The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kryczek, I.
Right arrow Articles by Zou, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kryczek, I.
Right arrow Articles by Zou, W.
The Journal of Immunology, 2006, 177: 40-44.
Copyright © 2006 by The American Association of Immunologists

CUTTING EDGE

Cutting Edge: Induction of B7-H4 on APCs through IL-10: Novel Suppressive Mode for Regulatory T Cells1

Ilona Kryczek*, Shuang Wei*, Linhua Zou*, Gefeng Zhu{dagger}, Peter Mottram{ddagger}, Huanbin Xu{ddagger}, Lieping Chen{dagger} and Weiping Zou2,*

* Department of Surgery, University of Michigan, Ann Arbor, MI 48109; {dagger} Department of Dermatology, Johns Hopkins University, Baltimore, MD 21287; and {ddagger} Tulane University Health Sciences Center, New Orleans, LA 70112


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Multiple modes of suppressive mechanisms including IL-10 are thought to be implicated in CD4+CD25+ regulatory T (Treg) cell-mediated suppression. However, the cellular source, role, and molecular mechanism of IL-10 in Treg cell biology remain controversial. We now studied the interaction between Treg cells and APCs. We demonstrate that Treg cells, but not conventional T cells, trigger high levels of IL-10 production by APCs, stimulate APC B7-H4 expression, and render APCs immunosuppressive. Initial blockade of B7-H4 reduces the suppressive activity mediated by Treg cell-conditioned APCs. Further, APC-derived, rather than Treg cell-derived, IL-10 is responsible for APC B7-H4 induction. Therefore, Treg cells convey suppressive activity to APCs by stimulating B7-H4 expression through IL-10. Altogether, our data provide a novel cellular and molecular mechanism for Treg cell-mediated immunosuppression at the level of APCs, and suggest a plausible mechanism for the suppressive effect of IL-10 in Treg cell-mediated suppression.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Treg cells comprise 5–10% of the circulating CD4+ T cell population and play a crucial role in different pathological settings (1, 2, 3, 4). Multiple suppressive modes are proposed to explain the suppressive mechanisms of regulatory T (Treg)3 cells (5). Some in vitro experimental data suggest a minor role of IL-10 in Treg cell-mediated suppression (6, 7). However, numerous in vivo models have demonstrated a nonredundant role of IL-10 in Treg cell-mediated suppression (8, 9, 10). Nonetheless, the source and molecular suppressive mechanisms of IL-10 in the context of Treg cell biology remain elusive.

B7-H4 is a recently discovered B7 family member. B7-H4 negatively regulates T cell responses in vitro (11, 12, 13). Treg cells (2) and suppressive B7-H4+ macrophages (14) were localized in ovarian tumor. In this report, we studied the interaction between Treg cells and APCs. Our study reveals a previously unappreciated mechanistic relationship among IL-10, B7-H4, Treg cells, and APCs and demonstrates a novel molecular and cellular suppressive mechanism for Treg cell-mediated immunosuppression.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Human cells

Peripheral blood CD14+ cells, CD4+CD25– T cells, CD4+CD25bright T cells (Treg cells), CD4+CD45RO+CD25– T cells, and lin–HLA-DR+CD11c+ Primary myeloid dendritic cells (MDCs) were sorted with FACSaria (BD Biosciences) with purity >98% (15). Monocyte-derived DCs (MDDCs) were obtained as described (16). Cells were stained with mAbs and analyzed on a LSR II (BD Biosciences). Mouse anti-human Abs, including CD4-FITC (SK3), CD25-PE (MA251), HLA-DR-PercP (L243), CD11c-allophycocyanin (B-ly6), and CD14-allophycocyanin-Cy7 (M{Phi}P9) were obtained from BD Biosciences.

Human FOXP3 detection

RT-PCR was conducted for FOXP3 (2). Results were expressed as fold differences relative to GAPDH (2). FOXP3 protein was detected by intracellular staining with rat anti-human FOXP3 Ab (clone PCH101; eBioscience).

Human T cell immunosuppressive assay

T cell immunosuppression was tested in a coculture system. CD4+CD25– T cells (2 x 105/ml) were stimulated with 2.5 µg/ml anti-human CD3 (clone UCHT1), 1.2 µg/ml anti-human CD28 (clone CD28.2) (BD Biosciences), and fresh monocytes (2 x 105/ml) in the presence of different concentrations of Treg cells or different concentrations of conditioned CD14+ cells as indicated. Seventy-two hours after coculture, T cell proliferation was evaluated by thymidine incorporation. In some cases, CD14+ cells were incubated with mouse anti-human IL-10 receptor (0.5 µg/ml, mouse IgG1, clone 37607; R&D Systems) as indicated.

Mouse experiments

C57BL wild-type and IL-10–/– mice (The Jackson Laboratory) were maintained in specific pathogen-free conditions. Eight-week-old female mice were used in all the experiments. Mouse CD11b+ cells, CD4+CD25+ cells, and CD4+CD25– T cells were enriched from spleen cells with mouse CD4 selection kits (StemCell Technology) and sorted with high purity (> 95%). Mouse T cell immunosuppression was tested in a coculture system. CD4+CD25– T cells (2 x 105/ml) were stimulated with 2.5 µg/ml anti-mouse CD3 (clone145-2C11; BD Biosciences) and fresh CD11b+ cells (2 x 105/ml) in the presence of different concentrations of CD4+CD25bright T cells (Treg cells). Seventy-two hours after coculture, T cell proliferation was evaluated by thymidine incorporation.

Expression and regulation of human APC B7-H4 expression

Blood CD14+ cells, MDCs, and MDDCs (1 x 106/ml) were cultured for 72 h with human rIL-10 (R&D Systems) or with different concentrations of autologous CD4+CD25– T cells, Treg cells (0–1 x 106/ml) in the presence of anti-human CD3, and anti-human CD28. In some cases, cytokines were detected by ELISA (R&D Systems) in the culture supernatants. Neutralizing mAb against human IL-10 (clone 23738, 50 ng/ml; R&D Systems) was used as indicated. B7-H4 mRNA was detected by RT-PCR (17). To detect B7-H4 protein, cells were initially incubated with human AB serum to block nonspecific binding and then stained with mouse anti-human B7-H4 (hH4.1, IgG1, 4 µg/ml) (11), further stained with goat anti-mouse Ab (BD Biosciences). Additional controls were cells stained with medium, primary mAb, second mAb with or without isotypes. B7-H4 surface protein was analyzed by flow cytometry.

Blockade of human B7-H4 induction

Antisense morpholino oligonucleotide specific for B7-H4 (GAGGATCTGCCCCAGGGAAGCCATG) (B7-H4 blocking oligos), and the inverted oligonucleotide (control oligos) were produced by GeneTools. To block B7-H4 induction, monocytes were incubated for 3 h with 0.6 µM oligos in serum-free medium supplemented with 0.2 µM ethoxylated polyethylenimine (GeneTools). Cells were washed twice and used for additional experiments.

Statistical analysis

Differences in cell surface molecule expression were determined by {chi}2 test, and in other variables by unpaired t test, with p < 0.05 considered significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Treg cells, but not conventional T cells, trigger APC-dependent, high levels of IL-10

CD4+CD25bright T cells, but not CD4+CD25– T cells, highly expressed FOXP3 mRNA (n = 12; *, p < 0.001) (Fig. 1A). Treg cells are thought to be enriched in CD4+CD25bright T cell population (17). FOXP3+ T cells were largely found in CD4+CD25bright T cell population (Fig. 1B). CD4+CD25bright T cells inhibited T cell proliferation in a dose-dependent manner (n = 10; *, p < 0.01, **p < 0.0001) (Fig. 1C). Therefore, we sorted CD4+CD25bright T cells (Treg cells) for our experiments.


Figure 1
View larger version (38K):
[in this window]
[in a new window]
  		FIGURE 1. Human Treg cells trigger APC-dependent, high levels of IL-10. A, CD4+CD25+ T cells express FOXP3 mRNA. CD4+CD25bright T cells were sorted by FACS from blood. FOXP3 mRNA was determined by RT-PCR as described (2 20 ). Inset, FOXP3 RT-PCR products migrated in the gel.; CD25+, Treg cells; CD25–, CD4+CD25– T cells; Control, no cDNA input. B, CD4+CD25+ T cells express FOXP3 protein. FOXP3 protein was analyzed by intracellular staining (gated on CD4+CD3+ cells) (see Materials and Methods). Results were expressed as the percent of FOXP3+ in CD4+ T cells (upper panel), CD4+CD25– T cells, CD4+CD25dim T cells and CD4+CD25bright T cells (histogram, lower panel). n = 7. C, Treg cells suppress T cell activation in vitro. CD3+CD25– T cells were cultured with different concentrations of autologous Treg cells as indicated. T cell proliferation was determined by thymidine incorporation. Results are expressed as the mean cpm ± SEM. D, Treg cells induce APC-dependent IL-10 production. Autologous Treg cells and conventional T cells were cocultured in the presence or absence of CD14+ cells as described. The culture supernatants were collected, and IL-10 was detected in the supernatants with ELISA kit. Results are expressed as the mean value ± SEM.

 
We studied the interaction between APCs and Treg cells. Treg cells or CD4+CD25– T cells or CD4+CD45RO+CD25– T cells were cocultured for 72 h with autologous monocytes in the presence of anti-human CD3 and CD28. We detected higher levels of IL-10 in the culture supernatants with Treg cells than conventional T cells (n = 7; *, p < 0.04) (Fig. 1D). The production of TNF-{alpha}, but not IL-10, was higher in the culture with CD4+CD45RO+CD25– T cells (632 ± 87 pg/ml) than with Treg cells (91 ± 22 pg/ml) and CD4+CD25– T cells (132 ± 53 pg/ml) (n = 4; p < 0.01), whereas there was no significant difference in IL-1beta production among the three groups. These data suggest that Treg cells, but not conventional T cells, may selectively trigger high levels of IL-10 production.

We detected little IL-10 in the culture supernatants when monocytes were omitted. Addition of monocytes resulted in significantly higher levels of IL-10 production in Treg cell and monocyte coculture (n = 7; *, p < 0.001) (Fig. 1D). Similar results were observed when monocytes were replaced by MDCs and MDDCs. Altogether, our data demonstrate that Treg cells condition APC-dependent, high levels of IL-10 production.

Treg cell suppressive capacity is reduced in the absence of IL-10 in APCs

To determine the importance of the high levels of IL-10 triggered by Treg cells, we sorted CD11b+ monocytes, Treg cells, and CD4+CD25– T cells from wild-type and IL-10–/– mice. We cocultured autologous Treg cells with T cells and CD11b+ cells in the presence of anti-CD3 mAb. As expected, IL-10–/– and IL-10+/+ Treg cells exhibited a dose-dependent suppressive activity in vitro. However, the levels of suppression were significantly higher in the group with all the cells from IL-10+/+ mice than from IL-10–/– mice (n = 5; p < 0.05) (Fig. 2A). Thus, although IL-10 is not essential for Treg cell suppressive activity, the presence of IL-10 profoundly enhances Treg cell-mediated suppression.


Figure 2
View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 2. Mouse Treg suppressive capacity is reduced in the absence of IL-10 in APCs. Mouse Treg suppressive capacity is reduced in the presence of IL-10–/– APCs. Treg cells, CD4+CD25– T cells and CD11b+ cells were sorted from wild-type and IL-10–/– mice. Variable concentration of Treg cells were cocultured with 2 x 105/ml CD4+CD25– T cells and CD11b+ cells were cocultured for 72 h in the presence of soluble anti-mouse CD3 mAb. T cell proliferation was determined by thymidine incorporation. A, Treg-mediated suppression in IL-10–/– vs IL-10+/+ mice. B, Treg-mediated suppression in different combinations of cells from IL-10–/– and IL-10+/+ mice. Treg-mediated suppression was analyzed with different combinations of cells sorted from IL-10–/– and IL-10+/+ mice as indicated. Treg-mediated suppressive activity was expressed as the mean percentage of suppression ± SEM. The percent of suppression was calculated with the formula: 100% – 100 x cpm values with Treg cells/cpm values without Treg cells. Different concentrations of Treg cells were used. Results were shown at 4 x 104/ml Treg cells. IL-10–/–, cells from IL-10–/– mice; W, cells from wild-type mice.

 
To determine which population is responsible for IL-10 production, we used various combinations of cells from IL-10–/– and IL-10+/+ mice (Fig. 2B). We showed that when the ratio between Treg cells and CD4+CD25– T cells was <1:1, the addition of IL-10–/–CD11b+ cells resulted in significant reduction of Treg cell-mediated suppression (n = 5; *, p < 0.05, compared with IL-10+/+CD11b+ cells) (Fig. 2B and data not shown). When the ratio between Treg cells (2 x 105/ml) and CD4+CD25– T cells (2 x 105/ml) was 1:1, the levels of Treg-mediated suppression reached the plateau and were comparable among different cellular combinations. It suggests that APC-derived IL-10 is critical for Treg cell suppressive activity.

IL-10–/– Treg cells or IL-10–/– conventional T cells slightly affected Treg cell-mediated suppression (p > 0.05) (Fig. 2B). Our data suggest that APC-dependent, but not Treg cell-dependent IL-10, implicates in Treg cell-mediated suppression.

Treg cells enable APC suppressive activity

Our human studies suggest that Treg cells triggered APC-dependent IL-10 production (Fig. 1D). The experiments with IL-10–/– mice indicated that APC-derived IL-10 implicates in Treg cells suppressive activity (Fig. 2). We asked whether Treg cell-conditioned APCs are distinct from conventional T cell-conditioned APCs. To this end, we incubated CD14+ cells with Treg cells or conventional T cells in the presence of anti-human CD3 and anti-human CD28. Seventy-two hours later, we sorted these monocytes and tested their capacity of activating T cells. Strikingly, CD14+ cells pretreated with Treg cells, but not CD4+CD25– T cells and medium, significantly suppressed T cell proliferation (n = 5; * p < 0.05) (Fig. 3A). The data indicate that Treg cells enable APC suppressive activity.


Figure 3
View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 3. Human Treg cells render CD14+ cells immunosuppressive. A, Treg cell-conditioned monocytes are suppressive. Fresh CD14+ cells were cultured with autologous Treg cells or CD4+CD25– T cells or medium in the presence of soluble anti-CD3 and anti-CD28 mAbs for 72 h. CD14+ cells were sorted from this coculture. Different concentrations of the sorted CD14+ cells were further cultured with fresh CD4+CD25– T cells for 3 days in the presence of anti-CD3 and anti-CD28 mAbs. T cell proliferation was detected by thymidine incorporation. Results are expressed as the mean cpm ± SEM. B, IL-10 is crucial for Treg cell-conditioned monocyte-mediated T cell suppression. In the above culture system, CD14+ cells were initially incubated with anti-human IL-10 receptor. After being conditioned with Treg cells, CD14+ cells (4 x 104/ml) were subject to T cell activation in the presence of anti-human IL-10 receptor. Results are expressed as the mean percentage of T cell proliferation ± SEM. C–E, Treg cells stimulate B7-H4 expression on APCs. APC subsets were cocultured with different concentrations of Treg cells or CD4+CD25– T cells for 3 days in the presence of anti-CD3 and anti-CD28 mAbs. B7-H4 expression was analyzed by FACS. B7-H4 expression was expressed as the mean percentage of positive cells ± SEM in gated CD14+ cells (C and D) and CD11c+ cells (D). B7-H4 expression also was expressed by histogram (E). Treg cell concentration was 1 x 106/ml for D and E.

 
To study the role of IL-10 in T cell suppression mediated by Treg cell-conditioned APCs, Treg cell-conditioned CD14+ cells were preincubated with mouse anti-human IL-10 receptor, sorted, and further cultured with conventional T cells in the presence of anti-IL-10 receptor. We observed that T cell suppression mediated by Treg cell-conditioned CD14+ cells was significantly reduced (n = 4; *, p < 0.03) (Fig. 3B). These data suggest that APC-derived IL-10 implicates in T cell suppression mediated by Treg cell-conditioned APCs.

Treg cells selectively stimulate APC B7-H4 expression

We further studied the phenotype of CD14+ cells conditioned by Treg cells and conventional T cells. Treg cells, but not conventional T cells, including CD4+CD45RO+CD25– T cells, stimulated B7-H4 expression on CD14+ cells (n = 12; *, p < 0.001) (Fig. 3, C–E, and data not shown). We observed similar expression of CD40, CD54, CD80, and HLA class I and II expression on Treg cell-conditioned and conventional T cell-conditioned monocytes. It suggests that Treg cells may selectively stimulate B7-H4 expression on monocytes.

To determine whether Treg cells stimulate B7-H4 in different APC subsets, we cocultured Treg cells with MDCs or MDDCs. We showed that Treg cells significantly stimulated B7-H4 expression on MDCs and MDDCs (n = 8; *, p < 0.01 for all) (Fig. 3, D and E). The data indicate that Treg cells can induce B7-H4 expression on multiple APC subsets.

Induction of APC B7-H4 is IL-10 dependent

Treg cells trigger high levels of IL-10 production (> 1 ng/ml) (Fig. 1D). We hypothesized that IL-10 may contribute to B7-H4 induction on APCs. To test this, we analyzed B7-H4 expression on CD14+ cells during coculture with Treg cells in the presence of neutralizing Ab against IL-10. Anti-human IL-10 partially but significantly decreased CD14+ cell B7-H4 expression (n = 6; *, p < 0.001) (Fig. 4A). In support of this, rIL-10 stimulated B7-H4 expression on APCs (n = 6; p < 0.001) (Fig. 4, B and C). Further, low concentrations of IL-10 (0.1–1 ng/ml) efficiently stimulated B7-H4 expression on APCs (Fig. 4B), but not CD40, CD80, and CD86 expression (data not shown). Thus, Treg cells trigger APC B7-H4 expression at least partially through IL-10.


Figure 4
View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 4. Induction of APC B7-H4 by Treg cells is IL-10 dependent. A, Induction of APC B7-H4 by Treg cells is IL-10 dependent. Autologous Treg cells were cultured with CD14+ cells with anti-CD3 and anti-CD28 mAbs for 3 days in the presence of anti-human IL-10 or and control mAb. B7-H4 expression was analyzed on CD14+ cells. B, rIL-10 induces B7-H4 expression on APC subsets. APC subsets were cultured for 72 h in medium or different concentrations of IL-10. B7-H4 expression was analyzed by FACS and expressed as the mean percentage of positive cells ± SEM (A and B) or histogram (C).

 
Blocking B7-H4 reduces the suppressive activity of Treg cell-conditioned APCs

We next determined whether APC B7-H4 is involved in the Treg cell-suppressive capacity. Specific neutralizing anti-human B7-H4 mAb is not available. We designed the B7-H4 blocking oligos and control oligos.

We initially studied IL-10-stimulated normal monocytes. The B7-H4 blocking oligos, but not control oligos, significantly inhibited basal and IL-10-induce B7-H4 mRNA expression by at least 1000-fold (Fig. 5A). B7-H4 blocking oligos also blocked B7-H4 protein induced by IL-10 (n = 6; p < 0.05) (Fig. 5B). Neither B7-H4 blocking oligos nor control oligos affected macrophage MHC class I, MHC class II, CD16, CD32, CD80, or CD86 expression (data not shown).


Figure 5
View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 5. Supressive activity of Treg-conditioned APCs is B7-H4 dependent. A, B7-H4 blocking oligos block monocyte B7-H4 mRNA. Blood monocytes were exposed to B7-H4 blocking oligos or control oligos for 24 h with or without IL-10. B7-H4 mRNA was detected by RT-PCR. n = 9. B, B7-H4 blocking oligos block IL-10-induced monocyte B7-H4 protein. Blood monocytes were exposed to B7-H4 blocking oligos and control oligos with IL-10 (10 ng/ml). Cell surface B7-H4 was detected by FACS analysis. Results were expressed as the mean percentage of positive cells ± SEM. C, B7-H4 blocking oligos block Treg-induced monocyte B7-H4 expression. Blood monocytes were exposed to B7-H4 blocking oligos, control oligos, and medium and were cocultured with Treg cells as described. B7-H4 expression was detected by FACS by gating on CD14+ cells. Results were expressed as the mean percentage of positive cells ± SEM. D, Oligos exposed, Treg-conditioned CD14+ cells were sorted and further subject to stimulating autologous CD4+CD25– T cells as described. T cell proliferation was measured with thymidine incorporation. Results were expressed as the mean cpm values ± SEM.

 
We next examined whether B7-H4 blocking oligo would block Treg cell-induced B7-H4 expression on monocytes. Normal blood monocytes were initially exposed to B7-H4 blocking oligos or control oligos and then cocultured with Treg cells. The B7-H4 blocking, but not control oligos, significantly reduced monocyte B7-H4 expression induced by Treg cells, whereas control oligos had no significant effects on B7-H4 expression (n = 6; *, p < 0.05) (Fig. 5C). These data indicate that B7-H4 blocking oligos specifically block Treg-induced monocyte B7-H4 expression.

We further evaluated the role of B7-H4 in T cell suppression mediated by Treg-conditioned monocytes as we described (Fig. 3A). To this end, we initially exposed normal monocytes to B7-H4 blocking oligos or control oligos or medium. These monocytes were subsequently incubated with Treg cells for 72 h. We then sorted these monocytes for testing their capacity of activating T cells. As expected, T cell suppression was significantly reduced in the presence of Treg-conditioned monocytes exposed to B7-H4 blocking oligos, compared with control oligos and medium (n = 6; *, p < 0.01) (Fig. 5D). These data indicate that B7-H4 contributes to the suppressive activity mediated by Treg cell-conditioned APCs.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
In this study, we document that Treg cells trigger high levels of IL-10 production by APCs and, in turn, stimulate APC B7-H4 expression in an autocrine manner and render APCs immunosuppressive via B7-H4.

Inconsistent with some reports (6, 18), we show that IL-10–/– Treg cells are suppressive. Hence, Treg-derived IL-10 is not essential for Treg-mediated suppression. However, in a typical immunosuppressive assay (6), Treg suppressive capacity is reduced when Treg cells, conventional T cells, and APCs are all from IL-10–/– mice. It indicates that IL-10 participates in Treg-mediated suppression. In support of this, when the ratio between Treg cells and conventional T cells is <1:1, the suppressive capacity of IL-10–/– and IL-10+/+ Treg cells is equally and profoundly reduced when IL-10–/– APCs are added. The data indicate that APC, but not Treg-derived IL-10, is crucial for Treg-mediated suppression.

Many in vitro suppressive assays are conducted in the absence of APCs, or APCs are substituted by irradiated whole spleen cells. It is not a surprise that these assays cannot define the role of APCs in Treg-mediated suppression, including APC-derived IL-10. APCs actively process Ags and present Ags to T cells in vivo (8, 9, 10). The ratio between Treg cells and T cells may rarely reach 1:1 in vivo. Thus, APC-derived IL-10 would likely involve in Treg-mediated T cell suppression in vivo.

Treg cells, but not conventional T cells, trigger high levels of IL-10 production. It is unknown how and why Treg cells do so. IL-10 has long been thought as an immunosuppressive cytokine, but it remains elusive how IL-10 implicates in Treg-mediated suppression. Inhibition is thought to be mediated mainly by effects on APCs (7, 19). However, very high concentrations of IL-10 (≥ 20–40 ng/ml) are essential to alter DC phenotypes (19). This concentration may not be physiologically relevant in vivo. We now show that as low as 0.1 ng/ml IL-10 can profoundly stimulate APC B7-H4 expression. Treg cells can trigger APC IL-10 production, which in turn stimulates B7-H4 expression and renders APCs suppressive through B7-H4. Thus, our data provide a plausible mechanism for the suppressive effect of IL-10. Because Treg cells are a small population, Treg-to-T cell contact-dependent suppressive mechanism may not ensure an efficient suppression in vivo. It is postulated that Treg cells may inhibit APC function. Induction of suppressive B7-H4 on APCs provides a novel molecular and cellular basis for Treg-mediated suppression in the level of APCs.

Our data mechanistically link IL-10, B7-H4, Treg cells, and APCs. B7-H4 is a newly identified B7 family member (11, 12, 13). Although mouse B7-H4 ligation of T cells has a profound inhibitory effect T cell activation (11, 12), the regulatory mechanisms and function of B7-H4 remain to be defined. We show that IL-10 stimulates B7-H4 expression on different APC subsets. More importantly, Treg-conditioned APCs strongly suppress T cell activation via B7-H4 induction. Our findings thus provide three pieces of novel information: 1) IL-10 is capable of inducing B7-H4 expression on human APCs; 2) similar to murine B7-H4 fusion protein (11, 12, 13), human APC B7-H4 negatively regulates T cell responses; and 3) human Treg cells enable suppressor activity to APCs via triggering B7-H4 expression. Thus, as suppression partially relies on Treg-triggered, APC-dependent IL-10, our observation reconciles the apparent contradiction in previous studies regarding the role and source of IL-10 in Treg cell biological activity.

In summary, our data demonstrate a novel molecular and cellular suppressive mechanism for Treg cells and suggest a plausible mechanism for the suppressive effect of IL-10 in Treg biology. Therefore, one can expect that targeting B7-H4 may be a novel strategy to revert Treg-mediated suppression in vivo.


   Acknowledgments
 
We thank Andrew S. Flies for technical assistance.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Cancer Institute Grants CA092562, CA100227, and CA99985 (to W.Z.) and CA97085 (to L.C.). Back

2 Address correspondence and reprint requests to Dr. Weiping Zou, Department of Surgery, 1500 East Medical Center Drive, Ann Arbor, MI 48109-0346. E-mail address: wzou{at}umich.edu Back

3 Abbreviations used in this paper: Treg, regulatory T; MDC, primary myeloid dendritic cell; MDDC, monocyte-derived DC. Back

Received for publication November 8, 2005. Accepted for publication May 3, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Zou, W.. 2006. Regulatory T cells, tumor immunity and immunotherapy. Nat. Rev. Immunol. 6: 295-307. [Medline]
  2. Curiel, T. J., G. Coukos, L. Zou, X. Alvarez, P. Cheng, P. Mottram, M. Evdemon-Hogan, J. R. Conejo-Garcia, L. Zhang, M. Burow, et al 2004. Specific recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege and predicts reduced survival. Nat. Med. 10: 942-949. [Medline]
  3. Zou, W.. 2005. Immunosuppressive networks in the tumor environment and their therapeutic relevance. Nat. Rev. Cancer. 5: 263-274. [Medline]
  4. Yu, P., Y. Lee, W. Liu, T. Krausz, A. Chong, H. Schreiber, Y. X. Fu. 2005. Intratumor depletion of CD4+ cells unmasks tumor immunogenicity leading to the rejection of late-stage tumors. J. Exp. Med. 201: 779-791. [Abstract/Free Full Text]
  5. von Boehmer, H.. 2005. Mechanisms of suppression by suppressor T cells. Nat. Immunol. 6: 338-344. [Medline]
  6. Shevach, E. M.. 2002. CD4+CD25+ suppressor T cells: more questions than answers. Nat. Rev. Immunol. 2: 389-400. [Medline]
  7. Hawrylowicz, C. M., A. O’Garra. 2005. Potential role of interleukin-10-secreting regulatory T cells in allergy and asthma. Nat. Rev. Immunol. 5: 271-283. [Medline]
  8. Asseman, C., S. Mauze, M. W. Leach, R. L. Coffman, F. Powrie. 1999. An essential role for interleukin 10 in the function of regulatory T cells that inhibit intestinal inflammation. J. Exp. Med. 190: 995-1004. [Abstract/Free Full Text]
  9. Belkaid, Y., B. T. Rouse. 2005. Natural regulatory T cells in infectious disease. Nat. Immunol. 6: 353-360. [Medline]
  10. Annacker, O., R. Pimenta-Araujo, O. Burlen-Defranoux, T. C. Barbosa, A. Cumano, A. Bandeira. 2001. CD25+CD4+ T cells regulate the expansion of peripheral CD4 T cells through the production of IL-10. J. Immunol. 166: 3008-3018. [Abstract/Free Full Text]
  11. Sica, G. L., I. H. Choi, G. Zhu, K. Tamada, S. D. Wang, H. Tamura, A. I. Chapoval, D. B. Flies, J. Bajorath, L. Chen. 2003. B7–H4, a molecule of the B7 family, negatively regulates T cell immunity. Immunity 18: 849-861. [Medline]
  12. Prasad, D. V., S. Richards, X. M. Mai, C. Dong. 2003. B7S1, a novel B7 family member that negatively regulates T cell activation. Immunity 18: 863-873. [Medline]
  13. Zang, X., P. Loke, J. Kim, K. Murphy, R. Waitz, J. P. Allison. 2003. B7x: a widely expressed B7 family member that inhibits T cell activation. Proc. Natl. Acad. Sci. USA 100: 10388-10392. [Abstract/Free Full Text]
  14. Kryczek, I., L., Zou, P., Rodriguez, G., Zhu, S., Wei, P., Mottram, M., Brumlik, P., Cheng, T., Curiel, L., Myers, et al. B7–H4 expression identifies a novel suppressive macrophage population in human ovarian carcinoma. J. Exp. Med. In press.
  15. Zou, W., V. Machelon, A. Coulomb-L’Hermin, J. Borvak, F. Nome, T. Isaeva, S. Wei, R. Krzysiek, I. Durand-Gasselin, A. Gordon, et al 2001. Stromal-derived factor-1 in human tumors recruits and alters the function of plasmacytoid precursor dendritic cells. Nat. Med. 7: 1339-1346. [Medline]
  16. Zou, W., J. Borvak, F. Marches, S. Wei, P. Galanaud, D. Emilie, T. J. Curiel. 2000. Macrophage-derived dendritic cells have strong Th1-polarizing potential mediated by beta-chemokines rather than IL-12. J. Immunol. 165: 4388-4396. [Abstract/Free Full Text]
  17. Baecher-Allan, C., J. A. Brown, G. J. Freeman, D. A. Hafler. 2001. CD4+CD25high regulatory cells in human peripheral blood. J. Immunol. 167: 1245-1253. [Abstract/Free Full Text]
  18. Sakaguchi, S., N. Sakaguchi, J. Shimizu, S. Yamazaki, T. Sakihama, M. Itoh, Y. Kuniyasu, T. Nomura, M. Toda, T. Takahashi. 2001. Immunologic tolerance maintained by CD25+CD4+ regulatory T cells: their common role in controlling autoimmunity, tumor immunity, and transplantation tolerance. Immunol. Rev. 182: 18-32. [Medline]
  19. Steinbrink, K., H. Jonuleit, G. Muller, G. Schuler, J. Knop, A. H. Enk. 1999. Interleukin-10-treated human dendritic cells induce a melanoma-antigen-specific anergy in CD8+ T cells resulting in a failure to lyse tumor cells. Blood 93: 1634-1642. [Abstract/Free Full Text]
  20. Zou, L., B. Barnett, H. Safah, V. F. Larussa, M. Evdemon-Hogan, P. Mottram, S. Wei, O. David, T. J. Curiel, W. Zou. 2004. Bone marrow is a reservoir for CD4+CD25+ regulatory T cells that traffic through CXCL12/CXCR4 signals. Cancer Res. 64: 8451-8455. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Proc. Natl. Acad. Sci. USAHome page
M. M. Tiemessen, A. L. Jagger, H. G. Evans, M. J. C. van Herwijnen, S. John, and L. S. Taams
CD4+CD25+Foxp3+ regulatory T cells induce alternative activation of human monocytes/macrophages
PNAS, December 4, 2007; 104(49): 19446 - 19451.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
A. D. Reynolds, R. Banerjee, J. Liu, H. E. Gendelman, and R. L. Mosley
Neuroprotective activities of CD4+CD25+ regulatory T cells in an animal model of Parkinson's disease
J. Leukoc. Biol., November 1, 2007; 82(5): 1083 - 1094.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
S. S. Lee, W. Gao, S. Mazzola, M. N. Thomas, E. Csizmadia, L. E Otterbein, F. H. Bach, and H. Wang
Heme oxygenase-1, carbon monoxide, and bilirubin induce tolerance in recipients toward islet allografts by modulating T regulatory cells
FASEB J, November 1, 2007; 21(13): 3450 - 3457.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
P. Hubert, N. Jacobs, J.-H. Caberg, J. Boniver, and P. Delvenne
The cross-talk between dendritic and regulatory T cells: good or evil?
J. Leukoc. Biol., October 1, 2007; 82(4): 781 - 794.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
R. J. DiPaolo, C. Brinster, T. S. Davidson, J. Andersson, D. Glass, and E. M. Shevach
Autoantigen-Specific TGFbeta-Induced Foxp3+ Regulatory T Cells Prevent Autoimmunity by Inhibiting Dendritic Cells from Activating Autoreactive T Cells
J. Immunol., October 1, 2007; 179(7): 4685 - 4693.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
I. Kryczek, S. Wei, G. Zhu, L. Myers, P. Mottram, P. Cheng, L. Chen, G. Coukos, and W. Zou
Relationship between B7-H4, Regulatory T Cells, and Patient Outcome in Human Ovarian Carcinoma
Cancer Res., September 15, 2007; 67(18): 8900 - 8905.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
D.-M. Kuang, Y. Wu, N. Chen, J. Cheng, S.-M. Zhuang, and L. Zheng
Tumor-derived hyaluronan induces formation of immunosuppressive macrophages through transient early activation of monocytes
Blood, July 15, 2007; 110(2): 587 - 595.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. G. Elpek, C. Lacelle, N. P. Singh, E. S. Yolcu, and H. Shirwan
CD4+CD25+ T Regulatory Cells Dominate Multiple Immune Evasion Mechanisms in Early but Not Late Phases of Tumor Development in a B Cell Lymphoma Model
J. Immunol., June 1, 2007; 178(11): 6840 - 6848.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
I. Kryczek and W. Zou
Response to Comment on "Cutting Edge: Induction of B7-H4 on APCs through IL-10: Novel Suppressive Mode for Regulatory T Cells"
J. Immunol., April 15, 2007; 178(8): 4706 - 4706.
[Full Text] [PDF]

Home page
 J. Immunol.Home page
N. Mirza and D. Gabrilovich
Comment on "Cutting Edge: Induction of B7-H4 on APCs through IL-10: Novel Suppressive Mode for Regulatory T Cells"
J. Immunol., April 15, 2007; 178(8): 4705 - 4706.
[Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
I. Kryczek, S. Wei, E. Keller, R. Liu, and W. Zou
Stroma-derived factor (SDF-1/CXCL12) and human tumor pathogenesis
Am J Physiol Cell Physiol, March 1, 2007; 292(3): C987 - C995.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kryczek, I.
Right arrow Articles by Zou, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kryczek, I.
Right arrow Articles by Zou, W.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS