomplete, but to further investigate this possibility, we tested for basal STAT1 phosphorylation and for spontaneous IFN-
release in two additional subjects with COPD, and found none (data not shown). Thus, although the NTHi-derived lipopeptides PCP and P6 acquire strong IL-6-inducing activity when used to stimulate M
in the presence of human IFN-
, the STAT1-dependent increase in TNF-
production they induce in mice appears not to be conserved in humans.
|
genes in the two species. The human IL-6 promoter contains sequences that bind IRF-1, activity of which (in addition to NF-
B) is essential for IL-6 production (28). Using TESS promoter analysis software (
www.cbil.upenn.edu/tess/
), we found corresponding IRF-1-binding sites in the murine IL-6 promoter (GenBank accession no. M20572). Analysis of the murine TNF-
promoter (GenBank accession no. AB062426) revealed two potential IFN-stimulated response elements (ISRE) that match the consensus sequence AGTTTCNNTTCNC/T (33). These elements are located 122 and 499 bp upstream from the ATG translational start site. In agreement with our ELISA data in the human system (Fig. 8B), we found no such ISRE consensus sequences in the promoter of the human TNF-
gene (GenBank accession no. AB088112). | Discussion |
|---|
|
|
|---|
to mount a strong inflammatory response to NTHi OMPs that are themselves relatively innocuous. Using TLR2-specific synthetic tripalmitoylated lipopeptides that correspond to the invariant portion of three highly conserved NTHi OMPs (2), we found that IFN-
markedly increases a cytokine (IL-6) and induces two chemokines (CCL5, CXCL10) that drive mucus production and inflammatory cell recruitment, respectively. This observation is noteworthy because TLR2 is unique, among the nine TLRs common to mice and humans, for being incapable of autocrine/paracrine STAT1 activation via IFN-
production (34, 35). We now show that direct activation of STAT1 by IFN-
during TLR2 signaling permits induction of cytokines and chemokines which are typically induced by TLR3 or TLR4 stimulation alone. We also found that TLR2-induced TNF-
production is up-regulated by a STAT1-dependent transcriptional mechanism in murine AM
, but not in human AM
. By showing how IFN-
modulates the host response to components of a Gram-negative pathogen, these data emphasize that the importance of type I IFN to innate immunity is not limited to its antiviral properties (15, 16), and provide a partial explanation for the association of viral respiratory tract infections with AECB.
Mechanistically, the effects we found on addition of IFN-
to TLR2 stimuli (synergistic increase in IL-6, induction of CCL5 and CXCL10, and disparity in the effect on TNF-
between mice and humans) are all explained by the presence or absence of ISRE in the promoters of these proinflammatory genes. Both the murine and human IL-6 genes contain IRF-1-binding sites. CCL5 and CXCL10 production in both species depends strictly on the IFN-regulated factors IRF-3 and IRF-1, respectively (30, 31). By contrast, the human TNF-
promoter lacks the ISRE elements found in the mouse. Interestingly, the TNF family member TRAIL is induced by IFN-
via STAT1 activation in human cells (40), suggesting that it is the human TNF-
promoter that has diverged from a primordial mechanism retained in the mouse. Because IRF-binding sites in the murine TNF-
promoter match the ISRE inner core, this region could bind either STAT or IRF proteins (41). Indeed, previous chromatin immunoprecipitation data identified phospho-STAT1 binding in the murine TNF-
gene (42). Clearly, the precise mechanisms by which STAT1 up-regulates TNF-
transcription in the murine system, and their significance, require further investigation.
It should not be surprising that the finding that TNF-
production by TLR2-stimulated resident murine M
can be magnified by a STAT1-dependent transcriptional mechanism has gone undetected. LPS stimulation of murine PM
(the stimulus and cell type most commonly used to study TNF-
production) itself induces IFN-
via an autocrine/paracrine loop (43). Our findings provide a potential explanation for the resistance of IFN-
/ mice to LPS-induced lethality (17) and for similarities between IFN-
/ mice and TNF-
/ mice (44), that led Deonarain et al. (44) to hypothesize a critical immunoregulatory interrelationship between IFN-
and TNF-
. We now extend their data using a TLR2-dependent stimulus and resident murine AM
, a cell type we have shown cannot produce IFN-
upon LPS stimulation (18).
The AM
products that we measured have considerable potential to contribute to lung pathology. IL-6 is the only cytokine that directly up-regulates expression by primary human tracheobronchial epithelial cells of the principal airway mucin genes, MUC5B and MUC5AC (45). CCL5 and CXCL10 are potent recruitment signals for cell types bearing their respective receptors, CCR5 (T cells, monocytes) and CXCR3 (T, B, NK, NKT, and mast cells) (46). As a non-Glu-Leu-Arg-containing CXC chemokine, CXCL10 also has angiogenic and profibrotic properties that might contribute to the marked small airway thickening and peribronchial fibrosis seen in advanced COPD (47).
COPD is increasingly recognized as an inflammatory disease (47). Although the roles of bacterial infections in AECB and in COPD progression remain controversial (48, 49), several recent findings imply that NTHi contribute importantly to both processes. NTHi is the bacteria most commonly isolated from expectorated sputum of both stable COPD patients and during AECB (4, 5), and the increased frequency of its isolation during AECB, relative to the stable state (5), is consistent with an etiological role. In a study using bronchoscopic protected brush sampling, isolation of NTHi increased between the stable and exacerbated state (50). Moreover, molecular evidence of NTHi persistence despite negative sputum cultures (51) implies that NTHi colonization of the lower tracheobronchial tree in COPD has likely been underestimated. Hence, our results suggest that production of type I IFN by virally infected airway cells already colonized by NTHi could be a common trigger for the inflammation characteristic of AECB.
A potential limitation of our human data is that AM
were obtained from subjects with a history of COPD, although none had suffered recent exacerbation. Hence, it is possible that the responsiveness of their AM
to IFN-
was altered, relative to normal subjects or healthy smokers, by previous lower airway infections. Testing this interesting possibility will require considerably greater study.
The two strain-conserved OMP that we showed elicit a strong response in human M
, PCP and P6, are attractive candidate immunogens (2, 11). Indeed, other TLR2 stimulants are currently being evaluated in such settings (52), and TLR2 ligands have been shown to exert an adjuvant role in human Th1 responses (53). Coadministration of IFN-
as an adjuvant may increase immunization efficiency, as type I IFN powerfully stimulates development and activity of monocyte-derived dendritic cells (54, 55).
In summary, we show that IFN-
, which is produced by virally infected respiratory epithelial cells, converts normally innocuous NTHi OMPs into potent stimulants for AM
production of inflammatory mediators, but does so via different mechanisms in mice and humans. By activating STAT1, exogenous IFN-
compensates for the inability of TLR2-initiated signals to be amplified by the autocrine/paracrine loop observed during TLR3 and TLR4 activation.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by Merit Review funding and a Research Enhancement Award Program grant from the Department of Veterans Affairs and by RO1 HL056309 and HL082480 from the U.S. Public Health Service. ![]()
2 Address correspondence and reprint requests to Dr. Jeffrey L. Curtis, Pulmonary and Critical Care Medicine Section (506/111G), Department of Veterans Affairs Medical Center, 2215 Fuller Road, Ann Arbor, MI 48105-2303; E-mail address: jlcurtis{at}umich.edu or Dr. Antonello Punturieri, National Heart, Lung, and Blood Institute, 2 Rockledge Center, Suite 10018, 6701 Rockledge Drive, Bethesda, MD 20892. E-mail address: puntieria{at}nih.nhlbi.gov ![]()
3 Abbreviations used in this paper: NTHi, nontypeable Haemophilus influenzae; COPD, chronic obstructive pulmonary disease; AECB, acute exacerbations of chronic bronchitis; OMP, outer membrane lipoprotein; M
, macrophage; AM
, alveolar M
; LP, lipopeptide Pam3CysSK4; PM
, peritoneal M
; BAL, bronchoalveolar lavage; IRF, IFN-regulatory factor; ISRE, IFN-stimulated response element; IP-10, IFN-
-inducible protein 10. ![]()
Received for publication February 6, 2006. Accepted for publication April 14, 2006.
| References |
|---|
|
|
|---|
B by nontypeable Haemophilus influenzae is mediated by Toll-like receptor 2-TAK1-dependent NIK-IKK
/
-I
B
and MKK3/6-p38 MAP kinase signaling pathways in epithelial cells. Proc. Natl. Acad. Sci. USA 98: 8774-8779.
/
) in immunity and autoimmunity. Annu. Rev. Immunol. 23: 307-336. [Medline]
-mediated innate signal amplification and STAT1 phosphorylation in resident murine alveolar macrophages. J. Immunol. 173: 1033-1042.
and tumor necrosis factor-
in monocytic cells involves cooperation between interferon regulatory factor-1, NF
B, and Sp1 transcription factors. J. Biol. Chem. 270: 27920-27931.
B and IFN-regulatory factor transcription factors. J. Immunol. 164: 5352-5361.
B sequence motifs controls IFN
- and lipopolysaccharide-stimulated transcription from the murine IP-10 promoter. J. Biol. Chem. 268: 6677-6688.
-containing complexes play a predominant role in induction of IFN-
-inducible protein, 10 kDa (IP-10) by IFN-
alone or in synergy with TNF-
. J. Immunol. 161: 4736-4744.
synergistically enhances induction of interleukin-6 by double stranded RNA in HeLa cells. Eur. J. Biochem. 267: 2768-2777. [Medline]
. J. Biol. Chem. 271: 5790-5794.
in human cancer cells. Cancer Res. 63: 5299-5307.
gene expression by IFN-
and pamidronate in murine macrophages: regulation by STAT1-dependent pathways. J. Immunol. 174: 1801-1810.
-induced STAT1
/
-dependent gene expression in macrophages. Nat. Immunol. 3: 392-398. [Medline]
in lymphoid development, myelopoiesis, and tumor development: links to tumor necrosis factor
. Proc. Natl. Acad. Sci. USA 100: 13453-13458. This article has been cited by other articles:
![]() |
J. L. Curtis, C. M. Freeman, and J. C. Hogg The Immunopathogenesis of Chronic Obstructive Pulmonary Disease: Insights from Recent Research Proceedings of the ATS, October 1, 2007; 4(7): 512 - 521. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |