The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ahmed, C. M. I.
Right arrow Articles by Johnson, H. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ahmed, C. M. I.
Right arrow Articles by Johnson, H. M.
The Journal of Immunology, 2006, 177: 315-321.
Copyright © 2006 by The American Association of Immunologists

IFN-{gamma} and Its Receptor Subunit IFNGR1 Are Recruited to the IFN-{gamma}-Activated Sequence Element at the Promoter Site of IFN-{gamma}-Activated Genes: Evidence of Transactivational Activity in IFNGR11

Chulbul M. I. Ahmed2 and Howard M. Johnson

Department of Microbiology and Cell Science, University of Florida, Gainesville, FL 32611


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
We have shown previously that IFN-{gamma} and one of its receptor subunits, IFNGR1, are translocated to the nucleus, together with STAT1{alpha} as one macromolecular complex, via the classical importin-dependent pathway. In this study, we have identified the nuclear targets of IFN-{gamma} and IFNGR1. By chromatin immunoprecipitation followed by PCR, IFN-{gamma}, its receptor subunit IFNGR1, and STAT1{alpha} were found to be associated with the IFN-{gamma}-activated sequence (GAS) in the promoter of two of the genes stimulated by IFN-{gamma}. Immunoprecipitated chromatin also showed the association of the IFN-{gamma}, IFNGR1, and STAT1{alpha} on the same DNA sequence. Examination of nuclear extracts from WISH cells treated with IFN-{gamma} revealed the specific binding of IFN-{gamma}, IFNGR1, and STAT1{alpha} to biotinylated GAS nucleotide sequence. Association of IFN-{gamma}, IFNGR1, and STAT1{alpha} with the GAS promoter was also demonstrated by EMSA. Transfection with a GAS-luciferase gene together with the IFNGR1 and nonsecreted IFN-{gamma} resulted in enhanced reporter activity. In addition, IFNGR1 fused to the yeast GAL4 DNA binding domain resulted in enhanced transcription from a GAL4 response element, suggesting the presence of a trans activation domain in IFNGR1. Our observations put IFN-{gamma} and its receptor subunit, IFNGR1, in direct contact with the promoter region of IFN-{gamma}-activated genes with associated increased activity, thus suggesting a transcriptional/cotranscriptional role for IFN-{gamma}/IFNGR1 as well as a possible role in determining the specificity of IFN-{gamma} action.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Interferon-{gamma} has been known for some time to translocate to the nucleus of receptor-expressing cells with kinetics as rapid as those for the activation and nuclear translocation of the transcription factor STAT1{alpha} that it activates (1, 2). More recently, nuclear translocation of IFN-{gamma} has been shown to be driven by a nuclear localization sequence (NLS)3 in its C terminus (3, 4). Mutations of the IFN-{gamma} NLS destroy its biological activity, which can be restored by reconstitution with the NLS from T Ag of SV40 virus (4, 5). The T Ag NLS is known to localize to the nucleus in IMP{alpha}/beta1/Ran-dependent fashion. Excess T Ag NLS peptide inhibits IFN-{gamma} NLS-dependent nuclear import, suggesting that IFN-{gamma} NLS mediates nuclear import through the same pathway (3). Results from immunoprecipitation experiments, which detected endocytosed IFN-{gamma} bound to IMP{alpha}5 (NPI-1) in cells actively transporting IFN-{gamma} to the nucleus, are consistent with this conclusion (4).

Subsequent experiments showed that the receptor {alpha}-subunit, IFNGR1, of the hetero-oligomeric receptor also translocates to the nucleus in IFN-{gamma}-treated cells, while the beta-subunit (IFNGR2) is not translocated (4, 6, 7). Uptake of IFN-{gamma} is a receptor-mediated endocytic process, recent studies indicating that plasma membrane lipid microdomains are the primary sites for the endocytic events leading to nuclear translocation of IFN-{gamma}, IFNGR1, as well as STAT1{alpha} (8).

The trafficking of IFN-{gamma}, the role of its NLS, and how this relates to signal transduction/function have been the subject of recent studies. The IFN-{gamma} NLS is known to contribute minimally to extracellular high affinity receptor-ligand binding, but is required for receptor endocytosis. Subsequent to endocytosis, the C-terminal domain of IFN-{gamma} (including NLS) appears also to be able to interact with the intracellular cytoplasmic domain of IFNGR1 (residues 253–287) of the IFN-{gamma} receptor complex (9). This binding, which requires the NLS, also increases the affinity of the Janus family kinase JAK2 for IFNGR1 (10). Significantly, a C-terminal peptide of IFN-{gamma} (aa 95–133) that contains the NLS domain can act as an agonist when delivered intracellularly and induce classical IFN-{gamma} activities of antiviral protection and up-regulation of MHC class II molecules (11). This intracellular agonist/mimetic peptide is not active on IFNGR1–/– cells, demonstrating the requirement of the IFNGR1 cytoplasmic domain. Moreover, the intracellular mimetic induces JAK2 autophosphorylation (9), as well as nuclear translocation of both IFNGR1 and STAT1{alpha} (6), comparable to that of the addition of extracellular IFN-{gamma}. Deletion of the NLS within the mimetic abolishes biological activity as well as the ability to induce nuclear translocation of IFNGR1 and STAT1{alpha}. In keeping with these observations, intracellular expression of a full-length nonsecreted form of IFN-{gamma} can also affect IFNGR1 nuclear translocation, activation, and nuclear translocation of STAT1{alpha}, as well as induction of biological activities normally elicited by addition of extracellular IFN-{gamma} (4). Intracellular expression of an IFN-{gamma} mutant in which the basic residues of the NLS were replaced with alanines failed to induce nuclear translocation of IFNGR1 or STAT1{alpha}, and led to a loss of IFN-{gamma} activity (4). This suggests that the IFN-{gamma} NLS functions intracellularly, mediating interaction with specific intracellular components critical for IFN-{gamma} activity.

An intracellular excess of a peptide representing the cytoplasmic binding site of IFNGR1 for the C terminus of IFN-{gamma} prevented the complexation of internalized IFN-{gamma} with the cytoplasmic domain of cell surface IFNGR1 in cells that were actively internalizing IFN-{gamma} (6). Moreover, such cells were also blocked with respect to the tyrosine phosphorylation of STAT1{alpha}. Thus, internalized IFN-{gamma} appears to be able to interact with the cytoplasmic domain of IFNGR1 in intact cells as part of the signal transduction events leading to STAT1{alpha} tyrosine phosphorylation. Cytosolic injection of Abs to IFN-{gamma} aa 95–133 blocks STAT1{alpha} nuclear translocation in response to extracellular IFN-{gamma} (6), which further supports the idea that the C terminus of endocytosed IFN-{gamma} accesses the cytosol, although the mechanism is as yet undetermined.

The requirement of the IFN-{gamma} NLS for internalization, binding to the cytoplasmic domain of IFNGR1, activation of JAK2 and STAT1{alpha}, and nuclear translocation of activated STAT1{alpha} and IFNGR1 suggests that some or all of these processes may be coupled, presumably through the NLS. Consistent with this, it has been observed that after internalization, extracellular IFN-{gamma} could be recovered directly associated with IMP{alpha}5 in a cytosolic complex of IFN-{gamma}/IFNGR1/phosphorylated STAT1{alpha} (4). The formation of the complex was dependent on the IFN-{gamma} NLS.

The question arises as to whether IFN-{gamma} and IFNGR1 function solely as chaperones for nuclear transport of STAT1{alpha} or whether they also function as transcription/cotranscription factors to elicit IFN-{gamma}-specific gene activation. We report in this study that both IFN-{gamma} and IFNGR1 bind to the IFN-{gamma}-activated sequence (GAS) response element in the promoter region of the IFN-{gamma}-activated genes. Furthermore, we show that this binding results in enhanced activation of IFN-{gamma}-induced genes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Cell culture and Abs

WISH cells were purchased from American Type Culture Collection (ATCC) and were grown in DMEM with 10% FBS and antibiotics. The following Abs were purchased: polyclonal antisera to human IFN-{gamma} and IFNGR1 (PBL Biomedical) and polyclonal Abs to human IFNGR2 and STAT1{alpha} (Santa Cruz Biotechnology). Ab to acetylhistone is from Active Motif. The cytoplasmic and nuclear fractions were prepared as described previously (12).

Nuclear translocation of IFN-{gamma} (95–134) fused to GFP

A plasmid containing the entire coding sequence of human IFN-{gamma} was purchased from ATCC. The sequence from aa 95–134 was amplified by PCR and fused in frame with the C terminus of humanized rGFP in the plasmid, phrGFPII-C (Stratagene). An NLS mutant of IFN-{gamma} (95–134) peptide in which the 128KTGKRKR was mutated to 128ATGAAAA has been described previously (4). The PCR product corresponding to IFN-{gamma} (95–134) from NLS mutant sequence was similarly fused to the C terminus of phrGFP. WISH cells that were grown on coverslips to near 30% confluency in a 35-mm dish were transfected using lipofectamine (Invitrogen Life Technologies), with 3 µg each of the phrGFP alone, the IFN-{gamma} (95–134) fused to GFP, or the NLS-mutated sequence fused to GFP. The next day, cells were fixed with 2% paraformaldehyde in PBS, mounted on a slide, and viewed in a Zeiss Axiovert Zoom microscope using LSM5 Pascal software.

Chromatin immunoprecipitation (ChIP) assay

WISH cells seeded the previous day and grown to 90% confluency were treated with human IFN-{gamma} (1000 U/ml) for 1 h. Cells were washed with cold PBS and treated with 1% formaldehyde for 5 min at 37°C. The rest of the procedure was conducted using the ChIP kit from Upstate Biotechnology, as per the manufacturer’s protocol. Sonication was conducted to get DNA fragments of ~500 bp. Control IgG or different Abs, as indicated, were used for each immunoprecipitation. DNA fragments eluted were used for PCR with the following primers that spanned the GAS element in their promoters. Human IFN regulatory factor-1 (IRF-1) promoter region was amplified with the primers 5'-CTTCGCCGCTAGCTCTAC-3' (–388 to –371) and 5'-GCCGCGCGGGCGCCCATT-3' (–283 to –312), while human IFN-{gamma}-inducible indoleamine 2,3 dioxygenase promoter was amplified with the primers TAACACAGGTTGTGTTTCCG (–497 to –476) and AAGGCTGCAGTCCTAAACTC (–378 to –399). As a control, PCR was conducted with the primers from the human beta-actin promoter 5'-TGCACTGTGCGGCGAAGC-3' (–980 to –963) and 5'-TCGAGCCATAAAAGGCAA-3' (–915 to –932). The PCR conditions were: 94°C for 5 min, followed by 20 cycles at 94°C for 30 s, 52°C for 30 s, and 72°C for 30 s. This was followed by annealing at 72°C for 7 min.

Following ChIP with different Abs indicated, the DNA protein complex was used to elute the associated proteins by boiling with the electrophoresis buffer and was analyzed by Western blotting, as mentioned below.

Analysis of proteins bound to biotinylated GAS promoter DNA

To identify the proteins associated with the GAS promoter, a nucleotide sequence from human IRF-1 promoter, which contains the GAS motif 5'-AGCCTGATTTCCCCGAAATGACGGC-3', was chosen. An oligonucleotide containing three copies of this sequence and another oligonucleotide with complementary sequence were synthesized. The two strands were biotinylated individually with reagents from Pierce, followed by annealing. Nuclear extracts were prepared from WISH cells that were treated with human IFN-{gamma} (1000 U/ml) for different times indicated. A total of 150 µg of this nuclear extract was incubated for 15 min on ice in 200 µl of reaction mixture containing 10 mM HEPES (pH 7.9), 20 mM KCl, 0.5 mM EDTA, 0.5 mM DTT, 10% glycerol, 5 µg of poly(dI:dC), and protease inhibitor mixture (Roche Biochemicals). To this mixture, 50 ng of the biotinylated double-stranded oligonucleotides was added, and incubation was conducted at room temperature for 15 min. Streptavidin magnetic beads (Magnsephere Paramagnetic particles; Promega) were washed three times with the wash buffer containing 10 mM HEPES (pH 7.9), 100 mM KCl, 1 mM EDTA, 0.5 mM DTT, 12% glycerol, 0.05% Nonidet P-40, 100 mg/ml BSA, and protease inhibitor mixture (Roche Biochemicals). The incubation mixture from above was added to the beads, and incubation continued for 30 min on ice. The beads were then washed three times with wash buffer containing 30 µg/ml poly(dI:dC). The bound proteins were eluted with 0.5% SDS and 1 M NaCl, electrophoresed, and analyzed by Western blotting.

EMSA

Nuclear extracts were prepared from WISH cells treated with human IFN-{gamma} (1000 U/ml) for 1 h. A total of 5 µg of nuclear extract was incubated with 5 ng of biotinylated double-stranded oligonucleotide, as above, in 20 µl of reaction mixture containing 10 mM Tris (pH 7.5), 50 mM KCl, 5 mM MgCl2, 1 mM DTT, 2.5% glycerol, 0.05% Nonidet P-40, and 50 µg/ml poly(dI:dC) for 20 min at room temperature. In the competition experiments, nuclear extracts were preincubated with a 200-fold excess of a cold oligonucleotide before addition of biotinylated probe. To test the involvement of IFN-{gamma} or IFNGR1, 1 µg of Ab was added to the nuclear extracts in reaction mixture on ice for 15 min before the addition of biotinylated DNA. The reaction was terminated by addition of 2 µl of 10x gel loading buffer (250 mM Tris HCl (pH 7.5), 0.2% bromphenol blue, and 40% glycerol). The mixture was run on a nondenaturing 6% acrylamide gel. DNA was transferred to a membrane, followed by detection using streptavidin-HRP conjugate and chemiluminescent substrate from Pierce.

Western blot analysis and immunoprecipitation

Cells were washed with PBS and harvested in lysis buffer (50 mM Tris-HCl (pH 7.5), 250 mM NaCl, 0.1% Nonidet P-40, 50 mM NaF, 5 mM EDTA, and protease inhibitor mixture) (Roche Biochemicals). Protein concentration was measured using bicinchoninic acid kit from Pierce. Protein (10 µg each) was electrophoresed on an acrylamide gel, transferred to nylon membrane, and probed with the Abs indicated. HRP-conjugated secondary Abs were used, and detection was conducted by chemiluminescence (Pierce). Immunoprecipitation was conducted by incubating specific Abs with cell extracts, followed by incubation with IgG-Sepharose (Sigma-Aldrich), sedimentation, and washings.

Reporter gene constructs and assays

The plasmid pGL3 promoter, which expresses the firefly luciferase, was obtained from Promega. A sequence containing three copies of the GAS promoter element from human IRF-1 gene, 5'-AGCCTGATTTCCCCGAAATGACGGC-3', was inserted in the multiple cloning site of pGL3. The cloning of nonsecreted IFN-{gamma} and its NLS mutant in an eukaryotic expression vector, pShuttleCMV, has been described previously (4). A clone containing the coding sequence for human IFNGR1 was purchased from ATCC. This clone was used to amplify the entire coding sequence or the cytoplasmic domain (aa 250–472) of IFNGR1. The resulting fragment was cloned in the plasmid, pShuttleCMV, for the purpose of expression. A constitutively expressed thymidine kinase promoter-driven Renilla luciferase gene (pRL-TK) from Promega was used as an internal control in all of the reporter plasmid transfections. WISH or NIH 3T3 cells (105 cells/well) were seeded in a 12-well plate. The next day, 3 µg each of firefly luciferase expressing plasmid and any cotransfected DNA and 10 ng of pRL-TK were used for transfection using Fugene 6 (Roche). Two days later, the cell lysates were used to assay for firefly luciferase, followed by Renilla luciferase, using a dual luciferase assay kit from Promega, according to the manufacturer’s instructions. Luciferase activity in relative luciferase units was calculated by dividing firefly luciferase activity by Renilla luciferase activity in each sample. Error bars represent the SD.

A fusion between the full-length or the cytoplasmic domain of IFNGR1 and the yeast GAL4 DNA binding domain was conducted, as follows. The plasmid, pFA-CMV, which contains the yeast GAL4 DNA binding domain, driven by CMV promoter, was obtained from Stratagene. The PCR product of full-length or cytoplasmic domain of IFNGR1 was fused in frame with the C terminus of GAL4 DNA binding domain. The plasmid pFR-luciferase (Stratagene), which contains the GAL4 response element fused to firefly luciferase, was used to cotransfect NIH 3T3 cells using Fugene 6. Constitutively expressed Renilla luciferase gene construct was used simultaneously, and relative luciferase units were determined, as described above.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Requirement of an NLS in the C terminus of IFN-{gamma} for the nuclear translocation of IFN-{gamma}

We have shown via the digitonin nuclear assay that IFN-{gamma} possesses a classic polycationic NLS (3). By contrast, reports that STAT1{alpha} possesses an unconventional NLS have all used an overexpression approach of STAT1{alpha} fused to GFP (13). We first determined, therefore, the nuclear localization properties of IFN-{gamma} polycationic NLS-containing peptide, IFN-{gamma} (95–134)-GFP fusion expression protein. WISH cells were transfected with a vector expressing GFP alone, GFP fused to IFN-{gamma} (95–134), or GFP fused to NLS mutant of IFN-{gamma} (95–134). As shown in Fig. 1, GFP alone is distributed evenly throughout WISH cells, whereas IFN-{gamma} (95–134)-GFP accumulated in the nucleus of the cells. Several fields were analyzed for the measurement of fluorescence in nucleus vs fluorescence in cytosol, and a significant accumulation of the IFN-{gamma} (95–134)-GFP in the nucleus was observed (data not shown). Mutations of lysines and arginines to alanines in the IFN-{gamma} (95–134) NLS sequence, 128KTGRKRKR, resulted in loss of the ability of GFP to accumulate in the nucleus. Thus, the IFN-{gamma} classical NLS sequence is functional in both an overexpression system and the digitonin nuclear assay procedure.


Figure 1
View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 1. Nuclear translocation of IFN-{gamma} (95–134). WISH cells were transfected with a GFP-expressing vector (left panel), IFN-{gamma} (95–134) fused to GFP-expressing vector (middle panel), or NLS mutant of IFN-{gamma} (95–134) fused to GFP-expressing vector (right panel). The following day, the cells were fixed and viewed in a confocal microscope. Cells shown are representative of several fields viewed with at least 20 cells each.

 
IFN-{gamma} and IFNGR1 are recruited to the GAS element in the IFN-{gamma}-induced promoter

To identify the target of IFN-{gamma} and IFNGR1 that are translocated to the nucleus, WISH cells that were treated with IFN-{gamma} for 1 h were analyzed by ChIP of sonicated chromatin containing ~500-bp fragments of DNA, followed by PCR (Fig. 2). Two of the genes that are induced by IFN-{gamma}, namely IRF-1 and indoleamine dioxygenase (IDO), which contain the GAS in their promoters, were chosen. The PCR product selected for amplification extends from nt –388 to –283 in the promoter of IRF-1 gene and from –497 to –378 in the promoter of IDO gene. As a control, PCR product chosen for the promoter of beta-actin gene extends from nt –980 to –915. Immunoprecipitation of the sonicated chromatin with Abs to IFN-{gamma}, IFNGR1, or STAT1{alpha}, followed by PCR with primers flanking the GAS element from IRF-1 or IDO promoter, resulted in PCR products of expected length. This suggested the association of IFN-{gamma}, IFNGR1, and STAT1{alpha} with the same DNA sequences containing the GAS element. Similar results were obtained by carrying out immunoprecipitation with Abs raised against different epitopes of IFN-{gamma} and IFNGR1 (data not shown). This is further evidence that the Abs precipitated the same DNA fragments. Normal IgG used as a control did not give rise to the PCR products observed with Abs specific to IFN-{gamma}, IFNGR1, or STAT1{alpha}. As a positive control, an Ab to acetylhistone H3 was used for global immunoprecipitation of transcriptionally active chromatin. It gave rise to a product similar to that of the input actin by PCR analysis, further indicating that the immunoprecipitation involved a site of active transcription. Immunoprecipitation with IFNGR2 Ab did not give rise to any PCR product, which is consistent with our previous observations that IFNGR2 does not undergo endocytosis and nuclear transport in IFN-{gamma}-treated cells (4). Primers to beta-actin generated a PCR product only in the input DNA that was taken before immunoprecipitation as well as in DNA fragments from acetylhistone H3 immunoprecipitate, providing further evidence for the IFN-{gamma} specificity associated with IRF-1 and IDO primers. Thus, PCR of IFN-{gamma}, IFNGR1, and STAT1{alpha} chromatin immunoprecipitates suggest that these factors all bind to the GAS element in the promoter region of IRF-1 and IDO genes.


Figure 2
View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 2. IFN-{gamma} and IFNGR1 are recruited to the GAS element in IRF-1 and IDO promoters. WISH cells treated with IFN-{gamma} (1000 U/ml) for 1 h were used. Chromatin from cross-linked cells was sheared by sonication and incubated overnight with the specific Abs indicated, followed by incubation with protein G-Sepharose saturated with salmon sperm DNA. The detection of immunoprecipitated IRF-1 promoter (first row), IDO promoter (second row), and beta-actin promoter (third row) was conducted by PCR with promoter-specific primers. PCR products were run on a 2.2% agarose gel and stained with ethidium bromide.

 
Endocytosis of IFN-{gamma} results in its association with the cytoplasmic domain of the IFNGR1 receptor chain, along with activated STAT1{alpha}. The complex of IFN-{gamma}/IFNGR1/STAT1{alpha} in turn binds to importin {alpha} via the NLS of IFN-{gamma}. This complex, in turn, binds to importin beta and undergoes active transport to the nucleus via nuclear pore complex (4). The PCR data above of immunoprecipitates with specific Abs suggest that IFN-{gamma}, IFNGR1, and STAT1{alpha} are all associated with the GAS promoter region of IFN-{gamma}-inducible genes. Thus, experiments were next directed toward demonstration of IFN-{gamma}, IFNGR1, and STAT1{alpha} proteins on the same immunoprecipitated chromatin. As shown in Fig. 3, immunoprecipitation with Abs to IFNGR1 or STAT1{alpha} showed the presence of STAT1{alpha}, IFNGR1, and IFN-{gamma} on the same DNA/protein complexes by Western analysis. Normal IgG used as a control did not show these proteins associated with DNA. Thus, consistent with the ChIP PCR profile, STAT1{alpha}, IFNGR1, and IFN-{gamma} proteins associate with the same promoter region of IFN-{gamma}-activated genes in the nucleus.


Figure 3
View larger version (56K):
[in this window]
[in a new window]
 
FIGURE 3. Association of IFN-{gamma} and IFNGR1 with GAS element in chromatin. WISH cells treated with IFN-{gamma} for 60 min were used. Chromatin from cross-linked cells was sheared by sonication and incubated overnight with the control IgG (lane 1), Abs to IFNGR1 (lane 2), or Abs to STAT1{alpha} (lane 3), followed by incubation with protein G-Sepharose saturated with salmon sperm DNA. Proteins eluted from these immunoprecipitated complexes were analyzed by Western blot analysis with the Ab for STAT1{alpha} (top row), IFNGR1 (middle row), or IFN-{gamma} (bottom row). The corresponding amount of whole cell extracts without any immunoprecipitation was loaded in lane 4.

 
To further verify that IFN-{gamma} and IFNGR1 associate with the GAS promoter element along with IFN-{gamma}, a biotinylated GAS promoter was generated and incubated with nuclear extracts from WISH cells treated with IFN-{gamma} (Fig. 4). Extracts from cells treated with IFN-{gamma} for 0, 30, or 60 min were incubated with the GAS promoter for 15 min, after which the GAS promoter was incubated with streptavidin bound to magnetic particles. Bound proteins were eluted, electrophoresed, and probed with Abs to STAT1{alpha}, IFNGR1, and IFN-{gamma}. All three proteins associated with the GAS promoter by 30 min, which probably reflected reversible dissociation from the GAS promoter in the nuclear extracts. It is worth noting that the size of the nuclear IFNGR1 bound to the GAS element is the same as that seen in the whole cell extract, suggesting that full-length IFNGR1 is associated with this promoter. Interestingly, IFNGR2 was not associated with the promoter complex, but was seen in the whole cell extract, consistent with its lack of endocytosis and nuclear translocation (4). Thus, IFNGR1 and IFN-{gamma}, similar to STAT1{alpha}, associated with the GAS promoter in cells treated with IFN-{gamma}.


Figure 4
View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 4. IFN-{gamma} and IFNGR1 are associated with the GAS promoter. A biotinylated double-stranded oligomer containing three copies of GAS promoter element was incubated with nuclear extracts from WISH cells, untreated (lane 1) or treated with IFN-{gamma} for 30 min (lane 2) or 60 min (lane 3). This complex was added to streptavidin-bound magnetic particles. The bound proteins were eluted, electrophoresed, and probed sequentially with Abs to STAT1{alpha} (first row), IFNGR1 (second row; entire gel included to show lack of proteolysis of this receptor), IFNGR2 (third row), or IFN-{gamma} (fourth row). Lane 4 shows proteins from whole cell extract run as a control.

 
Assembly of different proteins at the GAS promoter was also analyzed by EMSA. Incubation of a biotinylated GAS probe with nuclear extracts from IFN-{gamma}-treated cells gave rise to a protein DNA complex that appeared to be specific to this DNA element (Fig. 5). Incubation of the nuclear extracts with an Ab to IFN-{gamma}, IFNGR1, or STAT1{alpha} resulted in a shift of the complex with the GAS probe, suggesting the association of these proteins in this complex. Addition of normal IgG or an Ab to IFNGR2 did not affect the formation of this complex. Lack of IFNGR2 in the complex is consistent with previous observations. Unlabeled GAS competed with biotinylated GAS probe in binding to the complex, while an unrelated DNA sequence from Oct-1 promoter did not compete with the formation of this complex, indicating it was specific to the GAS DNA element. However, we cannot rule out the possibility that multiple bands might arise from this complex due to possible variation in the stoichiometry of the interactions that may be reflected as aggregates on the top of the EMSA gel.


Figure 5
View larger version (79K):
[in this window]
[in a new window]
 
FIGURE 5. Nuclear IFN-{gamma} and IFNGR1 are associated with GAS element in the promoter. A biotinylated GAS element containing probe was incubated with nuclear extracts from WISH cells treated with IFN-{gamma} (lanes 2–9). Lane 1, Shows incubation under the same conditions without the cell extract. Abs to IFNGR1 (lane 3), IFN-{gamma} (lane 4), STAT1{alpha} (lane 5), IFNGR2 (lane 6), or normal IgG (lane 7) were added before the addition of labeled probe. Addition of a nonspecific Oct-1 primer (lane 8) and excess cold primer (lane 9) is shown. The DNA protein complex was run on a 6% acrylamide gel, transferred to a nylon membrane, and detected by chemiluminescence by addition of a streptavidin-HRP substrate. The GAS-specific complex and the unbound GAS probe are shown by arrows.

 
A trans activation domain in IFNGR1

To test whether the association of IFNGR1 with the GAS promoter could influence the transcriptional activity from this promoter, the GAS promoter element fused to luciferase reporter gene was used (Fig. 6). Cotransfection of this reporter plasmid in WISH cells with nonsecreted IFN-{gamma} resulted in increased transcriptional activity, which was not seen with a control vector plasmid without the IFN-{gamma} sequence, or an NLS mutant of IFN-{gamma}, in which the positively charged amino acids 128KTGKRKR were replaced with alanines (4). Cotransfection of the reporter plasmid with a plasmid expressing the full-length IFNGR1 and nonsecreted IFN-{gamma} or the cytoplasmic domain of IFNGR1 and nonsecreted IFN-{gamma} resulted in nearly 2-fold increase of the activity from the GAS promoter over that observed with IFN-{gamma} alone. This activity was dependent on the presence of NLS in nonsecreted IFN-{gamma}, because transfection with a NLS mutant of IFN-{gamma} resulted in abolition of increased transcription seen with the full-length or cytoplasmic domain of IFNGR1. Thus, IFN-{gamma} and IFNGR1, which were found to bind to GAS element, are able to enhance transcription upon binding to this sequence.


Figure 6
View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 6. IFNGR1 can stimulate transcription at the GAS promoter. WISH cells were transfected with a vector without the promoter element (lane 1), or with the plasmid containing the GAS element linked to luciferase gene in all other lanes. Constitutively expressed Renilla luciferase vector was included in all of the lanes. Cotransfection was conducted with an empty expression vector (lane 2), or the different coding sequences in expression vector, such as nonsecreted IFN-{gamma} (lane 3), nonsecreted IFN-{gamma} and cytoplasmic domain of IFNGR1 (lane 4), and nonsecreted IFN-{gamma} and full-length IFNGR1 (lane 5). An NLS mutant of IFN-{gamma}, in which alanines were substituted for lysines and arginines in the NLS, was used with the reporter plasmid in lane 6, and with the reporter plasmid and cytoplasmic domain of IFNGR1 (lane 7), and with the reporter plasmid and full-length IFNGR1 (lane 8). Two days later, relative luciferase activity was measured. Abbreviations: ICD, cytoplasmic domain of IFNGR1; R1, full-length IFNGR1.

 
The increased transcriptional activity observed with IFNGR1 was further verified by fusion of the full-length or cytoplasmic domain of IFNGR1 with the yeast GAL4 DNA binding domain in plasmid pFA-CMV (Stratagene). A reporter plasmid, pFR-luciferase (Stratagene), that contains the GAL4 response element fused to luciferase gene was used as a reporter (Fig. 7). Transfections were conducted in NIH 3T3 cells using Renilla luciferase as an internal control. The plasmids pFA-CMV and pFR-luciferase transfected simultaneously showed transcriptional activity that was not observed with either of these plasmids transfected individually. Interestingly, constructs with either the full-length or cytoplasmic domain of IFNGR1 fused to GAL4 DNA binding domain showed a higher transcriptional response than seen with the GAL4 DNA binding domain alone, suggesting the presence of trans activational domain in IFNGR1. Because the IFNGR1 in itself does not carry a DNA binding domain, its association with STAT1{alpha} at the GAS element may provide that function. The presence of IFN-{gamma} in the same transcriptional complex may have a further role in generating a response unique to this cytokine.


Figure 7
View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 7. Trans activational domain in IFNGR1. NIH 3T3 cells were used to transfect the plasmid, pFA-CMV, containing yeast GAL4 DNA binding domain alone (lane 1), or the reporter plasmid, pFR-luciferase, containing GAL4 response element linked to firefly luciferase gene alone (lane 2). The reporter plasmid was cotransfected with pFA-CMV (lane 3), cytoplasmic domain of IFNGR1 fused to GAL4 DNA binding domain (lane 4), or full-length IFNGR1 fused to GAL4 DNA binding domain (lane 5). Relative luciferase activity was determined 2 days later. Abbreviations: FA, plasmid pFA-CMV; FR, plasmid FR-CMV; FA.ICD, cytoplasmic domain of IFNGR1 fused to GAL4 DNA binding domain; FA.R1, full-length IFNGR1 fused to GAL4 DNA binding domain.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The STAT family of transcription factors has seven members, which are thought to be the mediators of the unique functions associated with >50 different ligand/receptor systems (14). STAT proteins usually form homodimers in response to ligand stimulation, and structure studies have shown that STATs bind to the response elements on genes as dimers (15). Notable exceptions are STAT1/STAT2 mediation of type I IFN activity (reviewed in Ref. 9), STAT1/STAT3 mediation of IL-6 activity, and STAT5{alpha}/STAT5beta mediation of growth hormone activity. The prevailing view in STAT signaling is that the ligand activates the cell solely via interactions with the extracellular domain of the receptor complex (14). This in turn results in the activation of receptor-associated JAK kinases (14), leading to phosphorylation and dimerization of STAT transcription factors, which then dissociate from the receptor cytoplasmic domain and translocate to the nucleus. Given the limited number of STAT family members along with their preference to form homodimers, it is difficult to explain the unique specificity of a given ligand/receptor system if the activated STAT is viewed as being solely responsible for the resultant biological function. Various scenarios have been put forth to explain this apparent paradox. For example, the specificity of signaling could be explained in part by the nature or prior commitment of the target cell. In effect there is only one type of response that the cell can make no matter how many different ligands use the particular STAT in cell signaling. There are cells, however, that can respond with specificity to several cytokines that use the same STAT signaling. For example, IFN-{gamma} and IL-10 both activate STAT1 in human monocytes to form homodimers, yet the cellular response differs for the two proteins (reviewed in Ref. 9). IFN-{gamma} induces an antiviral state and up-regulates MHC class II molecules on monocytes, while IL-10 does neither.

It has also been proposed that JAK/STAT signaling is modular and highly flexible, with substantial overlap between different response pathways (16). This proposal is based in part on the observation that IL-6 can induce an antiviral state in cells lacking the STAT3 gene. IL-6 activates both STAT1 and STAT3 in cells, and thus its ability to induce an antiviral state in wild-type cells is blocked by concomitant activation of STAT3 according to this model. The modular model does not explain findings that some type I IFNs can activate STAT3 along with STAT1 and STAT2 and still induce an antiviral state (16). It also does not take into account the fact that IFNs are routinely assayed in the presence of other cytokines that can activate STAT3 in cells, including IL-6.

As indicated above, we have established that a complex of IFN-{gamma}/IFNGR1/STAT1{alpha} is involved in active transport of phospho-STAT1{alpha} into the nucleus, including most recently by the digitonin in vitro transport assay system (6). PhosphoSTAT1{alpha} did not undergo active nuclear transport in the absence of IFN-{gamma} and IFNGR1. By contrast, reports that STAT1{alpha} possesses an intrinsic unconventional NLS have all used overexpression of STAT1{alpha} fused with GFP (13). An unconventional intrinsic NLS has not been demonstrated for STAT1{alpha} by the digitonin nuclear assay method. The data presented in this study address the nature of postnuclear transport events. ChIP of nuclear extracts with Abs to IFN-{gamma}, IFNGR1, and STAT1{alpha} from WISH cells treated with IFN-{gamma}, followed by PCR, showed that all of the proteins were associated with a DNA sequence containing the IFNG{gamma} GAS element. ChIP with Abs to IFNGR1 and STAT1{alpha} also showed STAT1{alpha}, IFNGR1, and IFN-{gamma} proteins associated with the same DNA sequence by Western blot analysis. IFN-{gamma}, IFNGR1, and STAT1{alpha} from nuclear extracts of cells treated with IFN-{gamma} also bound to biotinylated GAS nucleotide sequence. IFNGR2, which did not undergo endocytosis, was not present in any ChIP assays. As expected, IFN-{gamma} treatment of WISH cells transfected with a GAS-luciferase reporter gene resulted in gene activation. Overexpression of the cytoplasmic domain of IFNGR1 resulted in enhanced reporter gene activity, suggesting that IFNGR1 possesses transcription factor activity.

The findings presented in this study are similar to those reported for epidermal growth factor (EGF) receptor (EGFR) transcription activity (17). EGFR and its ligand EGF have been shown to traffic to the nucleus. This has culminated in the identification of a function for the EGFR isoform ErB-1 in the nucleus, in which EGFR was shown to bind to the cyclin D promoter in a sequence-specific manner and to modulate cyclin D1 gene transcription (17, 18). Although EGFR had trans activational function, it lacked a DNA binding domain, and thus most likely required a DNA-binding cotranscription factor. Analogous to the interaction of IFNGR1 with STAT1{alpha}, EGFR was shown to physically interact with STAT3 in the nucleus, leading to transcriptional activation of inducible NO synthetase (18).

Similarly, the prolactin hormone has been shown to traffic to the nucleus in treated cells via a cyclophilin B chaperone (19). Interestingly, prolactin activated STAT5, formed a complex with it in the nucleus, and increased STAT5{alpha}-mediated gene expression. Thus, prolactin appears to function as an inducer of STAT5{alpha} transcriptional activity. That the STATs by themselves are not the ultimate determinants of transcriptional response is also evidenced by the recent observation that STAT3 could act as a transcriptional activator or a repressor of cdc25A promoter, depending on whether it was associated with myc or retinoblastoma protein at this promoter (20).

We have shown previously that interaction of IFN-{gamma} with its receptor results in formation of the complex of STAT1{alpha}/IFNGR1/IFN-{gamma} in both the cytoplasm and nucleus (6, 7). Specifically, similar complexes were found in both compartments using immunoprecipitation with Abs to the proteins of the complex. Thus, IFNGR1 and IFN-{gamma} are contained in complexes with STAT1{alpha} in the nucleus. The data presented in this study indicate that all of these proteins are associated with the GAS element of genes activated by IFN-{gamma}, but it is possible that IFNGR1 and IFN-{gamma} could also interact with the GAS element on their own independent of STAT1{alpha}. Future studies will focus on the role of the STAT1{alpha}/IFNGR1/IFN-{gamma} complex in IFNGR1 and IFN-{gamma} binding to the GAS element.

Direct transcriptional/cotranscriptional activity of ligand/receptor systems such as IFN-{gamma}, EGF, and prolactin has important implications for the specificity of biological activities of these factors as well as a plethora of other factors that signal through the JAK/STAT pathway (21). In all systems examined that use STAT signaling, the ligand and/or the receptor contain a conventional polycationic NLS in its sequence and ligand and/or receptor have been shown to traffic to the nucleus in every case that was examined (21). This would suggest that conservation of the NLS sequence in protein systems that activate STAT transcriptional factors has important implications in determining specificity of gene activation by these factors.


    Acknowledgments
 
We thank Donna Williams for help with confocal microscopy.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grant AI 56152 and Grant W911NF-05-1-0170 from the Department of Defense (to H.M.J.). Back

2 Address correspondence and reprint requests to Dr. Chulbul M. I. Ahmed, Department of Microbiology and Cell Science, University of Florida, P.O. Box 110700, Building 981, Room 1052, Gainesville, FL 32611-0700. E-mail address: ahmed1{at}ufl.edu Back

3 Abbreviations used in this paper: NLS, nuclear localization sequence; ChIP, chromatin immunoprecipitation; EGF, epidermal growth factor; EGFR, EGF receptor; GAS, IFN-{gamma}-activated sequence; IDO, indoleamine dioxygenase; IRF, IFN regulatory factor. Back

Received for publication December 7, 2005. Accepted for publication April 7, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. MacDonald, H. S., V. M. Kushnaryov, J. J. Sedmak, S. E. Grossberg. 1986. Transport of {gamma} interferon into the cell nucleus may be mediated by nuclear membrane receptors. Biochem. Biophys. Res. Commun. 138: 254-260. [Medline]
  2. Bader, T., J. Weitzerbin. 1994. Nuclear accumulation of interferon {gamma}. Proc. Natl. Acad. Sci. USA 91: 11831-11835. [Abstract/Free Full Text]
  3. Subramaniam, P. S., M. G. Mujtaba, M. R. Paddy, H. M. Johnson. 1999. The carboxy terminus of interferon {gamma}. J. Biol. Chem. 274: 403-407. [Abstract/Free Full Text]
  4. Ahmed, C. M., M. A. Burkhart, M. G. Mujtaba, P. S. Subramaniam, H. M. Johnson. 2003. The role of IFN{gamma} nuclear localization sequence in intracellular function. J. Cell Sci. 116: 3089-3098. [Abstract/Free Full Text]
  5. Subramaniam, P. S., M. M. Green, J. Larkin, III, B. A. Torres, H. M. Johnson. 2001. Nuclear translocation of IFN{gamma} is an intrinsic requirement for its biological activity and can be driven by a heterologous nuclear localization sequence. J. Interferon Cytokine Res. 21: 951-959. [Medline]
  6. Subramaniam, P. S., J. Larkin, M. G. Mujtaba, M. R. Walter, H. M. Johnson. 2000. The COOH-terminal nuclear localization sequence of interferon {gamma} regulates STAT1{alpha} nuclear translocation at an intracellular site. J. Cell Sci. 113: 2771-2781. [Abstract]
  7. Larkin, J., H. M. Johnson, P. S. Subramaniam. 2000. Differential nuclear localization of the IFNGR-1 and IFNGR-2 subunits of IFN{gamma} receptor complex following activation by IFN{gamma}. J. Interferon Cytokine Res. 20: 565-576. [Medline]
  8. Subramaniam, P. S., H. M. Johnson. 2002. Lipid microdomains are required sites for the selective endocytosis and nuclear translocation of IFN{gamma}, its receptor chain IFN{gamma} receptor-1, and the phosphorylation and nuclear translocation of STAT1{alpha}. J. Immunol. 169: 1959-1969. [Abstract/Free Full Text]
  9. Subramaniam, P. S., B. A. Torres, H. M. Johnson. 2001. So many ligands, so few transcription factors: a new paradigm for signaling through STAT transcription factors. Cytokine 15: 175-187. [Medline]
  10. Szente, B. E., P. S. Subramaniam, H. M. Johnson. 1995. Identification of IFN{gamma} receptor binding site for JAK2 and enhancement of binding by IFN{gamma} and its C-terminal peptide IFN{gamma} (95–133). J. Immunol. 155: 5617-5622. [Abstract]
  11. Szente, B. E., H. M. Johnson. 1994. Binding of IFN{gamma} and its C-terminal peptide to a cytoplasmic domain of its receptor that is essential for its function. Biochem. Biophys. Res. Commun. 201: 215-221. [Medline]
  12. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, K. Struhl. 2002. Short Protocols in Molecular Biology Wiley, New York.
  13. McBride, K. M., G. Banningert, C. McDonald, N. C. Reich. 2002. Regulated nuclear import of STAT1 transcription factor by direct binding of importin {alpha}. EMBO J. 21: 1754-1763. [Medline]
  14. Brivanlou, A. H., J. E. Darnell, Jr. 2002. Signal transduction and the control of gene expression. Science 295: 813-818. [Abstract/Free Full Text]
  15. Chen, X., U. Vinkemeier, Y. Zhao, D. Jeruzalmi, J. E. Darnell, J. Kuriyan. 1998. Crystal structure of a tyrosine phosphorylated STAT-1 dimer bound to DNA. Cell 93: 827-839. [Medline]
  16. Kerr, I. M., A. P. Costa-Pereirs, B. F. Lillemeier, B. Strobl. 2003. Of JAKs, STATs, blind watchmakers, jeeps and trains. FEBS Lett. 546: 1-5. [Medline]
  17. Lin, S. Y., K. Makino, W. Xia, A. Matin, Y. Wen, K. Y. Kwong, L. Bourguignon, M. C. Hung. 2001. Nuclear localization of EGF receptor. Nat. Cell Biol. 3: 802-808. [Medline]
  18. Lo, H., S. Hsu, M. Ali-Seyed, M. Gunduz, W. Xia, Y. Wei, G. Bartholomeusz, J. Shih, M. C. Hung. 2005. Nuclear interaction of EGFR and STAT3 in the activation of iNOS/NO pathway. Cancer Cells 7: 575-588.
  19. Rycyzyn, M. A., C. V. Clevenger. 2002. The intracellular prolactin/cyclophilin B complex as a transcription inducer. Proc. Natl. Acad. Sci. USA 99: 6790-6795. [Abstract/Free Full Text]
  20. Barre, B., A. Vigneron, O. Coqueret. 2005. The STAT3 transcription factor is a target for the myc and retinoblastoma proteins on the cdc25A promoter. J. Biol. Chem. 280: 15673-15681. [Abstract/Free Full Text]
  21. Johnson, H. M., P. S. Subramaniam, S. Olsnes, D. A. Jans. 2004. Trafficking and signaling pathways of nuclear localizing protein ligands and their receptors. BioEssays 26: 993-1004. [Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
K. G. Frey, C. M. I. Ahmed, R. Dabelic, L. D. Jager, E. N. Noon-Song, S. M. Haider, H. M. Johnson, and N. J. Bigley
HSV-1-Induced SOCS-1 Expression in Keratinocytes: Use of a SOCS-1 Antagonist to Block a Novel Mechanism of Viral Immune Evasion
J. Immunol., July 15, 2009; 183(2): 1253 - 1262.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. M. Ahmed, R. Dabelic, L. W. Waiboci, L. D. Jager, L. L. Heron, and H. M. Johnson
SOCS-1 Mimetics Protect Mice against Lethal Poxvirus Infection: Identification of a Novel Endogenous Antiviral System
J. Virol., February 1, 2009; 83(3): 1402 - 1415.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
A. Baetz, C. Koelsche, J. Strebovsky, K. Heeg, and A. H. Dalpke
Identification of a nuclear localization signal in suppressor of cytokine signaling 1
FASEB J, December 1, 2008; 22(12): 4296 - 4305.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. S. Neves, S. A. C. Perez, L. A. Spencer, R. C. N. Melo, L. Reynolds, I. Ghiran, S. Mahmudi-Azer, S. O. Odemuyiwa, A. M. Dvorak, R. Moqbel, et al.
Eosinophil granules function extracellularly as receptor-mediated secretory organelles
PNAS, November 25, 2008; 105(47): 18478 - 18483.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Kalie, D. A. Jaitin, Y. Podoplelova, J. Piehler, and G. Schreiber
The Stability of the Ternary Interferon-Receptor Complex Rather than the Affinity to the Individual Subunits Dictates Differential Biological Activities
J. Biol. Chem., November 21, 2008; 283(47): 32925 - 32936.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. N. Khodarev, A. J. Minn, E. V. Efimova, T. E. Darga, E. Labay, M. Beckett, H. J. Mauceri, B. Roizman, and R. R. Weichselbaum
Signal Transducer and Activator of Transcription 1 Regulates Both Cytotoxic and Prosurvival Functions in Tumor Cells
Cancer Res., October 1, 2007; 67(19): 9214 - 9220.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. M. Ahmed, J. P. Martin, and H. M. Johnson
IFN Mimetic as a Therapeutic for Lethal Vaccinia Virus Infection: Possible Effects on Innate and Adaptive Immune Responses
J. Immunol., April 1, 2007; 178(7): 4576 - 4583.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ahmed, C. M. I.
Right arrow Articles by Johnson, H. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ahmed, C. M. I.
Right arrow Articles by Johnson, H. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS