The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, L.
Right arrow Articles by Ransohoff, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, L.
Right arrow Articles by Ransohoff, R. M.
The Journal of Immunology, 2006, 177: 17-21.
Copyright © 2006 by The American Association of Immunologists


CUTTING EDGE

Cutting Edge: The Silent Chemokine Receptor D6 Is Required for Generating T Cell Responses That Mediate Experimental Autoimmune Encephalomyelitis1

LiPing Liu*, Gerard J. Graham{dagger}, Anita Damodaran*,{ddagger}, Taofang Hu*, Sergio A. Lira§, Margaret Sasse*, Claudia Canasto-Chibuque§, Donald N. Cook and Richard M. Ransohoff2,*

* Neuroinflammation Research Center, Department of Neurosciences, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 44195; {dagger} Division of Immunology, Infection and Inflammation, University of Glasgow, Glasgow, United Kingdom; {ddagger} University of Southern California, Los Angeles, CA 90089; § Immunobiology Center, Mount Sinai School of Medicine, New York, NY 10029; and National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
D6, a promiscuous nonsignaling chemokine binding molecule expressed on the lymphatic endothelium, internalizes and degrades CC chemokines, and D6–/– mice demonstrated increased cutaneous inflammation following topical phorbol ester or CFA injection. We report that D6–/– mice were unexpectedly resistant to the induction of experimental autoimmune encephalomyelitis due to impaired encephalitogenic responses. Following induction with myelin oligodendroglial glycoprotein (MOG) peptide 35–55 in CFA, D6–/– mice showed reduced spinal cord inflammation and demyelination with lower incidence and severity of experimental autoimmune encephalomyelitis attacks as compared with D6+/+ littermates. In adoptive transfer studies, MOG-primed D6+/– T cells equally mediated disease in D6+/+ or D6–/– mice, whereas cells from D6–/– mice transferred disease poorly to D6+/– recipients. Lymph node cells from MOG-primed D6–/– mice showed weak proliferative responses and made reduced IFN-{gamma} but normal IL-5. CD11c+ dendritic cells accumulated abnormally in cutaneous immunization sites of D6–/– mice. Surprisingly, D6, a "silent" chemokine receptor, supports immune response generation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
Conventional chemokine receptors are seven-transmembrane single polypeptide chains whose intracellular domains couple to heterotrimeric G proteins to mediate agonist responses and to beta-arrestins for internalization. These receptors are required for the chemotactic and activating responses of leukocytes to the chemokine ligands. In addition to classical receptors, there are at least three chemokine-binding molecules that have moderate to high homology to classical receptors but lack G protein coupling motifs and are incapable of eliciting chemotactic or activating responses to a ligand (1). Two of these "silent" receptors, D6 and the Duffy Ag receptor for chemokines (DARC),3 have been characterized in some detail (1). The biological functions of DARC, which is expressed on erythrocytes and postcapillary venules, seem to be 2-fold: to transfer chemokines from parenchymal sites of synthesis across endothelial barriers and to provide a binding "sink" for chemokines in the circulation. Based on in vitro observations, D6 was proposed as a chemokine-scavenging receptor, functioning to aid in the resolution of inflammatory reactions. D6 is selectively expressed on the lymphatic endothelium. Upon transfection into lymphatic endothelial cells or human embryonic kidney cells (2, 3), D6 shuttles rapidly between plasma membrane and early endosomes independently of ligand engagement; consistent with these findings, D6 associated constitutively with beta-arrestins (4). After binding its ligands, which include >12 inflammatory CC chemokines, D6 delivers these components to sites of intracellular degradation. As predicted by the scavenger receptor paradigm for D6, mice that lacked D6 exhibited markedly increased cutaneous inflammatory reactions in two distinct models (5, 6). Following phorbol ester painting, D6–/– mice showed remarkably sustained persistence of its inflammatory chemokine ligands along with psoriasiform skin changes that included skin thickening, hyperkeratosis, marked inflammatory infiltrates, and angiogenesis (5). The pathology was reversed by blocking chemokine availability with neutralizing Abs or by depleting T cells or abrogating TNF signaling, indicating its inflammatory and chemokine-dependent nature. Upon s.c. challenge with CFA, the D6–/– mice showed many of these features, including increased inflammatory infiltrates, but without hyperkeratosis (6). D6–/– mice that received CFA showed increased amounts of CC chemokines and increased cellularity in the draining lymph nodes, suggesting an enhanced flux of chemokines across the lymphatic vessels. In this regard, chemokines are transported from local inflammatory sites to draining lymph nodes and mediate the recruitment of circulating monocytes across high endothelial venules (7). Although chemokines clearly orchestrate this "remote control" process, its physiological importance in establishing adaptive immune responses remains incompletely defined.

In the current study we addressed two questions. 1) Would enhanced inflammation in the skin of D6–/– mice affect the induction of experimental autoimmune encephalomyelitis (EAE) by s.c. immunization? 2) Would reduced potential clearance of chemokines from the inflamed CNS worsen the severity of EAE? Surprisingly, we found that D6–/– mice were relatively resistant to the induction of EAE. These results widen the functional spectrum of nonsignaling chemokine receptors and suggest that the orchestrated delivery of chemokines to draining lymph nodes or their clearance from immunization sites may play an important role in the generation of immune responses.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
Mice

The generation and genotyping of D6-deficient mice has been described previously (5). D6-deficient mice had been backcrossed to C57BL/6J (B6) mice for 12 generations, and D6+/– mice were intercrossed to obtain D6+/+, D6+/–, and D6–/– mice. In all experiments, age- and sex-matched littermate cohorts at 8–10 wk of age were used. All mice were housed under pathogen-free conditions in the animal facility at the Cleveland Clinic Foundation, Cleveland, OH. All protocols for animal research met the requirements of the Animal Research Committee of the Cleveland Clinic Foundation and were in compliance with the Public Health Service policy on humane care and use of laboratory animals.

Induction and analysis of EAE

Active immunization. Induction of EAE was performed as previously described (8). Briefly, mice were s.c. injected at two sites with 100 µg of rat myelin oligodendroglial glycoprotein (MOG) peptide 35–55 (MEVGWYRSPFSRVVHLYRNGK; >95% purity) (Bio-Synthesis) emulsified in CFA containing 400 µg of Mycobacterium tuberculosis (Difco Laboratories). On the same day (day 0) and on day 2 postimmunization (p.i.), mice were i.v. injected with 200 ng of pertussis toxin (Sigma-Aldrich). All mice were weighed, examined, and graded daily for neurological signs in a blinded manner as follows: 0, no disease; 1, decreased tail tone or slightly clumsy gait; 2, tail atony and moderately clumsy gait and/or poor righting ability; 3, limb weakness; 4, limb paralysis; and 5, moribund state. The day of EAE onset was calculated by adding the first day of clinical signs for individual mice and dividing by the number of mice in the group. The day of peak EAE was calculated by determining the first day of maximum EAE score for individual mice and dividing by the number of mice in the group. Mean maximum score was calculated by adding peak scores of individual mice and dividing by the number of mice. Cumulative EAE score was calculated by adding total EAE scores from onset until day 22 p.i. for individual mice and dividing by the number of mice. Active immunization with MOG35–55 induced monophasic EAE in B6 mice and was followed for 22 days. Animals were euthanized if scores were worse than grade 4.

Adoptive transfer. To prepare encephalitogenic cells for adoptive transfer of EAE, mice were immunized with MOG/CFA in the same fashion as for active EAE. Spleens and lymph nodes were collected 8 days p.i., single cell suspensions were prepared, and RBCs were lysed. Cells (6 x 106 cells/ml) were cultured in RPMI 1640 medium (supplemented with 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 100 IU/ml penicillin/streptomycin, and 2 x 10–5 M 2-ME (Invitrogen Life Technologies)) with MOG35–55 (20 µg/ml) and IL-12 (30 ng/ml) (R&D Systems). Three days after initiation of culture, the cells were harvested, washed in PBS, and injected into recipient mice that were irradiated sublethally (500 rad) within 16 h before cells injection. All mice were weighed, examined, and graded daily after cell transfer (9).

T cell recall responses: proliferation and cytokine production

T cell proliferation assays and quantification of cytokine production were performed as previously described (8). For T cell proliferation, draining lymph node cells from MOG35–55-immunized mice were harvested 8 days p.i., and incubated in 96-well plates (1 x 105 per well) with MOG35–55 or Con A (Sigma-Aldrich) at the indicated concentration or in medium alone. During the final 16 h of a total 72 h in culture, cells were pulsed with 1µCi/well [H]thymidine (Amersham Biosciences); plates were harvested using a Tomtec harvester and analyzed with a 1450 Wallac Microbeta Trilux liquid scintillation and luminescence counter.

For quantification of cytokine production, draining lymph node cells isolated from MOG35–55-immunized D6–/– or D6+/+ mice were incubated (5 x 105 cells/ml) in 24-well plates with MOG35–55 (20 µg/ml). After 48 h, supernatants were collected for cytokine detection. ELISA kits for IFN-{gamma} and IL-5 were obtained from R&D Systems. A standard curve was generated with each assay. All samples were measured in duplicate and diluted if necessary.

Histology and immunohistochemistry

Histological and immunohistochemical analysis of spinal cords at different stages of EAE was done as previously described (8) using rat anti-mouse CD45 mAbs at 1/2000 dilution (clone MCA 1388; Serotec) and rabbit anti-human myelin basic protein (MBP) at 1/4000 dilution (DakoCytomation). Fresh skin tissues from CFA/MOG peptide-injected mice at day 3 or day 8 p.i., both ipsilateral and contralateral to the injection site, were dissected and embedded in OCT on dry ice. Eight-micron sections were prepared and dried overnight at room temperature and stored at –80°C before using. For H&E and immunohistochemical staining, skin tissues sections were air dried for 30 min, fixed in acetone at room temperature for 10 min, rinsed in PBS, incubated with 3% hydrogen peroxide in PBS, blocked with avidin/biotin blocking kits (SP-2001; Vector Laboratories) and by incubation with 10% goat or rabbit serum at room temperature for 30 min, and then incubated at 37°C for 1 h with the following primary Abs at the dilutions indicated: hamster anti-mouse CD3 at 1/100 dilution (145–2c11; R&D Systems); CD11c at 1/100 dilution (HL3; BD Pharmingen); and rat anti-mouse Gr1 at 1/500 dilution (Ly-6G; BD Pharmingen). Tissues were then incubated with the appropriate biotinylated secondary Ab, goat anti-hamster (Jackson ImmunoResearch Laboratories) or rabbit anti-rat (Vector Laboratories), at 1/500 dilution for 30 min at room temperature and then with an avidin/biotin complex kit at 1/1000 dilution (PK-6100; Vector Laboratories). Sections were washed thrice with PBST buffer (PBS with 0.2% Triton X-100) after each incubation step (except for goat serum). All Abs, as well as the avidin/biotin complex, were diluted in 1% BSA in PBST. Sections were developed with 3, 3-diaminobenzidine tetrahydrochloride (SK-4100, Vector Laboratories) with hydrogen peroxide for 5 min at room temperature. Following development with 3, 3-diaminobenzidine tetrahydrochloride, tissues were rinsed in distilled-deionized H2O, counterstained with 50% hematoxylin for 5 s, and then dehydrated and mounted. All slides were visualized by light microscopy (Leica), digitized under a x2.5, x5, or x10 objective, and captured with a 3-CCD color video camera interfaced with a MagnaFIRE image analysis system (Optronics).

RT-PCR analysis

RNA was extracted using TRIzol reagent (Invitrogen Life Technologies) according to the manufacturer’s instructions. Reverse transcription was performed using SuperScript first strand synthesis system for RT-PCR (12371-019; Invitrogen Life Technologies) according to the manufacturer’s instructions. To measure the expression of D6 using RT-PCR, the following three different pairs of primers were used (from 5' to 3'; antisense to sense): D6-1, CACTGCCTCTCACCACCGTC and GGACAGAGATGGCCAGGGATG (expected size of PCR product, 509 bp); D6-2, AGCTTTACCTGCTGAACCTGG and AAGAAGAAGATCATGGCCAAGAGTG (441 bp) (5); and D6-3, GGAAGAGACAGTAATGAGTAAGGC and GTGACAGAGAGCCTGGCCTTC (374 bp) (10). The housekeeping gene GAPDH primers GGTGGAGGTCGGAGTCAACG and CAAAGTTGTCATGGATGACC (~500 bp) were used as a positive control.

Statistical analyses

The Student t test was used for the comparisons of disease severity, day of onset, day of peak, mean maximum score, cumulative EAE score, levels of T cell proliferation, and cytokine expression in comparisons between D6+/+ and D6–/– mice. A {chi}2 test was used for the comparisons of disease incidence or mortality between D6+/+ and D6–/– mice. p < 0.05 was considered significant.


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
D6–/–, D6+/+, and D6+/– mice were generated for these experiments and studied in gender-matched littermate cohorts to minimize effects of background genes. We conducted three separate immunizations to induce EAE, which exhibited typical onset and course in D6+/+ mice, with most mice developing hind limb paralysis. We observed greatly reduced and significantly reduced EAE severity in D6–/– mice by analysis of the pooled data (Fig. 1, A and B). The incidence of disease was also somewhat reduced in D6–/– mice; those failing to exhibit signs of disease in the 22-day period of observation were removed from analysis of disease score. D6–/– mice consistently showed reduced peak severity of disease along with improved resolution of the EAE attack, as compared with their wild-type littermates. The day of EAE onset and the day of peak severity were equivalent in D6–/– and D6+/+ mice (Fig. 1B), arguing against altered kinetics of disease as an explanation for these findings. To evaluate the pathological basis for these neurological signs, we examined spinal cord histology by immunohistochemistry using anti-CD45 Abs to monitor inflammation and anti-MBP Abs to reveal demyelination (Fig. 1C) (11). We found that inflammation and demyelination mirrored neurobehavioral severity, being uniformly more extensive in wild-type mice with EAE than in D6–/– animals.


Figure 1
View larger version (50K):
[in this window]
[in a new window]
 
FIGURE 1. D6-deficient mice develop milder EAE with decreased infiltrates and demyelination. A, Effect of D6 gene disruption on the course of MOG35–55 induced EAE. D6+/+ ({blacksquare}; n = 15) and D6–/– ({diamond}; n = 17) mice were immunized with MOG35–55. Results are expressed as mean EAE scores pooled from three independent experiments. *, p < 0.05 from day 14 to day 22. B, Summary of MOG35–55 induced EAE in D6+/+ and D6–/– mice. C, CNS pathology of D6–/– and D6+/+mice with EAE. Inflammation in axial sections of spinal cords in D6+/+ (a) and D6–/– (b) mice was evaluated by CD45 staining. Serial sections of the spinal cords from D6+/+ (c) and D6–/– (d) mice were analyzed with anti-MBP Abs, and high power views of regions corresponding to boxed areas in a and b show reduced demyelination in D6–/– mice. Images are representative of four individual immunohistochemical analyses of D6+/+ and D6–/– mice. Arrows show demyelination in c. Bars, 500 µm (in a and b) and 50 µm (in c and d).

 
We addressed whether mice lacking D6 could express an encephalitogenic response to cells from D6-sufficient MOG-primed mice by using D6–/– or D6+/+ mice as recipients of encephalitogenic cells from D6+/– mice. D6–/– and D6+/+ mice exhibited equivalent severity of disease (Fig. 2A), demonstrating that the presence of D6 was dispensable for expression of EAE in response to encephalitogenic cells. This result also argued that D6 was not required for the clearance of inflammatory CC chemokines from the CNSs of mice with this model disorder. Consistent with this interpretation, we used semiquantitative RT-PCR to show that D6 mRNA was expressed at low levels in the spinal cords of healthy mice without change in expression levels at the peak of EAE (data not shown).


Figure 2
View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 2. D6 plays a role in the initiation phase but not in the effector phase of EAE. A, Encephalitogenic cells prepared from D6+/– were injected into sublethally irradiated D6+/+ and D6–/– mice. Data are shown as group mean EAE scores (n = 4 per group) that are representative of two independent experiments. There is no significant difference between these two groups. B, Encephalitogenic cells prepared from D6+/+ and D6–/– mice were injected into sublethally irradiated D6+/– mice. Data are shown as group mean EAE scores (n = 4 per group). *, p < 0.05. 

 
We therefore turned our attention to determining whether the priming of encephalitogenic T cells might be impaired in D6–/– mice. This issue was addressed in reciprocal adoptive transfers by using cells from D6–/– or D6+/+ mice to induce disease in D6+/– recipients, with findings that closely resembled those in active immunizations; cells from MOG-immunized D6–/– mice induced EAE poorly in D6+/– animals as compared with those from D6+/+ littermates (Fig. 2B). Together, these findings suggested impaired T cell priming in D6–/– mice. To extend these findings, we evaluated recall proliferation and cytokine production by draining lymph node cells from D6-deficient and wild-type mice, following immunization with MOG35–55 peptides and CFA. Cells from D6–/– mice proliferated well after incubation with mitogen (Fig. 3A) but weakly in response to Ag (Fig. 3B). Furthermore, cells from D6–/– mice produced significantly less IFN-{gamma} than cells from wild-type mice (Fig. 3C) but equal amounts of IL-5 (Fig. 3D). These findings indicated that D6–/– mice were impaired in the generation of MOG-specific T cell responses. There was no evidence that the failure to generate robust type 1 cytokine production was caused by a shift to a type 2 response. It was not clear whether the suboptimal response to MOG immunization in D6–/– mice was attributable to a primary T cell defect or to impaired Ag presentation. The status of D6 as a nonsignaling receptor favored the interpretation that the absence of D6 affected the microenvironment required for efficient Ag presentation rather than causing a cell-intrinsic T cell defect.


Figure 3
View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 3. Development of Th1-type response is impaired in D6–/– mice. A and B, A decreased proliferative response toward MOG35–55 restimulation, but not Con A stimulation, was observed in T cells from D6–/– mice compared with D6+/+ mice. Draining lymph node cells were isolated from D6+/+ ({blacksquare}) and D6–/– ({diamond}) mice restimulated with the indicated concentrations of MOG35–55 (B) or ConA (A) for 72 h and pulsed with 1µCi of [3H]thymidine for the last 16 h. Each curve (±SE) represents the mean cpm of three wells. Data shown were from one mouse per group and are representative of two independent experiments with four mice in each group. *, p < 0.05 compared with cells from D6+/+ mice in B. C and D, Cytokine production by D6+/+ and D6–/– T cells upon MOG35–55 restimulation in vitro. Draining lymph node cells were isolated from D6+/+ (black bars) and D6–/– (gray bars) mice and restimulated with 20 µg/ml MOG 35–55 in vitro. Supernatants were harvested after 48 h and analyzed by ELISA for IFN-{gamma} (C) and IL-5 (D). Data are shown as concentration of cytokine in supernatants pooled from 12 mice per group from three independent experiments. **, p < 0.05 compared with cells from D6+/+ mice in C. There was no significant difference (P= NS) in D

 
We previously showed altered and enhanced inflammation with necrotic foci, leukocyte infiltrates, and angiogenesis 3 days after the injection of CFA in D6–/– mice (6). It was of interest to determine whether s.c. injection of CFA with MOG peptide elicited a similar reaction. Morphology of the skin of D6–/– and D6+/+ littermates was similar contralateral to the injection (data not shown), but D6–/– mice showed increased inflammatory infiltrates, augmented vascularity, and necrotic foci after injection of CFA with MOG peptide (Fig. 4, A and B), using the protocol for induction of EAE. We used immunohistochemistry to characterize the cutaneous inflammatory infiltrates, with Abs to CD11c for dendritic cells (DCs), Abs to CD3 for T cells, and Abs to Gr1 for myeloid cells. At day 3 p.i., accumulations of CD3+ lymphocytes and Gr1+ myeloid cells were equivalent in the skin of D6+/+ and D6–/– mice (Fig. 4, E–H). Strikingly, however, CD11c+ DCs formed large dermal aggregates in D6–/– but not D6+/+ skin (Fig. 4, C and D). We asked whether aggregates of DCs in the skin of D6–/– mice might result from altered migration kinetics out of inflamed skin,. We found that these dermal DC aggregates persisted at day 8 p.i., a time point at which we also observed increased CD3 and Gr1 immunoreactive cells in D6–/– cutaneous immunization sites (data not shown). Contralateral to the immunization site, there were no differences between D6+/+ and D6–/– mice in the distribution of CD11c+, CD3+, or Gr1+ cells (data not shown). Because the principal site of D6 expression is on the lymphatic endothelium, these results suggested that D6–/– mice failed to respond to s.c. immunization because DCs were abnormally retained in the inflamed skin and did not arrive at local lymph nodes.


Figure 4
View larger version (97K):
[in this window]
[in a new window]
 
FIGURE 4. Characterization of the cellular infiltrate in the inflamed skin of D6+/+ and D6–/– mice on day 3 p.i. Serial sections were stained with H&E (A and B) or immunostained with Abs to CD11c (C and D), CD3 (E and F), or Gr1 (G and H) from ipsilateral skin of D6+/+ mice (A, C, E, and G) or D6–/– mice (B, D, F, and H) at day 3 p.i. Data are representative of four mice per group. Scale bar, 500 µM (A and B) and 250 µM (C–H).

 
Results of the current study expand the functional spectrum of nonsignaling chemokine receptors. Analysis of mice that lacked DARC on the endothelium but not on erythrocytes revealed its role in transcytosis of chemokines for presentation to passing leukocytes, thereby promoting inflammatory reactions (12). Our findings in D6–/– mice now add this receptor to those that are required for aspects of immunity despite the absence of signaling capacity. It remains to be determined definitively how the presence of D6 affects the outcome of immunization in this system. One possibility is that Ag-charged DCs are inhibited in their exit from the intense inflammatory reaction found in the immunization site as suggested by our observation (Fig. 4D) of CD11c+ DC aggregates in cutaneous immunization sites of D6–/– mice (13). Another possibility concerns the concept of remote control of immune responses by chemokine transfer to the local lymph node (7). However, CFA-injected D6–/– mice showed hypercellular lymph nodes 3 days after injection, with increased CCL2 concentration 7 days postinjection (6), arguing against a cardinal role for D6 in chemokine transfer to the draining lymph node. Future investigations will focus on whether timing and concentration of chemokine accumulation in local lymph nodes or gradients between skin and lymph nodes are critical for efficient generation of immune responses to cutaneous immunization./


    Acknowledgments
 
We thank Sandra Cardona and Justin Johnson for excellent technical assistance.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grant 3RO1 NS32151 (to R.M.R.) and a Junior Faculty Award from the Nancy Davis Center Without Walls (to L.L.). Back

2 Address correspondence and reprint requests Dr. Richard M. Ransohoff, Neuroinflammation Research Center, Department of Neurosciences, Lerner Research Institute, Cleveland Clinic, 9500 Euclid Avenue, Cleveland, OH 44195. E-mail address: ransohr{at}ccf.org Back

3 Abbreviations used in this paper: DARC, Duffy Ag receptor for chemokines; DC, dendritic cell; EAE, experimental autoimmune encephalomyelitis; MBP, myelin basic protein; MOG, myelin oligodendroglial glycoprotein; p.i., post immunization. Back

Received for publication December 23, 2005. Accepted for publication May 1, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 

  1. Locati, M., Y. M. Torre, E. Galliera, R. Bonecchi, H. Bodduluri, G. Vago, A. Vecchi, A. Mantovani. 2005. Silent chemoattractant receptors: D6 as a decoy and scavenger receptor for inflammatory CC chemokines. Cytokine Growth Factor Rev. 16: 679-686. [Medline]
  2. Fra, A. M., M. Locati, K. Otero, M. Sironi, P. Signorelli, M. L. Massardi, M. Gobbi, A. Vecchi, S. Sozzani, A. Mantovani. 2003. Cutting edge: scavenging of inflammatory CC chemokines by the promiscuous putatively silent chemokine receptor D6. J. Immunol. 170: 2279-2282. [Abstract/Free Full Text]
  3. Weber, M., E. Blair, C. V. Simpson, M. O’Hara, P. E. Blackburn, A. Rot, G. J. Graham, R. J. Nibbs. 2004. The chemokine receptor D6 constitutively traffics to and from the cell surface to internalize and degrade chemokines. Mol. Biol. Cell 15: 2492-2508. [Abstract/Free Full Text]
  4. Galliera, E., V. R. Jala, J. O. Trent, R. Bonecchi, P. Signorelli, R. J. Lefkowitz, A. Mantovani, M. Locati, B. Haribabu. 2004. beta-Arrestin-dependent constitutive internalization of the human chemokine decoy receptor D6. J. Biol. Chem. 279: 25590-25597. [Abstract/Free Full Text]
  5. Jamieson, T., D. N. Cook, R. J. Nibbs, A. Rot, C. Nixon, P. McLean, A. Alcami, S. A. Lira, M. Wiekowski, G. J. Graham. 2005. The chemokine receptor D6 limits the inflammatory response in vivo. Nat. Immunol. 6: 403-411. [Medline]
  6. Martinez de la Torre, Y., M. Locati, C. Buracchi, J. Dupor, D. N. Cook, R. Bonecchi, M. Nebuloni, D. Rukavina, L. Vago, A. Vecchi, et al 2005. Increased inflammation in mice deficient for the chemokine decoy receptor D6. Eur. J. Immunol. 35: 1342-1346. [Medline]
  7. Palframan, R. T., S. Jung, G. Cheng, W. Weninger, Y. Luo, M. Dorf, D. R. Littman, B. J. Rollins, H. Zweerink, A. Rot, U. H. von Andrian. 2001. Inflammatory chemokine transport and presentation in HEV: a remote control mechanism for monocyte recruitment to lymph nodes in inflamed tissues. J. Exp. Med. 194: 1361-1373. [Abstract/Free Full Text]
  8. Liu, L., D. Huang, M. Matsui, T. T. He, T. Hu, J. DeMartino, B. Lu, C. Gerard, R. M. Ransohoff. 2006. Severe disease, unaltered leukocyte migration, and reduced IFN-{gamma} production in CXCR3–/– mice with experimental autoimmune encephalomyelitis. J. Immunol. 176: 4399-4409. [Abstract/Free Full Text]
  9. Marusic, S., M. W. Leach, J. W. Pelker, M. L. Azoitei, N. Uozumi, J. Cui, M. W. Shen, C. M. DeClercq, J. S. Miyashiro, B. A. Carito, et al 2005. Cytosolic phospholipase A2 {alpha}-deficient mice are resistant to experimental autoimmune encephalomyelitis. J. Exp. Med. 202: 841-851. [Abstract/Free Full Text]
  10. Nibbs, R. J., S. M. Wylie, I. B. Pragnell, G. J. Graham. 1997. Cloning and characterization of a novel promiscuous human beta-chemokine receptor D6. J. Biol. Chem. 272: 12495-12504. [Abstract/Free Full Text]
  11. Wujek, J. R., C. Bjartmar, E. Richer, R. M. Ransohoff, M. Yu, V. K. Tuohy, B. D. Trapp. 2002. Axon loss in the spinal cord determines permanent neurological disability in an animal model of multiple sclerosis. J. Neuropathol. Exp. Neurol. 61: 23-32. [Medline]
  12. Nibbs, R., G. Graham, A. Rot. 2003. Chemokines on the move: control by the chemokine "interceptors" Duffy blood group antigen and D6. Semin. Immunol. 15: 287-294. [Medline]
  13. Sozzani, S., P. Allavena, A. Vecchi, A. Mantovani. 1999. The role of chemokines in the regulation of dendritic cell trafficking. J. Leukocyte Biol. 66: 1-9. [Abstract]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
G. Trujillo, E. C. O'Connor, S. L. Kunkel, and C. M. Hogaboam
A Novel Mechanism for CCR4 in the Regulation of Macrophage Activation in Bleomycin-Induced Pulmonary Fibrosis
Am. J. Pathol., May 1, 2008; 172(5): 1209 - 1221.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, L.
Right arrow Articles by Ransohoff, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, L.
Right arrow Articles by Ransohoff, R. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS