The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chin, R. K.
Right arrow Articles by Fu, Y.-X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chin, R. K.
Right arrow Articles by Fu, Y.-X.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
Medline Plus Health Information
*Joint Disorders
The Journal of Immunology, 2006, 177: 290-297.
Copyright © 2006 by The American Association of Immunologists

Lymphotoxin Pathway-Directed, Autoimmune Regulator-Independent Central Tolerance to Arthritogenic Collagen1

Robert K. Chin2,*, Mingzhao Zhu2,*, Peter A. Christiansen*, Wenhua Liu*, Carl Ware{dagger}, Leena Peltonen{ddagger}, Xuejun Zhang§, Linjie Guo§, Shuhua Han§, Biao Zheng3,§ and Yang-Xin Fu3,4,*

* Department of Pathology and Committee in Immunology, University of Chicago, Chicago, IL 60637; {dagger} Division of Molecular Immunology, La Jolla Institute for Allergy and Immunology, San Diego, CA 92121; {ddagger} University of Helsinki and National Public Health Institute, Helsinki, Finland; and § Department of Immunology, Baylor College of Medicine, Houston, TX 77030


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Ectopic expression of peripherally restricted Ags by medullary thymic epithelial cells (mTECs) is associated with negative selection. Autoimmune regulator (AIRE) is considered to be the master regulator of these Ags. We show in this study that the ectopic expression of type II collagen (CII) in mTECs and the corresponding central tolerance to CII are AIRE independent but lymphotoxin dependent. The failure to properly express CII in mTECs of Lta–/– and Ltbr–/– mice leads to overt autoimmunity to CII and exquisite susceptibility to arthritis. These findings define the existence of additional pathways of ectopic peripheral Ag expression, parallel to and independent of AIRE, which may cover an extended spectrum of peripheral Ags in the thymus.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
ATCR repertoire that is exquisitely fitted to self-MHC is crucial for the sensitivity with which T cells must respond to foreign Ags. This requirement is balanced against the necessity of eliminating or otherwise controlling the imminent threat of overtly self-reactive TCR specificities. Autoimmune regulator (AIRE),5 considered a master regulator (1), drives the presentation of a robust and comprehensive immunological self in the thymus through the ectopic expression of peripherally restricted Ags by key medullary thymic epithelial cells (mTECs). Mutation of AIRE is responsible for autoimmune polyenocrinopathy-candidiasis-ectodermal dystrophy (APECED), an autosomal recessive, monogenic disorder characterized by organ-specific autoantibodies and multiorgan autoimmune destruction (2, 3, 4). The expression of AIRE in mTECs is itself directed by signaling through the lymphotoxin-beta receptor (LTbetaR) (5). Its ligand LT is expressed predominantly in the lymphoid compartment and is up-regulated on activated thymocytes (6). Autoimmunity arising from perturbed tolerance in the thymus has been documented for Lta–/– and Ltbr–/– mice and indeed mice deficient in several downstream signaling molecules (5, 7, 8, 9).

Clinical findings in APECED patients with mutations in AIRE, and analysis of Aire–/– mice, have revealed autoimmunity and autoimmune destruction focused predominantly on features the endocrine system (1, 2, 3, 4). The targeting of predominantly endocrine organs in APECED and Aire–/– mice raises the possibility that, even in the absence of AIRE, hosts can remain tolerized to the wide spectrum of outstanding peripherally restricted Ags. To explore the possibility that, in addition to AIRE, lymphotoxin signaling drives an additional host of parallel pathways for the ectopic expression of peripheral Ags, we investigated self-Ags known to be targeted in autoimmune disease, but not targeted in APECED. Type II collagen (CII) is a prominent target of autoimmune destruction in rheumatoid arthritis (RA) and is the arthritogenic Ag in the mouse model of RA, collagen-induced arthritis (CIA) (10, 11). It is unclear whether there is a defect at the level of central or peripheral tolerance in the pathogenesis of disease. There is a preponderance of evidence implicating CD4+ T cells as the central mediators of disease induction in arthritis (12). Not only does susceptibility segregate with class II MHC (MHC-II) polymorphism, administration of mAbs in mouse models against TCR{alpha}beta, CD4, and I-A all prevent disease (13, 14, 15). Recent gene array analysis of mouse MECs revealed many gene transcripts that may not be controlled by Aire (16, 17). Interestingly, CII also is selectively expressed in human MECs, raising the possibility that impaired central tolerance may contribute to human RA (18). Given the essential contributions of autoreactive T cells to the pathogenesis of both RA and CIA, we sought to define the role of central tolerance in forestalling anti-CII autoimmunity and examine the input of both AIRE and LT to this process.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mice

Lta–/– and Ltbr–/– mice, originally established on the 129 strain, were backcrossed to C57BL/6 mice for at least 13 and 11 generations, respectively, and maintained under specific pathogen-free conditions as described. C57BL/6 and Rag1–/– mice were purchased from The Jackson Laboratory. Ltbr–/– mice were obtained from Taconic Farms. Aire–/– mice were a gift from Dr. L. Peltonen (University of Helsinki and National Public Health Institute, Helsinki, Finland). Animal care and use were in accordance with institutional and National Institutes of Health guidelines.

mTEC isolation

TECs were isolated largely according to previously described protocol (1). Briefly, five thymi from young (5- to 7-wk-old) mice were digested with collagenase (0.1 µg/ml), dispase (2 U/ml), and DNase (10 U/ml) in RPMI 1640 (5% FCS) for 30 min x three rounds at 37°C. Cells were resuspended in PBS (5 mM EDTA, 1% FCS), incubated on ice for 10 min, and then separated on a discontinuous Percoll density gradient. The TEC-enriched fraction was harvested and stained with G8.8, 6C3 (Ab to cortical epithelial cell marker with the same reactivity as CDR1; BD Pharmingen), and CD45.2. mTECs were sorted on a MoFlo (DakoCytomation) according to the phenotype of CD45.2G8.8+6C3 with purity of >90%.

Real-time PCR

Real-time PCR was conducted on cDNA prepared from DNase-treated RNA extracted from whole thymus or sorted mTECs after four-color analysis and gating. RNA from mTECs was further amplified with the RiboAmp RNA amplification kit (Arcturus) before cDNA preparation. For AIRE, the following primers were used: (forward) CCAGTGAGCCCCAGGTTAAC, (reverse) GACAGCCGTCACAACAGATGA, (probe) FAM-TCACCTCCGTCGTGGCACACG-TAMRA. For insulin, the following primers were used: (forward) CTTCAGACCTTGGCGTTGGA, (reverse) ATGCTGGTGCAGCACTGATC, (probe) FAM-CCCGGCAGAAGCGTGGCATT-TAMRA. For CII, the following primers were used: (forward) ATTGAGAGCATCCGCAGCC, (reverse) GTTTCAGGTCTTGGCAAGTGC, (probe) FAM-ACGGCTCCCGCAAGAACCCTG-TAMRA. For keratin-14 (K14), the following primers were used: (forward) TGGGTGGAGACGTCAATGTG, (reverse) ATCTCGTTCAGGATGCGGC, (probe) FAM-ACGCCGCCCCTGGTGTGG-TAMRA For normalization, primers for GAPDH were used: The primers for GAPDH were as follows: (forward) TTCACCACCATGGAGAAGGC, (reverse) GGCATGGACTGTGGTCATGA, (probe) TET-TGCATCCTGCACCACCAACTGCTTAG-TAMRA. Duplex real-time PCR, with GAPDH as internal control, was conducted in a final volume of 25 µl with 900 nM of the forward and reverse primers and 200 nM of the probe using 2x Taqman Master Mix (Applied Biosystems) containing AmpliTaq Gold polymerase. Reactions were run on the Cepheid SmartCycler. Analysis of AIRE, insulin, K14, and GAPDH gene expression were performed with a concurrently run standard curve, then normalized to sample GAPDH levels. The standard curves for AIRE, insulin, CII, K14, and GAPDH had r2 values >0.98.

In vivo stimulation of wild-type (WT) and Lta–/– mice

WT and Lta–/– mice received i.p. injections of 50 µg of agonistic anti-LTbetaR Ab or rat-Ig isotype control in PBS. RNA from thymi were collected at 8 and 24 h after injection. Real-time PCR was conducted on cDNA prepared from DNase-treated RNA extracted from whole thymus.

Histology

Joint tissues collected for histologic examination were obtained 2 wk following secondary immunization, fixed in 10% buffered Formalin, and embedded in paraffin. Sections (4–5 µm) were obtained from the paraffin blocks and stained by H&E methods. All sections were then examined qualitatively by a pathologist in a blinded fashion.

Immunofluorescence staining

Age-matched thymi from WT, Lta–/–, and Aire–/– were embedded in OCT and snap-frozen. Sections (8 µm) were obtained from the frozen blocks, fixed in acetone, rehydrated in PBS/0.1% saponin, and blocked with 5% goat serum in PBS at room temperature for 1 h. mAb to Ep-CAM (clone G8.8; BD Biosciences), biotin-conjugated anti-CII mAb (Chondrex). This Ab also crossreacts with type XI collagen, because both types of collagen comprise the same chain, {alpha}1(II). To simplify the presentation in this study, CII represents {alpha}1(II), polyclonal rabbit anti-AIRE (a gift from Dr. P. Peterson, University of Tartu, Tartu, Estonia), and FITC-conjugated mAb to CD11c (clone N418; Biolegend) were incubated with tissue sections at 4°C overnight. Appropriate fluorescence-labeled secondary Abs were used for anti-Ep-CAM and anti-AIRE detection. Tyramid Signal Amplification-biotin amplification (PerkinElmer) was used for anti-CII-biosignal amplification in accordance with the product protocol. For immunofluorescence staining of CII, strepavidin PE-cytochrome 5 was used as the final reagent in TSA-biotin amplification.

Autoantibody ELISA

For detection of anti-insulin autoantibodies, ELISA plates (Dynex Technologies) were coated with 2 U/ml insulin (Lilly Research Laboratories) at 4°C overnight. For the detection of anti-collagen Abs, ELISA plates were coated with ELISA-grade bovine CII (Chondrex) according to the manufacturer’s instructions. Plates were washed with water and blocked with PBS/0.1% BSA for 1 h at 37°C. Serum samples were serially diluted in PBS/0.1% BSA from 1/300 to 1/8100. Bound Abs were detected with alkaline phosphatase-conjugated goat anti-mouse IgG (Southern Biotechnology Associates). The OD was measured at 405 nm by a spectrophotometer (Molecular Devices). Following dilution factor correction, adjacent OD readings on linear portion of titration curve were averaged. Arbitrary units were calculated from standard curve and divided by 103 before plotting. For statistical analysis, p values were determined by Student’s two-tailed t test.

Splenocyte and T cell transfer

Splenocytes were obtained by mechanically disrupting the spleens of 5- to 7-mo-old age-matched Ltbr–/– and WT control mice. RBCs were depleted with ammonium chloride (ACK) RBC lysis buffer. Forty million cells were injected retro-orbitally into sublethally irradiated (350 rad) Rag1–/– mice. Mice were bled 4 wk after transfer and analyzed for autoantibodies. For T cell transfer, B cells were purified from C57BL/6 WT mice by MACS column (Miltenyi Biotec), and CD4+ T cells were similarly purified by MACS column from age-matched C57BL/6 WT and Ltbr–/– mice. Two million purified CD4+ T cells from either C57BL/6 WT or Ltbr–/– mice were combined with 10 million purified WT B cells, and injected retroorbitally into Rag1–/– mice. Mice were bled 8 wk after transfer and analyzed for autoantibodies.

Thymus transplantation Thymi were isolated from newborn Ltbr–/– or WT mice and cultured in 1.35 mM 2-deoxyguanosine (Sigma-Aldrich) for 6–8 days to deplete bone marrow-derived cells. Thymi were then transplanted under the kidney capsule of 6-wk-old adult C57BL/6 mice that were thymectomized at 4 wk of age. Recipients were lethally irradiated and reconstituted with WT bone marrow immediately before thymus transplantation. Whole blood was collected 6 wk after transplantation. T cell reconstitution was assessed by FACS analysis of whole blood for CD4, CD8, and B220. Serum was used for autoantibody ELISA as described above.

In vitro T cell stimulation and collagen-induced arthritis

For the induction of CIA, 12-wk-old C57BL/6 WT or Lta–/– animals were injected i.d. at the base of the tail, with 100 µg (in 100 µl) of chicken CII (Sigma-Aldrich) dissolved in 0.01 M acetic acid and emulsified in an equal volume of CFA prepared by grinding 100 mg of heat-killed Mycobacterium tuberculosis (H37Ra; Difco) in 20 ml of IFA (Sigma-Aldrich). Mice were boosted with the same dose of CII in IFA by i.p. injection at day 21, then observed daily for the onset of arthritis. The arthritis index was derived by grading the severity of each paw from 0 to 3 as described (19), based on the degree of swelling and periarticular erythema. The scores of all four paws were added up to yield the arthritic index (19). For in vitro T cell stimulation, CD4+ T cells were purified from the spleen by MACS column (Miltenyi Biotec) from C57BL/6 WT and Lta–/– mice 10 days after secondary CII immunization or primary KLH immunization, respectively. Splenocytes from young, normal congenic mice were irradiated with 2000 rad and used as APCs. A total of 4 x 105 purified T cells and 1 x 106 APCs per well were used for proliferation assays. Denatured Arthrogen-CIA T cell grade type II chicken collagen (Chondrex) or keyhole limpet hemocyanin (Sigma-Aldrich) was added as stimulating Ag at concentrations of 0, 10, and 50 µg/ml. Cells were cultured in flat-bottom 96-well plates with DMEM supplemented with 1.5% homologous normal serum, penicillin-streptomycin (1x), and 2-ME (2-ME, 5 x 105 M) for 5 days. [3H]thymidine was added 16 h before cell harvest. Cell culture supernatants were collected at 72 h, and IFN-{gamma} concentration was analyzed by mouse Th1/Th2 cytokine CBA kit (BD Biosciences).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Ectopic thymic expression of CII is independent of AIRE

To determine whether CII, like insulin, is expressed in the thymus, real-time PCR was used to measure CII ({alpha}1) mRNA expression in 4-wk-old WT B6 thymi. CII was robustly expressed in WT thymi (Fig. 1a). To determine whether AIRE also is required for the ectopic expression of CII, thymi from age-matched Aire–/– mice were analyzed for relative CII mRNA levels and found to be statistically similar to WT (Fig. 1a). This is in striking contrast with the ectopic expression of insulin, which was undetectable in the thymi of Aire–/– mice (Fig. 1a). These findings raise the possibility that the ectopic expression of CII, and possibly a host of other autoantigens, is AIRE independent.


Figure 1
View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 1. Ectopic expression of CII is independent of AIRE. a, Real-time PCR analysis was conducted on cDNA prepared from DNase-treated RNA extracted from whole thymus. Relative abundance of mRNA levels of Ins1 and CII in 4- to 6-wk-old age-matched thymi from WT and Aire–/– mice is shown. The data represent the mean ± SEM. b and c, Production of anti-insulin (b) and anti-CII Ab (c) from age-matched (5–7 mo) WT and Aire–/– mice were measured by serum ELISA. Titers in arbitrary units were plotted after being divided by 103. Statistical analysis by Student’s t test.

 
To determine whether the divergent expression profiles of CII and insulin in the Aire–/– thymus manifests themselves into different susceptibility to autoimmune reactivity to these Ags with age, we analyzed, by ELISA, spontaneously arising anti-insulin and anti-CII Ab titers of 5- to 7-mo-old age-matched WT and Aire–/– mice. Although there was a significant increase in the titers of anti-insulin Ab in Aire–/– mice relative to WT (Fig. 1b), there was no perceptible change in anti-CII titers (Fig. 1c). These data suggest that ectopic expression of peripheral Ags in the thymus may play a crucial role in forestalling the development of autoimmunity to those specific Ags. In contrast with the failure of ectopic insulin expression in Aire–/– thymi and subsequent raising of anti-insulin Abs, ectopic expression of CII and tolerance to CII were unaffected by the absence of AIRE.

Thymic expression of CII is controlled by LT

As an Ag whose expression in the periphery is tightly restricted, the ectopic expression of CII in the thymus is likely to be similarly regulated, even if independent of AIRE. Previous studies have demonstrated the rapid kinetics and acute sensitivity with which Aire and ectopic insulin expression respond to signaling through the LT pathway (5). Grossly, we did not observe a major reduction of the medulla area by H&E staining nor by various anti-mTEC Abs. To determine whether the LT pathway controls the ectopic expression of CII, as it does insulin, we used real-time PCR to measure CII mRNA expression in age-matched WT, Lta–/–, and Ltbr–/– thymi. Both Lta–/– and Ltbr–/– thymi showed a 75–80% reduction in their expression of CII, the level of reduction similar to insulin (Fig. 2a). To exclude the possibility that the reduction of Ag levels in Lta–/– and Ltbr–/– thymi was due to a reduction in mTEC numbers (5, 7, 8, 9), mTECs from 6-wk-old WT and Ltbr–/– thymi were isolated according to the method described previously (1), and CII mRNA expression level was determined. On a per-cell basis, CII expression was again reduced in Ltbr–/– mTECs relative to WT with GAPDH as internal control (data not shown). Furthermore, because K14 is specifically and constitutively expressed in the majority of mTECs (5, 20). K14 was used as an internal control in real-time PCR, CII expression remained reduced in Ltbr–/– mTECs relative to WT (Fig. 2b). These data suggest that the LT pathway is necessary for the optimal expression of CII in mTECs.


Figure 2
View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 2. Ectopic expression of CII is dependent on LT. Real-time PCR analysis was conducted on cDNA prepared from DNase-treated RNA extracted from whole thymus. Relative abundance of mRNA levels of CII (a) in 4- to 6-wk-old age-matched WT, Lta–/–, and Ltbr–/– thymi is shown. Error bars indicate SD. b, Stroma from the thymi of five 6-wk-old WT or Ltbr–/– mice was stained with CD45.2, G8.8, and 6C3 Abs. RNA was isolated from sorted mTECs and amplified. cDNA was made and subject to real-time PCR to determine CII mRNA expression relative to the internal control, Krt1–14. Error bars indicate SD. c and d, Four-week-old WT (c) and Lta–/– (d) mice were injected i.p. with agonistic LTbetaR-Ab (3C8) or rat-Ig isotype control. RNA was collected from recipient thymi 8 or 24 h later, and real-time PCR was used to evaluate the relative abundance of Aire, CII, and Krt1–14 mRNA in recipients in response to 3C8 stimulation. Time (h) indicates hours of exposure of recipients to 3C8. Fold induction was calculated against respective rat-Ig isotype-treated thymi. The data represent the mean ± SEM.

 
To explore the kinetics by which CII can be induced by signaling through LTbetaR, young adult WT mice were treated briefly with agonistic LTbetaR mAb (3C8). Mice were injected i.p. with 3C8 or control rat-Ig, and thymi were collected after 8 and 24 h. At 8 h, WT mice treated with 3C8 demonstrated a 7-fold induction in Aire mRNA expression and a 20-fold increase in ectopic CII mRNA (Fig. 2c). At 24 h, expression of both genes had returned to baseline levels. Agonistic LTbetaR mAb treatment of Lta–/– mice resulted in a similar pattern of induction (Fig. 2d). Thus, not only does CII expression respond to LTbetaR stimulation, but also the kinetics of its regulation by LTbetaR signaling is rapid, demonstrating the exquisite sensitivity by which CII is controlled by the LT pathway. To demonstrate that the induction of CII by stimulation with agonistic LTbetaR Ab is specific to appropriate downstream targets, we used K14 as a negative control. K14 is a marker constitutively expressed by medullary epithelial cells and not known to be inducible by LTbetaR. Under all conditions of stimulation, we found ample expression but negligible induction of K14 (Fig. 2, c and d). Together, these data suggest that thymic expression of CII is controlled by LT.

AIRE and CII expression may be segregated into distinct cell populations

Having determined by real-time PCR that Aire–/– leave ectopic expression of CII in the thymus undisturbed, whereas Lta–/– and Ltbr–/– thymi present with serious disruption of CII expression, we undertook to confirm these findings at the protein level by immunofluorescence localization. Double staining in WT thymi of ectopically expressed CII (red) and the MEC marker G8.8 (green) localized the ectopically expressed CII within the epithelial cells of the thymic medulla (Fig. 3a). To assess whether ectopically expressed CII is disturbed in Aire–/– and Lta–/– thymi, age-matched thymi from these mice were similarly stained. Although Aire–/– thymi presented with no perturbation in ectopic CII expression (Fig. 3b), Lta–/– thymi appeared to have substantially lost CII expression (Fig. 3c). These findings confirm our real-time PCR data, that although ectopic expression of CII is independent of AIRE, it is critically dependent on LT signaling.


Figure 3
View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 3. AIRE and CII expression are segregated into distinct cell populations. a–c, Simultaneous tissue immunofluoresence staining for ectopically expressed CII (red) and mTEC maker Ep-CAM (green) on thymic tissue sections from age matched WT (a), Aire–/– (b), and Lta–/– (c) mice. d–f, Simultaneous immunofluoresence staining of AIRE (green) and CII (red): AIRE (d, green), and CII (e, red). f, Simultaneous immunofluoresence staining of ectopically AIRE (green) and CII (red). g and h, Simultaneous staining of dendritic cell marker CD11c (green) and CII (red).

 
Having demonstrated that CII is expressed in the thymus independently of AIRE, we wished to determine further whether the pathway responsible for CII expression localizes to the same cell population as the AIRE pathway. Double staining of WT thymi for AIRE (green) and CII (red), revealed no significant colocalization (Fig. 3, d–f). Additionally, staining of dendritic cell markers has excluded these lineages as the source of ectopic CII (Fig. 3, g and h). Together, these data suggest that AIRE-dependent and parallel AIRE-independent pathways reside in distinct cohorts of mTECs, together forming a patchwork representation of the peripheral self.

Breakdown of central tolerance leads to spontaneous anti-collagen autoimmunity

Having found profound reduction in CII expression in the thymi of Lta–/– and Ltbr–/– mice, in a manner reminiscent to that of ectopic insulin expression, we investigated further whether, similar to insulin, this reduction in ectopically expressed CII was severe enough to represent a breakdown of tolerance. Autoantibodies to CII, a T cell-dependent response, have been shown to initiate joint inflammation by binding to articular cartilage and activating complement and are sufficient on passive transfer to induce severe acute arthritic damage (21, 22). We assayed for the production of spontaneously arising anti-CII Abs as an indicator of defective T cell-dependent tolerance in Lta–/– and Ltbr–/– mice by ELISA. Consistent with a breakdown in tolerance to this self-Ag, we found significantly higher titers of CII Ab and anti-insulin Ab in both Lta–/– and Ltbr–/– mice (Fig. 4, a and b). Despite overt anti-CII autoimmunity, analysis of both Lta–/– and Ltbr–/– mice age >1 year revealed no evidence of spontaneously arising arthritis, presumably because the absence of peripheral LT signaling blocks disease pathogenesis, as demonstrated recently (23).


Figure 4
View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 4. Autoimmune inflammation in LT-deficient mice is lymphocyte autonomous. a and b, Production of anti-insulin (a) and anti-CII Ab (b) from age-matched (5–7 mo) WT, Lta–/–, and Ltbr–/– mice was measured by serum ELISA. c and d, Age-matched (5–7 mo) WT and Ltbr–/– splenocytes were adoptively transferred into sublethally irradiated Rag1–/– recipients. Recipient sera were analyzed by ELISA for the presence of anti-insulin (c) and anti-collagen Abs (d). e and f, Age-matched (5–7 mo) WT or Ltbr–/– CD4+ T cells were combined with WT B cells and transferred to Rag1–/– mice. Recipient sera were analyzed by ELISA for the presence of anti-insulin (e) and anti-collagen Abs (f) Representative figure of two independent experiments.

 
To sidestep the constraint imposed by the absence of LT signaling in the periphery, and to confirm that the autoimmunity in Lta–/– and Ltbr–/– mice represents a defect within the lymphoid compartment, 40 million splenocytes from 7-mo-old WT and Ltbr–/– mice were transferred into lightly irradiated (350 rad) Rag1–/– mice. Similar to anti-insulin Ab, serum titers of anti-CII Ab also were significantly elevated in Rag1–/– recipients of Ltbr–/– donor splenocytes (Fig. 4, c and d). Ltbr–/– donor splenocytes in Rag1–/– hosts were thus able to recapitulate the findings of Lta–/– and Ltbr–/– mice, demonstrating both the lymphoid-autonomous nature of the autoimmunity shown in these mice and the magnitude of autoimmune destruction that can arise from a defect in LT-regulated central tolerance. To attribute the autoimmunity exclusively to the T cell compartment, we transferred 2 million purified Ltbr–/– or WT T cells, in conjunction with 10 million purified WT B cells, into Rag1–/– mice. These autoantibody titers were similarly elevated in Rag1–/– recipients of purified Ltbr–/– donor T cells after 8 wk (Fig. 4, e and f). These data suggest that there is a potential increase of autoreactive T cells in the spleen leading to increased anti-CII Ab production.

Although the above splenocyte and T cell transfer experiments have focused the autoimmune defect to the T cell compartment, they still do not conclusively define whether this breakdown in T cell tolerance occurs centrally or in the periphery. To unequivocally demonstrate that the absence of LT signaling in the thymus results in a breakdown of T cell central tolerance in Lta–/– and Ltbr–/– mice, we performed thymus transplantation experiments. Thymi from Ltbr–/– and WT newborn pups were cultured for 6–8 days in the presence of 1.35 mM 2-deoxyguanosine to deplete bone marrow-derived cells. These thymi were then transplanted under the kidney capsule of 6-wk-old thymectomized B6 mice. Recipients were lethally irradiated before surgery and reconstituted with WT bone marrow the same day. Screening of recipients at 12 wk postop found comparable reconstitution of the T cell compartments (data not shown). Screening for spontaneously arising autoantibodies, we found significant higher levels of anti-insulin and anti-CII Abs in recipients of Ltbr–/– thymi (Fig. 5, a and b). An increase in tissue infiltration of T cells is often seen in Ltbr–/– and Aire–/– mice and as an important feature of autoimmunity. To determine whether recipients of Ltbr–/– thymi recapitulate this increase in tissue infiltration, various tissues were collected and submitted for histological analysis. These studies indeed revealed increased tissue infiltration in reconstituted mice, especially in the liver (Fig. 5c). These data clearly demonstrate not only that T cell central tolerance is critical for suppression of anti-CII autoimmunity, but also that the disruption of the ectopic expression of insulin and CII in the thymi of Lta–/– and Ltbr–/– mice results in autoimmune responses to those Ags.


Figure 5
View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 5. Thymic LTbetaR expression is critical for central tolerance. Neonatal WT and Ltbr–/– thymi were cultured in 1.35 mM 2-deoxyguanosine (Sigma-Aldrich) for 6–8 days to deplete bone marrow-derived cells. Thymi were then transplanted under the kidney capsule of 6-wk-old thymectomized C57BL/6 mice. Recipients were lethally irradiated and reconstituted with WT bone marrow the same day. Recipient sera were analyzed by ELISA for the presence of anti-insulin (a) and anti-collagen Abs (b) 3 mo following transplant. Titers expressed in arbitrary units. Student’s t test is used for statistical analysis. Increase of infiltration of lymphocytes into liver was clearly visualized in nude mice reconstituted with Ltbr–/– thymi (c).

 
Lta–/– mice are susceptible to CIA despite their resistant C57BL/6 background

Susceptibility to CIA is profoundly influenced by MHC-II genetics, and in genetically resistant strains, such as C57BL/6, even repeated immunizations fail to produce disease (10). Our Lta–/– and Ltbr–/– mice, despite their resistant C57BL/6 background and lack of draining LNs, spontaneously elaborate anti-CII Abs and increased T cell response to CII in a manner reminiscent of strains susceptible to CIA, such as DBA/1(10). To determine whether the disruption of central tolerance to CII in Lta–/– and Ltbr–/– mice is sufficiently severe to overcome the inhibitions of their resistant C57BL/6 background in vivo, we challenged WT and Lta–/– mice with heterologous CII emulsified in CFA, boosted at day 21 with i.p. injection of IFA-emulsified CII. At day 11 after boost, both groups display 100% incidence of arthritis symptoms. Although WT B6 mice remained only mildly symptomatic in response to repeat immunizations, all Lta–/– mice developed fulminant disease phenotype after the secondary immunization (Fig. 6a). In Lta–/– mice, histological analysis of the interphalangeal joints 2 wk after secondary immunization showed typical synovial hyperplasia and infiltration of the subsynovial tissue with inflammatory cells, including lymphocytes, whereas WT joints were histologically normal (Fig. 6b). These findings demonstrate that the breakdown in central tolerance to CII in Lta–/– and Ltbr–/– mice may be sufficiently severe to render them now susceptible to CIA, despite their resistant C57BL/6 background.


Figure 6
View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 6. LT{alpha}-deficient mice are susceptible to CIA despite resistant C57BL/6 background. a, Incidence of arthritis and clinical scores of C57BL/6 WT (open symbols, n = 8 mice) and Lta–/– (filled symbols, n = 8 mice). The incidences of both groups were 100% after day 11. Individual arthritic paws were evaluated for the severity of inflammation, and a combined clinical score was recorded (mean ± SEM, p < 0.01). Results are representative of four similar independent experiments. b, Severe infiltration found in the joints of challenged Lta–/– mice. Peripheral joints of B6 WT and Lta–/– mice following secondary immunization were fixed in 10% buffered formalin and paraffin mounted. Sections (4–5 µm) were stained by H&E and analyzed. Representative sections are shown. c, CD4+ T cells from C57BL/6 WT and Lta–/– mice were purified 10 days after the secondary CII immunization, and cocultured with irradiated normal congenic splenocytes in the presence of denatured chicken CII for 5 days. Each well contained 4 x 105 T cells and 1 x 106 irradiated splenic APC. [3H]thymidine was added 16 h before cell harvest. Average cpm values ± SD of triplicate wells were plotted after being divided by 103. Representative of two experiments. d, Cell culture supernatants from triplicate were collected and pooled together at 72 h, and IFN-{gamma} concentration was analyzed by CBA kit. Data represent the IFN-{gamma} concentration in 50 µg of CII-stimulated cell culture. e, CD4+ T cells from C57BL/6 WT and in Lta–/– mice were purified 10 days after the primary KLH immunization and cocultured with irradiated normal congenic splenocytes in the presence of denatured KLH for 5 days. Each well contained 4 x 105 T cells and 1 x 106 irradiated splenic APC. [3H]thymidine was added 16 h before cell harvest. Average cpm values ± SD of triplicate wells. Representative of four independent experiments.

 
To confirm that CII-responsive autoreactive T cells in Lta–/– mice play an integral role in the inexorable progression of CIA in Lta–/– mice, we analyzed CII-specific T cell responses. CD4+ T cells were purified from WT and Lta–/– mice 10 days after secondary immunization, before the appearance of clinical symptoms in vivo. These purified CD4+ cells were challenged in vitro with standardized irradiated WT splenic APCs titrated with the appropriate CII Ag. Thymidine incorporation assays demonstrated that, whereas WT CD4+ T cells remained firmly unresponsive to CII challenge, CD4+ T cells from Lta–/– mice responded with robust proliferation. (Fig. 6c) Moreover, activation of CD4+ T cells from Lta–/– mice led to their efficient maturation into effector cells, as IFN-{gamma}, the prototypic effector cytokine in CIA pathogenesis, also was significantly increased in Lta–/– cell cultures relative to WT (Fig. 6d). In contrast with the self-Ag CII, immunization with the exogenous Ag KLH resulted in robust in vitro CD4+ T cell responses from WT mice, but only weak response in Lta–/– mice (Fig. 6e), suggesting that the excessive inflammatory response to CII seen in Lta–/– mice is not due to a global T cell dysregulation. Rather, these findings argue that the susceptibility of Lta–/– mice to CIA is the result of a failure of T cell tolerance; that rather than the abortive response seen in WT T cells, Lta–/– T cells improperly tolerized to CII actively participate in the autoimmune destruction of joint structures.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Appreciation of AIRE’s role in promoting the ectopic expression of a subset of peripherally restricted Ags in the thymus provided a crucial insight into how central tolerance covers peripherally restricted Ags (1). Our recent demonstration that AIRE and AIRE-dependent peripherally restricted Ags are absent in Lta–/– and Ltbr–/– thymi defined LT’s role in directing this machinery (5). Another study has shown that, although mTECs in Ltbr–/– thymi appear reduced by anti-Ulex europaeus agglutinin staining, they are unchanged by other markers for mTECs (5, 7, 8, 9). Recent gene array analysis of mouse MECs found numerous tissue-restricted genes up-regulated in mature mTECs independent of AIRE. Most, but not all, of these genes are induced in functionally mature CD80high mTECs (16, 17). Given the focused targeting of endocrine organs in APECED and the limited reduction in expression of tissue-specific Ags in the Aire–/– thymus, we sought to determine whether AIRE-independent pathways exist for the remainder of peripheral Ags for autoimmune diseases that are unrelated to AIRE. In this study, we find that while ectopic expression of CII is AIRE independent, it is nevertheless under LT control. The significant reduction of ectopic CII expression in both Lta–/– and Ltbr–/– thymi and isolated mTECs, and the rapid response of thymi to in vivo agonist LTbetaR Ab stimulation, suggest that LT acts on mTECs directly. It remains to be determined whether the absence of LT signaling could impair the proper function or organization of a subset of mTECs. Very little is known about the signals that permit AIRE access to particular peripheral Ags, and even less is known about AIRE-independent pathways. Given the prominent polyendocrinopathy seen in APECED patients and Aire–/– mice, it is interesting to speculate that as AIRE controls endocrine system Ags, other pathways may similarly direct peripheral Ags that are grouped, and restricted along developmental lines. Indeed, our finding that ectopic CII and AIRE expression do not colocalize, coupled with data from others that mTECs from AIRE deficient mice express only a limited number of Ags (16, 17), it is possible that AIRE and AIRE-independent pathways are mutually exclusive in the individual mTECs.

CII is a major constituent protein of cartilage in diarthrodial joints, the predominant site of inflammation in RA, and is targeted specifically in the autoimmune response of RA patients (24, 25). The notion that central tolerance to arithitogenic Ags preempts the initiation of autoimmune destruction in the CIA model is somewhat overlooked, mostly from conceptual misgivings of how these Ags can come to be presented in the thymus. The uncovering of AIRE’s role in the ectopic thymic expression of peripheral Ags, and our findings relating to AIRE-independent pathways for ectopic expression of CII and likely others, remove this inhibition. Suggestive work by Lamhamedi-Cherradi et al. (26) in TRAIL–/– mice found an association between defects in thymocyte apoptosis and the susceptibility of C57BL/6 mice to CIA, although their system did not permit isolation of the TRAIL–/– defect exclusively to the thymus. We determined not only that CII was expressed in murine mTEC in a LT-dependent fashion, but also that transplantation of Ltbr–/– thymi into resistant hosts was sufficient to break tolerance, demonstrating the crucial protective contribution of central tolerance for autoimmune arthritis. Our findings are mirrored by recent studies demonstrating human mTEC expression of a highly diverse selection of tissue-specific genes, including CII (18). Our study raises the possibility that the breakdown of central tolerance for CII may be critical for the development of human RA. It’s noteworthy that both CII and CXI comprise the same chain, {alpha}1(II). Although CII is composed of three identical {alpha}1(II) chains, CXI has additional two chains of {alpha}1(XI) and {alpha}2(XI). Whether these additional chains for CXI also are involved in LT-mediated tolerance and arthritis remains to be determined.

Although we have found that Ltbr–/– mice are more susceptible to CIA, others have described LTbetaR-Ig fusion protein as an effective inhibitor of CIA development, arresting even established disease (23). There are several possible explanations. First, the LT pathway could play different, even opposing roles in central tolerance vs peripheral inflammation. The thymic defect in the absence of LT overcomes the absence of LT in the peripheral environment. For example, CII-specific T cell proliferation and IFN-{gamma} secretion was significantly higher in primed Lta–/– mice than that in WT mice in our study. Earlier studies (23) with LTbetaR-Ig blockade had an isolated anti-inflammatory response peripherally, without affecting central tolerance, and thus did not result in higher CII-specific T cell proliferation and IFN-{gamma} secretion. Second, different murine strains were used. DBA is a CIA-susceptible strain, meaning that it may already harbor defects in central or peripheral CII-tolerance. Thus, LTbetaR-Ig blockade in DBA models probably could not further exacerbate the central defect but would be active only in inhibiting peripheral inflammation. In contrast, B6 is a resistant strain, susceptible to CIA only with a defect in central tolerance as the result of LT deficiency. In the B6 background, LT deficiency affects both central tolerance and in peripheral inflammation, with the central defect predominant. Third, the effect of genetic LT deficiency could be more comprehensive than those seen with LTbetaR-Ig blockade. LT deficiency during development permits appearance of compensatory mechanisms, such as increased TNF expression in place of LT. Short-term LTbetaR-Ig blockade may not lead to such compensatory effects. Fourth, because of the promiscuous nature of TNF ligand/receptor pairings, LTbetaR-Ig also blocks the costimulatory function of LIGHT to HVEM, leading to decreased cell activation in treated mice. Lta–/– does not affect LIGHT or HVEM signaling.

The role of AIRE in establishing self-Ags specific central tolerance is not limited to transcriptional control of thymic expression of peripheral Ags. A recent report by Kuroda et al. (27) showed that, although thymic fodrin expression is normal in Aire–/– mice, they nevertheless go on to develop autoimmunity against fodrin. These data suggest that another mechanism of AIRE, in addition to thymic transcriptional control, is responsible for tolerance to fodrin. In contrast with the anti-fodrin immunity in Aire–/– mice, we found neither perturbation of thymic expression of CII nor autoimmunity to CII. This additional mechanism is thus unlikely to be involved in CII tolerance.

Although clonal deletion has occupied the center of attention as the mechanism of central tolerance mediated by ectopically expressed peripheral Ags, this may not be the full story (28). It has been demonstrated that resistant MHC-II, such as Ebetad, Ebetas, and I-Ab, not only resist CIA in their native hosts, but also will actively protect genetically susceptible hosts when transgenically expressed (29, 30, 31). This protection is difficult to be explained by clonal deletion alone, because the endogenous autoreactive repertoire would be not be deleted by the resistant MHC-II. Regulatory cells could provide a more elegant explanation. Ectopic expression of CII by mTECs, presented on resistant MHC-II, may instead facilitate efficient production of CII-specific regulatory T cells. Coexpression of susceptible and resistant MHCs on all APCs permits these regulatory T cells to restrain even endogenous autoreactive clones raised on susceptible MHCs, a finding revealed only in systems using endogenous self-Ag and a polyclonal T cell repertoire. It remains to be determined whether and how peripheral tolerance may play a role in the limiting autoimmune destruction in both LT and AIRE deficiency.

The revelation of an AIRE-independent pathway for controlling different peripheral Ags in the thymus opens new avenues for exploration of the complex mechanisms of negative selection beyond AIRE. The ability of LT to induce ectopic expression of peripherally restricted Ags, and the loss of AIRE-dependent and independent Ags in Lta–/– and Ltbr–/–, permit dissection of the LT-AIRE pathway, uncover the contributions of other mechanism of tolerance in the context of impaired negative selection, and the identification of possible AIRE family members. Understanding of the regulation of AIRE and parallel pathways responsible for central tolerance may offer novel diagnostic possibilities and therapies in the treatment of autoimmune disease.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This research was supported by National Institutes of Health Grants HD062026, DK58897, and CA09296-01 (to Y.-X.F.), RO1 AI051532 (to S.H.), and RO1 AG17149 (to B.Z.). Back

2 R.K.C. and M.Z. contributed equally to this study. Back

3 Y-X.F. and B.Z. share senior authorship. Back

4 Address correspondence and reprint requests to Dr. Yang-Xin Fu, Department of Pathology, 5841 South Maryland Avenue, Chicago, IL 60637. E-mail address: yfu{at}uchicago.edu Back

5 Abbreviations used in this paper: AIRE, autoimmune regulator; CII, type II collagen; TEC, thymic epithelial cell; mTEC, medullary TEC; MEC, medullary epithelial cell; LT, lymphotoxin; APECED, autoimmune polyenocrinopathy-candidiasis-ectodermal dystrophy; CIA, collagen-induced arthritis; RA, rheumatoid arthritis; MHC-II, MHC type II; K14, keratin-14; WT, wild type. Back

Received for publication December 2, 2005. Accepted for publication April 12, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Anderson, M. S., E. S. Venanzi, L. Klein, Z. Chen, S. P. Berzins, S. J. Turley, H. von Boehmer, R. Bronson, A. Dierich, C. Benoist, D. Mathis. 2002. Projection of an immunological self shadow within the thymus by the aire protein. Science 298: 1395-1401. [Abstract/Free Full Text]
  2. Ahonen, P.. 1985. Autoimmune polyendocrinopathy–candidosis–ectodermal dystrophy (APECED): autosomal recessive inheritance. Clin. Genet. 27: 535-542. [Medline]
  3. Bjorses, P., J. Aaltonen, N. Horelli-Kuitunen, M. L. Yaspo, L. Peltonen. 1998. Gene defect behind APECED: a new clue to autoimmunity. Hum. Mol. Genet. 7: 1547-1553. [Abstract/Free Full Text]
  4. Peterson, P., K. Nagamine, H. Scott, M. Heino, J. Kudoh, N. Shimizu, S. E. Antonarakis, K. J. Krohn. 1998. APECED: a monogenic autoimmune disease providing new clues to self-tolerance. Immunol. Today 19: 384-386. [Medline]
  5. Chin, R. K., J. C. Lo, O. Kim, S. E. Blink, P. A. Christiansen, P. Peterson, Y. Wang, C. Ware, Y. X. Fu. 2003. Lymphotoxin pathway directs thymic Aire expression. Nat. Immunol. 4: 1121-1127. [Medline]
  6. Browning, J. L., I. D. Sizing, P. Lawton, P. R. Bourdon, P. D. Rennert, G. R. Majeau, C. M. Ambrose, C. Hession, K. Miatkowski, D. A. Griffiths, et al 1997. Characterization of lymphotoxin-{alpha}beta complexes on the surface of mouse lymphocytes. J. Immunol. 159: 3288-3298. [Abstract]
  7. Boehm, T., S. Scheu, K. Pfeffer, C. C. Bleul. 2003. Thymic medullary epithelial cell differentiation, thymocyte emigration, and the control of autoimmunity require lympho-epithelial cross talk via LTbetaR. J. Exp. Med. 198: 757-769. [Abstract/Free Full Text]
  8. Burkly, L., C. Hession, L. Ogata, C. Reilly, L. A. Marconi, D. Olson, R. Tizard, R. Cate, D. Lo. 1995. Expression of relB is required for the development of thymic medulla and dendritic cells. Nature 373: 531-536. [Medline]
  9. Kajiura, F., S. Sun, T. Nomura, K. Izumi, T. Ueno, Y. Bando, N. Kuroda, H. Han, Y. Li, A. Matsushima, et al 2004. NF-{kappa}B-inducing kinase establishes self-tolerance in a thymic stroma-dependent manner. J. Immunol. 172: 2067-2075. [Abstract/Free Full Text]
  10. Myers, L. K., E. F. Rosloniec, M. A. Cremer, A. H. Kang. 1997. Collagen-induced arthritis, an animal model of autoimmunity. Life Sci. 61: 1861-1878. [Medline]
  11. Luross, J. A., N. A. Williams. 2001. The genetic and immunopathological processes underlying collagen-induced arthritis. Immunology 103: 407-416. [Medline]
  12. Ranges, G. E., S. Sriram, S. M. Cooper. 1985. Prevention of type II collagen-induced arthritis by in vivo treatment with anti-L3T4. J. Exp. Med. 162: 1105-1110. [Abstract/Free Full Text]
  13. Chiocchia, G., M. C. Boissier, C. Fournier. 1991. Therapy against murine collagen-induced arthritis with T cell receptor V beta-specific antibodies. Eur. J. Immunol. 21: 2899-2905. [Medline]
  14. Yoshino, S., L. G. Cleland, G. Mayrhofer. 1991. Treatment of collagen-induced arthritis in rats with a monoclonal antibody against the {alpha}beta T cell antigen receptor. Arthritis Rheum. 34: 1039-1047. [Medline]
  15. Wooley, P. H., H. S. Luthra, W. P. Lafuse, A. Huse, J. M. Stuart, C. S. David. 1985. Type II collagen-induced arthritis in mice. III. Suppression of arthritis by using monoclonal and polyclonal anti-Ia antisera. J. Immunol. 134: 2366-2374. [Abstract]
  16. Derbinski, J., J. Gabler, B. Brors, S. Tierling, S. Jonnakuty, M. Hergenhahn, L. Peltonen, J. Walter, B. Kyewski. 2005. Promiscuous gene expression in thymic epithelial cells is regulated at multiple levels. J. Exp. Med. 202: 33-45. [Abstract/Free Full Text]
  17. Johnnidis, J. B., E. S. Venanzi, D. J. Taxman, J. P. Ting, C. O. Benoist, D. J. Mathis. 2005. Chromosomal clustering of genes controlled by the aire transcription factor. Proc. Natl. Acad. Sci. USA 102: 7233-7238. [Abstract/Free Full Text]
  18. Gotter, J., B. Brors, M. Hergenhahn, B. Kyewski. 2004. Medullary epithelial cells of the human thymus express a highly diverse selection of tissue-specific genes colocalized in chromosomal clusters. J. Exp. Med. 199: 155-166. [Abstract/Free Full Text]
  19. Han, S., S. Cao, R. Bheekha-Escura, B. Zheng. 2001. Germinal center reaction in the joints of mice with collagen-induced arthritis: an animal model of lymphocyte activation and differentiation in arthritis joints. Arthritis Rheum. 44: 1438-1443. [Medline]
  20. Klug, D. B., C. Carter, I. B. Gimenez-Conti, E. R. Richie. 2002. Cutting edge: thymocyte-independent and thymocyte-dependent phases of epithelial patterning in the fetal thymus. J. Immunol. 169: 2842-2845. [Abstract/Free Full Text]
  21. Holmdahl, R., L. Jansson, A. Larsson, R. Jonsson. 1990. Arthritis in DBA/1 mice induced with passively transferred type II collagen immune serum. Immunohistopathology and serum levels of anti-type II collagen auto-antibodies. Scand. J. Immunol. 31: 147-157. [Medline]
  22. Stuart, J. M., F. J. Dixon. 1983. Serum transfer of collagen-induced arthritis in mice. J. Exp. Med. 158: 378-392. [Abstract/Free Full Text]
  23. Fava, R. A., E. Notidis, J. Hunt, V. Szanya, N. Ratcliffe, A. Ngam-Ek, A. R. De Fougerolles, A. Sprague, J. L. Browning. 2003. A role for the lymphotoxin/LIGHT axis in the pathogenesis of murine collagen-induced arthritis. J. Immunol. 171: 115-126. [Abstract/Free Full Text]
  24. Londei, M., C. M. Savill, A. Verhoef, F. Brennan, Z. A. Leech, V. Duance, R. N. Maini, M. Feldmann. 1989. Persistence of collagen type II-specific T-cell clones in the synovial membrane of a patient with rheumatoid arthritis. Proc. Natl. Acad. Sci. USA 86: 636-640. [Abstract/Free Full Text]
  25. Terato, K., Y. Shimozuru, K. Katayama, Y. Takemitsu, I. Yamashita, M. Miyatsu, K. Fujii, M. Sagara, S. Kobayashi, M. Goto, et al 1990. Specificity of antibodies to type II collagen in rheumatoid arthritis. Arthritis Rheum 33: 1493-1500. [Medline]
  26. Lamhamedi-Cherradi, S. E., S. J. Zheng, K. A. Maguschak, J. Peschon, Y. H. Chen. 2003. Defective thymocyte apoptosis and accelerated autoimmune diseases in TRAIL–/– mice. Nat. Immunol. 4: 255-260. [Medline]
  27. Kuroda, N., T. Mitani, N. Takeda, N. Ishimaru, R. Arakaki, Y. Hayashi, Y. Bando, K. Izumi, T. Takahashi, T. Nomura, et al 2005. Development of autoimmunity against transcriptionally unrepressed target antigen in the thymus of Aire-deficient mice. J. Immunol. 174: 1862-1870. [Abstract/Free Full Text]
  28. Liston, A., S. Lesage, J. Wilson, L. Peltonen, C. C. Goodnow. 2003. Aire regulates negative selection of organ-specific T cells. Nat. Immunol. 4: 350-354. [Medline]
  29. Gonzalez-Gay, M. A., E. Zanelli, S. D. Khare, C. J. Krco, P. Zhou, H. Inoko, M. M. Griffiths, H. S. Luthra, C. S. David. 1996. Human leukocyte antigen-DRB1*1502 (DR2Dw12) transgene reduces incidence and severity of arthritis in mice. Hum. Immunol. 50: 54-60. [Medline]
  30. Gonzalez-Gay, M. A., G. H. Nabozny, M. J. Bull, E. Zanelli, J. Douhan, III, M. M. Griffiths, L. H. Glimcher, H. S. Luthra, C. S. David. 1994. Protective role of major histocompatibility complex class II Ebd transgene on collagen-induced arthritis. J. Exp. Med. 180: 1559-1564. [Abstract/Free Full Text]
  31. Mitchison, N. A., M. C. Brunner. 1995. Association of H2Ab with resistance to collagen-induced arthritis in H2-recombinant mouse strains: an allele associated with reduction of several apparently unrelated responses. Immunogenetics 41: 239-245. [Medline]

Related articles in The JI:

IN THIS ISSUE

The JI 2006 177: 1-2. [Full Text]  



This article has been cited by other articles:


Home page
J. Histochem. Cytochem.Home page
C. Odaka
Localization of Mesenchymal Cells in Adult Mouse Thymus: Their Abnormal Distribution in Mice With Disorganization of Thymic Medullary Epithelium
J. Histochem. Cytochem., April 1, 2009; 57(4): 373 - 382.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Pierer, A. Schulz, M. Rossol, E. Kendzia, D. Kyburz, H. Haentzschel, C. Baerwald, and U. Wagner
Herpesvirus Entry Mediator-Ig Treatment during Immunization Aggravates Rheumatoid Arthritis in the Collagen-Induced Arthritis Model
J. Immunol., March 1, 2009; 182(5): 3139 - 3145.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. C. Martins, T. Boehm, and C. C. Bleul
Lt{beta}r Signaling Does Not Regulate Aire-Dependent Transcripts in Medullary Thymic Epithelial Cells
J. Immunol., July 1, 2008; 181(1): 400 - 407.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Seach, T. Ueno, A. L. Fletcher, T. Lowen, M. Mattesich, C. R. Engwerda, H. S. Scott, C. F. Ware, A. P. Chidgey, D. H. D. Gray, et al.
The Lymphotoxin Pathway Regulates Aire-Independent Expression of Ectopic Genes and Chemokines in Thymic Stromal Cells
J. Immunol., April 15, 2008; 180(8): 5384 - 5392.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Zhu, R. K. Chin, A. V. Tumanov, X. Liu, and Y.-X. Fu
Lymphotoxin Receptor Is Required for the Migration and Selection of Autoreactive T Cells in Thymic Medulla
J. Immunol., December 15, 2007; 179(12): 8069 - 8075.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. S. Venanzi, D. H. D. Gray, C. Benoist, and D. Mathis
Lymphotoxin Pathway and Aire Influences on Thymic Medullary Epithelial Cells Are Unconnected
J. Immunol., November 1, 2007; 179(9): 5693 - 5700.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chin, R. K.
Right arrow Articles by Fu, Y.-X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chin, R. K.
Right arrow Articles by Fu, Y.-X.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
Medline Plus Health Information
*Joint Disorders


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS