|
|
||||||||

* Sunnybrook Research Institute, and Department of Immunology, University of Toronto, Toronto, Ontario, Canada; and
Division of Biology, California Institute of Technology, Pasadena, CA 91106
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
E2A and HEB are expressed throughout T cell development, and regulate multiple stages of this process (5). Early T cell precursors can be identified as CD4CD8 double negative (DN) cells in the fetal or adult thymus, and progression of these cells through the early stages of T cell development can be tracked by surface CD44 and CD25 expression. A subset of the cells in the thymic DN1 (CD44+CD25) population are multipotent ETP (early T cell precursors) (8). The DN1 to DN2 (CD44+CD25+) transition marks entry into the T cell lineage, which also correlates with up-regulation of Thy-1. Thymocytes from E2A/ mice exhibit a partial block at the DN1 to DN2 transition (9, 10), whereas thymocytes from HEB/ mice do not in the steady state thymus (11, 12).
Commitment to the T lineage occurs at the DN3 stage, marked by down-regulation of CD44. Successful TCR-
rearrangement and signaling through the pre-TCR results in CD25 down-regulation and a burst of proliferation, in a process termed
-selection (13). HEB and/or E2A are directly involved in the rearrangement of TCR genes and the expression of many genes known to be important for both
-selection and 
T cell development (14, 15, 16, 17, 18, 19). Transgenic mice expressing an HEB mutant transgene that can dimerize but cannot bind DNA exhibit a severe block at the DN3 transition (20), indicating that bHLH function is necessary for this transition. HEB/ thymocytes have a less severe partial block at the DN3 stage, suggesting that E2A or ITF-2 can partially substitute for the function of HEB at this transition. The introduction of a TCR transgene into the HEB/ background does not relieve this block, indicating that HEB operates during
-selection in a parallel pathway to pre-TCR signaling (11).
Once thymocytes pass the
-selection checkpoint, the resulting DN4 cells up-regulate CD8 first to become immature single positive (ISP), CD8+CD4CD3) cells, and then express CD4 to become double positive (DP, CD4+CD8+) thymocytes. HEB/ thymuses accumulate ISP cells and show a decrease in the percentage of DP cells, indicating that loss of HEB results in a second partial block at the ISP to DP transition (11). In normal thymocyte development, positive selection leads to the production of mature SP (CD4+ or CD8+) thymocytes, whereas negative selection deletes potentially autoreactive T cells. E2A/ thymocytes exhibit perturbations in the CD4 to CD8 ratios of SP thymocytes, and a propensity toward malignant transformation into thymic lymphomas (9). No reports have been published thus far on the ability of HEB/ thymocytes to become cancerous, perhaps because of the more severe neonatal lethality in the HEB/ mice (12).
Class I bHLH factors and Id factors are intimately involved in the control of cell cycle proteins in addition to their roles in activating lymphocyte-specific genes (4, 5, 21). Therefore, understanding the integrated control of differentiation and proliferation by HEB and E2A during lymphocyte development will be essential for understanding both normal T cell development and the potential for aberrant differentiation that can lead to cancer when the functions of these regulatory proteins are perturbed. In this report we describe a new form of HEB called HEBAlt, which is expressed specifically in early T cell precursors. The distinctive expression pattern of this factor in thymocytes has already prompted us to use it as a reference sample in a few studies (22, 23, 24). In this study, however, we present the first detailed description of HEBAlt, and show that HEBAlt is specifically required for efficient generation of T cell precursors.
| Materials and Methods |
|---|
|
|
|---|
The animals used for the RT-PCR studies were C57BL/6 mice, C57BL6/E129 Rag-2/ mice, C57BL/6 SCID mice, C57BL/6 MHC/ mice, and C57BL/6-TCR
/
/ mice. HEB+/ mice were generated by Y. Zhuang (Duke University Medical Center, Durham, NC) (12) and provided to us by T. Hoang, Université de Montréal (Montréal, Quebec, Canada). Thymus samples were taken from 3- to 5-wk-old mice, and splenocytes and bone marrow from mice 12 wk or older. For OP9-DL1 cocultures, E14.5 embryos were obtained from either National Institutes of Health Swiss timed matings (National Cancer Institute) or from C57BL/6 wild-type or C57BL/6 HEB+/ timed matings at Sunnybrook Research Institute. The studies described within this report have been reviewed and approved by institutional review committees at California Institute of Technology or Sunnybrook Research Institute.
Sequence analysis
The HEBAlt cDNA sequence, obtained by sequencing a cDNA from a SCID thymocyte arrayed library (25), matches a RIKEN 12-day embryo male wolffian duct full-length cDNA (GenBank accession no. AK078415) (26). The Alt-specific (does not match HEBCan accession no. NM_011544) coding nucleotide sequence was run against the nonredundant GenBank database, the chicken EST database, and the Fugu genome using the Blastx and tBlastn programs (27). GenBank accession nos. for these sequences are: MITF-2A (mouse, Mus musculus) U16321.1; TnHEBAlt (green spotted pufferfish, Tetraodon nigroviridis) CAAE01014581.1; DrHEBAlt (zebrafish, Danio rerio) NP_999981; HsHEBAlt (human, Homo sapiens) NP_996923; FrHEBAlt (Japanese pufferfish, Fugu rubripes) CAAB01000314.1; FrITF2A CAAB01001447.1; and GgHEBAlt (chicken, Gallus gallus) BU441064.1. The genomic locus was analyzed by running the full-length HEBAlt cDNA nucleotide sequence against the mouse genome using Blastn to locate the exons and calculate the intron distances.
Generation of sorted cell populations
DN populations (see Fig. 2A) were obtained from Rag-2/ mice: DN1a (Sca-1+CD24lowCD44+), DN2 (Sca-1+CD24+CD44+), DN3 (Sca-1+CD24+CD44), and pre-NK (Sca-1CD24). The ISP (CD8+CD3) and mature SP (CD4+CD8 or CD4CD8+) thymocytes as well as TCR
+ SP splenocytes were obtained from C57BL/6 mice, whereas the DP (CD4+CD8+) cells were obtained from MHC-deficient mice. Fetal TCR
+ and TCR
+ cells were obtained from fetal thymic lobes grown in fetal thymic organ culture. These populations are described in detail elsewhere (25).
|
, and TCR
.
|
RNA was extracted using the RNAzol method (Leedo Medical Laboratory), and first-strand cDNA was generated from total RNA using Superscript II reverse transcriptase (Invitrogen Life Technologies). RT-PCR was performed using gene specific primers: HEBAlt atcctgtccctggaatgggcaa, HEBCan tctcaggctgtcagtctagt, HEB-A/C gtgaatgaaggctgccataact, E47 tccctggaggagaaggacct, E12 ccccagagcagaaggcgga, E47/12 ttggggttcaggttgcgt, MITF2A acaccatcccgggcatgggcgg, MITF2B agtgccatggaggtacagacaa, MITF2-A/B ttgatgtctgccgaggagtgggat, Id2-313 ggactcgcatcccactatcgt, Id2-646 gatcgtcttgcccaggtgtcg, Id3-340 ccgcatctcccgatccagaca, Id3-566 cctgaactcaacgcctcgagg, ZEB-199 tgaactgccagcagaccaga, ZEB-475 gcaggtgagcaactgggaaa, HPRT gtaatgatcagtcaacgggggac, and HPRT ccagcaagcttgcaaccttaacca. Products were amplified using AmplitaqGOLD DNA polymerase as previously described (25).
Quantitative real-time RT-PCR was performed on sorted cell populations by extraction of RNA using TRIzol (Invitrogen Life Technologies), followed by generation of first-strand cDNA using Superscript RT III. Aliquots of cDNA corresponding to
1000 cell equivalents were used as templates in quantitative real-time PCR using the SYBRGreen Master Mix kit (Applied Biosystems or Bio-Rad) and specific primers at 2.5 pM of each primer per 25 µl of reaction. Primer sequences have been previously reported (24, 28). Reactions were run and analyzed using the Applied Biosystems Sequence Detection System 7700 or 7000. All values were calculated relative to
-actin or GAPDH as indicated.
Western blot analysis
C57BL/6 DN (CD4CD8) thymocytes were purified using anti-CD4-biotin and anti-CD8-biotin Abs, streptavidin microbeads, and a Midi-MACS magnetic column (Miltenyi Biotec). Cell lysates were run on acrylamide gels and transferred to membrane as previously described (22). Abs used to probe the protein blots were rabbit polyclonal anti-HEB (A-20, sc-357) and rabbit anti-
-tubulin (H-235, SC-9104) from Santa Cruz Biotechnology.
Expression constructs
Full-length coding sequences were assembled and cloned into the pBK-CMV plasmid backbone using cDNAs from an arrayed SCID thymocyte library (25). These cDNAs do not contain the alternative "Ank" exon found in some other reported HEB cDNAs (29) (see Fig. 1) because they were naturally absent from the HEB cDNA clones obtained from the SCID thymocyte library. Recombinant plasmids were sequenced and used as templates in PCRs (Platinum Pfx DNA polymerase; Invitrogen Life Technologies) to amplify the coding region for insertion into the Zero Blunt TOPO vector (Invitrogen Life Technologies). XhoI restriction fragments amplified by Pfx from TOPO clone DNA were then cloned into the MIGR1 retroviral expression vector at the XhoI site. Primers were as follows: HEBAlt 5'-gactcgagcaccatgtactgtgcttatcct; HEBCan-XhoI 5'-gactcgagcaccatgaatccccagcagca; HEBTr-XhoI 5'-gactcgagcaccatggtatatgcaccatcc; and HEB-XhoI 3'-cactcgagttacagatgacccatagg. The same 3' primer was used for all three constructs. The 5' HEBTr-XhoI primer encodes a methionine not found in the endogenous cDNA sequence. All MIGR1-based vectors were sequenced to verify that mutations had not been introduced by PCR amplification.
|
Gel shift analysis
Nuclear extracts were prepared from transfected HeLa cells according to the reported procedure (18). Nuclear cell extract (5 µg of protein) was incubated with 0.5 fmol of 32P-labeled oligonucleotide at 0°C for 20 min in a 10-µl reaction mixture (20 mM HEPES buffer (pH 7.9), 100 mM KCl, 12.5 mM MgCl2, 1 mM EDTA, 20% (v/v) glycerol, 2 mM DTT, 0.5 mM PMSF, and 1 µg of poly(dI-dC)-poly(dI-dC)) in the presence or absence of unlabeled oligonucleotide. DNA protein complexes were resolved by electrophoresis on 5% polyacrylamide gels at 4°C for 1 h at 120 V in TGE buffer (25 mM Tris-HCl (pH 8.0), 192 mM glycine, and 2 mM EDTA). Supershift was done by following a published protocol (18). One microliter of anti-HEB Ab (sc-357) or 3 µl of anti-FLAG Ab (Sigma-Aldrich) were used for Supershift analysis. Wild-type E box oligonucleotide sequence GAGCAGAGCAGCTGGGGTACAGCTGGGTCTGT and mutant E box oligonucleotide sequence GAGCAGAGAAGCAAGGGTAAAGCAAGGTCTGT (18). Bold type indicates wild-type or mutant E box binding sites.
Isolation of fetal liver precursors
Fetal livers were dissected from day 14.5 embryos and made into single cell suspensions by pipetting up and down in 1 ml of HBSS (Invitrogen Life Technologies) plus 0.25% BSA and 2 mM EDTA per liver. Cells were enriched for multipotent precursors by magnetic bead depletion with biotinylated Abs (lineage (Lin): anti-Gr-1, anti-Ter119, anti-F4/80, and anti-CD19) and streptavidin microbeads using the Midi-MACS system. Fetal livers obtained from HEB+/ x HEB+/ timed matings were individually genotyped by PCR and then pooled according to genotype for MACS enrichment before transduction and plating on OP9-DL1 monolayers.
Retroviral transduction
Retroviral DNA was prepared using Endo-Free DNA extraction reagents and columns (Qiagen). The DNA was cotransfected into
NX-Eco packaging cells with the pcEco plasmid using a standard calcium phosphate transfection method. Supernatants were collected after 24 and 48 h, titered using NIH3T3 cells, and frozen in aliquots at 70°C until use. Cells were transduced by modified spin infection (22) in the presence of either polybrene (8 µg/ml) or LipofectAMINE (Invitrogen Life Technologies).
Fetal liver Lin cells were purified, transduced, and cultured overnight in OP9-DL1 medium (30) plus 5 ng/ml IL-7, 5 ng/ml stem cell factor (SCF), and 5 ng/ml Flt3 ligand (R&D Systems). The next day (1624 h after infection) the Sca-1+CD117+GFP+ fraction was sorted and plated on OP9-DL1 monolayers. Results were similar whether input cells were sorted for LSK GFP+ cells before OP9-DL1 coculture, or whether Lin or LSK cells were isolated, transduced, and placed in OP9-DL1 coculture without first purifying the GFP+ populations.
OP9-DL1 coculture
OP9-DL1 cells, which support the in vitro development of T cells, have been previously described (30). For coculture, 3,00010,000 transduced precursors were placed on OP9-DL1 monolayers in OP9-DL1 medium in the presence of IL-7, SCF, and Flt3 ligand (all 5 ng/ml; some experiments omitted SCF after day 7 and lowered IL-7 to 1 ng/ml). OP9-DL1 medium consisted of high glucose DMEM (Invitrogen Life Technologies) supplemented with 10 mM HEPES, 1 mM sodium pyruvate, 1x PSG (penicillin-streptomycin-glutamine; Invitrogen Life Technologies), 16% FBS (HyClone), and 55 µM 2-ME. Cultures were split every 35 days and placed on freshly plated subconfluent OP9-DL1 monolayers. Cultures were analyzed every 34 days after plating by flow cytometry using a FACSCalibur (BD Biosciences), and data were analyzed using CellQuest Pro (BD Biosciences).
| Results |
|---|
|
|
|---|
During a gene discovery project for transcription factors expressed at the pro-T cell stage of T cell development (25), we discovered a new form of the bHLH factor HEB. This transcript, termed HEBAlt, includes the bHLH domain and the AD2 domain of the previously described HEB transcript (which we call HEBCan, for canonical HEB), but replaces AD1 with a novel sequence we refer to as the Alt (alternative) domain (Fig. 1). The predicted 23 aa Alt domain is homologous to the N-terminal region of ITF-2A, which represents an alternatively spliced form of the related bHLH factor ITF-2 (31) (Fig. 1, A and C). The predicted amino acid sequence of Alt domain of HEB is well conserved throughout vertebrate phylogeny (Fig. 1C), indicating conserved function. We assembled a map of the HEB locus by comparing the HEBCan and HEBAlt cDNAs with the mouse genome sequence. The HEB locus is very large, spanning over 200 kb in the mouse, and the Alt exon is located between exons 8 and 9 (Fig. 1B). The transcriptional initiation site of HEBAlt mRNA is just upstream of the Alt exon. In the HEBAlt transcript, the Alt domain replaces exons 18 of HEBCan; in the HEBCan transcript, the Alt domain is spliced out.
HEBAlt is expressed only in the DN stages of thymocyte development
To define HEBAlt expression in the context of other bHLH factors during T cell development, RT-PCR was performed on primary cells representing successive stages of T cell differentiation (Fig. 2A). HEBAlt exhibits a strikingly unique expression pattern among the genes surveyed, in that it is the only bHLH factor that is restricted to the DN stages of T cell development (Fig. 2A). HEBCan, by contrast, is expressed in all thymocyte and splenocyte subsets analyzed in this study, and peaks in relative message level at the DP stage (Fig. 2, B and C). Quantitative real-time PCR analysis indicates that HEBAlt and HEBCan levels are similar in DN2 and pre-
-selection DN3 cells. The DN3 populations from wild-type mice, which include cells before and after
-selection, have higher levels of HEBCan than HEBAlt mRNA, suggesting that HEBCan may be up-regulated at
-selection (Fig. 2, C and D). HEBAlt is consistently up-regulated at the DN1 to DN2 transition, coincident with the induction of pro-T cell genes such as Rag-1, Rag-2, pre-T
, and with the onset of TCR rearrangement.
To estimate HEBCan and HEBAlt protein levels during T cell development, we used an anti-HEB Ab that binds to a common epitope at the 3' end of HEB. Two bands were detected on Western blots that corresponded to the approximate predicted sizes of HEBCan (
85 kDa) and HEBAlt (
65 kDa) in lysates from DN or DP cells (Fig. 2E). HEBAlt protein is expressed at higher levels than HEBCan in DN thymocytes, and is detectable in both DN3 and DN4 cells. Therefore, it is possible that HEBAlt protein is stabilized as a result of
-selection because HEBAlt mRNA levels drop at the DN3 to DN4 transition (Fig. 2C), whereas HEBAlt protein levels do not (Fig. 2E). HEBCan protein but not HEBAlt protein is detected in unfractionated thymocytes (Fig. 2E), which are
85% DP cells, consistent with the mRNA expression pattern. HEBCan protein levels do not appear to be higher in DP cells than in DN cells, however, despite the increase in mRNA. This result indicates that HEBCan may be subject to the same types of posttranslational control that have been reported for E2A during T cell development (10).
HEBAlt can specifically bind an E box motif
Although HEBAlt contains all of the domains necessary for dimerization and DNA binding, it remained possible that the Alt domain could cause a conformational change that would prohibit binding to DNA. To determine whether HEBAlt-containing dimers could bind relevant E box sites from the pre-T
locus (18), gel shift analyses were performed. Because HEBAlt-specific Abs were not available, two protein sources were used in standard gel shift assays to detect HEBAlt-specific binding: 1) in vitro transcribed and translated HEBAlt protein, and 2) Flag-tagged HEBAlt protein (3XF-HEBAlt) expressed in HeLa cells by transient transfection (Fig. 3A). Immunoblotting of HeLa cells transfected with 3XF-HEBAlt vs control plasmid DNA showed specific expression of Flag-tagged HEBAlt on a background of minimal endogenous HEB protein (Fig. 3B). HEBAlt from both sources exhibited binding to the probe. The specificity of the interaction was confirmed in two ways: 1) by preincubation with anti-HEB Ab (Fig. 3C) or anti-Flag Ab (Fig. 3D), each of which blocked binding of HEBAlt to the labeled DNA, and 2) by incubation with mutant E box oligonucleotides, which did not induce a gel shift when labeled (Fig. 3C) or inhibit binding to the labeled E box probe when used as unlabeled competitor (Fig. 3D).
Synergistic regulation of HEBAlt transcription by HEBCan and Delta-Notch signaling
To understand the role of HEBAlt in early T cell development, we generated retroviral expression constructs in the MIGR1 (MSCV-IRES-GFP) backbone that express HEBAlt (MIGR1-HEBAlt) or express HEBCan (MIGR1-HEBCan) (Fig. 4A). These constructs were used to transduce the adh.2C2 pro-T cell line (24, 32). Two days after transduction, GFP+ cells were sorted and subjected to quantitative real-time PCR analysis of HEBAlt and HEBCan mRNA levels (Fig. 4B). Total HEBAlt mRNA levels increased relative to the control in cells transduced with the MIGR1-HEBAlt retroviral construct, whereas HEBCan levels remained unchanged. In contrast, both HEBCan and HEBAlt total mRNA levels increased in HEBCan-transduced cells. These results suggested that increased levels of HEBCan up-regulated endogenous HEBAlt transcription in adh.2C2 cells. This up-regulation was confirmed at the protein level in a separate set of experiments (Fig. 4C).
|
Retroviral expression of HEB isoforms in hemopoietic multipotent precursors
To test whether expression of HEBAlt can influence the ability of multipotent progenitors to adopt a T cell fate, we used the same retroviral vectors shown in Fig. 4 to transduce fetal liver-derived hemopoietic precursors (Fig. 5A). HEBAlt is distinguished from HEBCan both by the absence of exons 18 and by the presence of the Alt exon. To determine which of these domains are important for differences in functional impact, we also transduced cells with an artificial variant of HEB that contains exons 921 plus a start codon. This construct, HEBTr, is identical with HEBAlt except that it lacks the Alt domain, and thus allows discrimination between functions that require the Alt domain and those that do not. Fetal liver cells enriched for Lin cells were transduced and cultured overnight to allow expression of GFP before sorting. MIGR1-transduced control cells always had higher percentages and levels of GFP+ cells than either MIGR1-HEBAlt- or MIGR1-HEBCan-transduced samples (Fig. 5B). Furthermore, MIGR1-HEBCan-transduced samples were routinely GFPlow compared with either control or HEBAlt-transduced samples; this was also true of MIGR1-HEBTr-transduced samples (data not shown). Importantly, a clear GFP+ population and a clear GFP population were always observed in the MIGR1-transduced control cells, whereas the GFP levels in HEB-transduced cells appeared as a continuum from GFP+ (above nontransduced levels) to GFP, instead of two separate GFP+ and GFP populations. HEBTr-transduced fetal liver cells were very similar to the HEBCan-transduced cells in terms of percentage and levels of GFP detected by FACS analysis (data not shown).
|
Transient expression of retroviral HEB transgenes generates a high frequency of GFP cells from sorted GFP+ transduced precursors
To assess the effects of expressing HEBAlt or HEBCan in hemopoietic stem cells, we placed transduced fetal liver precursors in OP9-DL1 coculture, which induces T cell development, or OP9-GFP coculture, which allows development of B cells (34). Introduction of HEB into precursors did not induce T cell development in OP9-GFP coculture, indicating that Notch signaling was still necessary in the presence of HEB (data not shown). T cell development did occur in OP9-DL1 coculture, as assessed by the appearance of CD4+CD8+ DP pre-T cells. In cell cultures that were seeded with sorted GFP+ HEB-transduced precursors, the majority of the surviving cells down-regulated retroviral transgene expression to appear GFP by FACS analysis by day 14 of coculture. This was a specific response to HEB expression because virtually no GFP cells were generated by the MIGR1-transduced controls. Consistent with their origin from HEBAlt-transduced cells, the GFP cells in the HEBAlt cultures were similar in phenotype to the cells that remained detectably GFP+ (Fig. 6A).
|
Strikingly, HEBAlt-transduced precursors generated higher percentages (Fig. 6A) and higher numbers (Fig. 6B) of CD4+CD8+ DP T cell precursors than control MIGR1-transduced precursors. This increase was seen in multiple experiments, as plotted in Fig. 6C. The GFP cells in the HEBAlt cultures were similar in phenotype to the GFP+ cells, with an expanded DP population. However, the numbers of GFP cells were much higher than the numbers of GFP+ cells for HEBAlt-transduced cultures. To determine the time at which these GFP cells first arose, the percentage of GFP+ cells at was tracked every 34 days over the 2-wk period of coculture (Fig. 7A). This time course suggested that the drop in the percentage of GFP+ cells occurred during the DN stages, and that after the initial appearance of these cells, there was a steady ratio of GFP+ to GFP cells in each culture.
|
The detection of low levels of transgene message in GFP cells sorted from day 7 cocultures confirmed that at least some of these cells had arisen from HEBAlt-transduced precursors which had down-regulated the transgene (Fig. 7D). Inclusion of CD25+ as a sorting criteria ensured that OP9-DL1 stromal cells, which also express GFP, were excluded from analysis. Furthermore, the GFP cells in the HEBAlt-transduced cultures expanded more rapidly than either the control cells or the HEBAlt-transduced GFP+ cells (Fig. 7, E and F). These data suggest retroviral HEBAlt causes an initial increase in T cell precursors, and that subsequent down-regulation of the HEBAlt transgene confers a proliferative advantage over those that maintain HEBAlt expression (Fig. 7G). Therefore, the GFP+ cells sustain expression of HEBAlt or HEBCan, whereas the GFP cells are composed primarily of cells which experienced transient expression of HEBAlt or HEBCan followed by transgene down-regulation.
Different effects of transient vs sustained expression of HEBCan
The appearance of GFP cells in the HEB-transduced cultures provided the ability to distinguish between early and late effects of transgene expression during T cell development. Sustained expression of HEBCan did not increase the numbers or percentages of DP cells, but was instead inhibitory for proliferation (Fig. 6B). By contrast, cells that transiently expressed HEBCan exhibited a similar increase in the percentages of DP T cells as the HEBAlt-transduced cells. Unlike the HEBAlt-transduced cultures, cells that expressed HEBCan transiently did not expand in number in OP9-DL1 coculture. Because HEBAlt can be induced by HEBCan in early precursors, it also suggests that the early influence of HEBCan on T cell precursor expansion may be due to up-regulation of HEBAlt. Cells transduced with HEBTr, which is identical with HEBAlt except for the deletion of the Alt domain, were even more severely inhibited in their ability to become DP T cell precursors, indicating that the Alt domain was required for the T cell-promoting activity of HEBAlt.
HEBAlt rescues delayed T cell specification in HEB/ precursors and enhances the generation of T cell precursors from wild-type multipotent progenitors
Analysis of the percentage of GFP+ cells at each time point in culture indicated that a brief burst of transgene expression within the first 4 days of culture was responsible for the increase in T cell precursors seen in the HEBAlt-transduced cultures (Fig. 7, A and B). FACS analysis at day 4 confirmed that HEBAlt-transduced cultures had increased percentages of CD25+Thy-1+ pro-T cells at this early time point in both GFP+ and GFP populations. These results were consistent among multiple experiments (Fig. 8D). HEBCan-transduced GFP cells also displayed a higher percentage of pro-T cells (Fig. 8A). To distinguish between the intrinsic ability of HEBCan to influence early T cell development vs its ability to up-regulate endogenous HEBAlt in early T cell precursors (Fig. 8C), we transduced HEB/ fetal liver precursors with the same retroviral constructs used in the wild-type experiments. Control-transduced HEB/ precursors showed a delay in the production of DN2 cells by day 4 of coculture relative to the wild-type MIGR1-transduced controls. Strikingly, only HEBAlt increased the percentage of DN2 cells from HEB/ precursors. The inability of other HEB isoforms, which have the ability to form bHLH heterodimers to increase pro-T cell generation, suggests that HEBAlt plays a specific positive function rather than a simple dominant negative function by inhibiting other bHLH proteins such as E2A. Therefore, HEBAlt rescues efficient generation of pro-T cells from hemopoietic stem cells, whereas HEBCan does not.
|
| Discussion |
|---|
|
|
|---|
The transient high level expression and down-regulation of vector to generate GFP cells in HEB-transduced populations provided the opportunity to assess the effects of transient vs sustained expression of the HEBAlt and HEBCan transgenes on T cell development. Analyses of RNA (Fig. 7) and DNA (data not shown) from GFP populations developing in OP9-DL1 cocultures confirmed that at least some of the GFP cells that arose in these cultures were derived from GFP+ cells that down-regulated the retroviral transgene. Analysis of these two populations in HEBAlt-transduced cultures showed that once the early increase in T cell precursors was achieved, the accelerated rate of development was independent of continued high level expression of HEBAlt, whereas sustained HEBAlt expression appeared to inhibit proliferation but not differentiation. By contrast, T cell development was inhibited by sustained high level expression of HEBCan, but not by transient expression of HEBCan. Our results are most consistent with a model involving a transient burst of HEBAlt expression that caused increased production of T cell precursors, followed by expansion of cells that subsequently down-regulate HEBAlt expression (Fig. 7). The increase in T cell precursors could be due to increased proliferation of DN2/3 cells and/or to enhanced entry into the T cell lineage. Future experiments will focus on cell cycle analysis during the first 4 days of OP9-DL1 coculture to distinguish between these possibilities.
Although transient high level expression of HEBCan enhanced the percentages of DP cells in OP9-DL1 coculture, no increase in total cell numbers occurred. Different ratios of HEBAlt-containing dimers and HEBCan-containing dimers would be expected in the HEBAlt-transduced vs the HEBCan-transduced cells, and this could impact differently on target genes required for differentiation vs those required for growth control. Previous work in other laboratories has indicated that overexpression of any full length class I bHLH factor (E2A, HEBCan, or ITF-2B) is generally detrimental to cell growth and survival (37), whereas Id expression is associated with cell proliferation (38). Other studies have shown that E2A expression can inhibit tumor formation in developing thymocytes (39). This is due in part to direct regulation of cell cycle regulation genes (21, 37, 40), but may also involve induction of apoptosis (39). At least some of these effects appear to be dependent on the presence of the AD1 domain (41, 42), which is not present in HEBAlt. Therefore, although HEBAlt was induced in HEBCan-transduced cells, the different ratios of each factor in HEBAlt- vs HEBCan-transduced cells decoupled their effects on differentiation and proliferation.
Developing HEB/ cells in OP9-DL1 coculture exhibited delayed up-regulation of CD25, and a complete block at the DN to DP transition, whereas in HEB/ mice, thymocytes were partially blocked at the DN3 and CD8+ ISP stage with reduced numbers of DP and SP cells (11). It is possible that more profound effects on early T cell development would be seen in the absence of both HEBAlt and ITF-2A because these homologs are both expressed during this time of development and are structurally very similar to each other. However, even in the presence of ITF-2A, the OP9-DL1 system enabled a kinetic analysis of the appearance of each developmental stage over time, which revealed specific potential roles for HEBAlt that were not apparent in the steady state HEB/ thymus.
The failure of HEB/ cells to develop to the DP stage was not rescued by the transduction of HEBAlt or HEBCan at the hemopoietic stem cell stage (data not shown). However, preliminary studies in our laboratory using wild-type transduced fetal thymocytes and DN2/3 precursors generated on OP9-DL1 cocultures suggest that once precursors are committed to the T cell lineage, elevated levels of HEBCan and HEBAlt have quite different effects than the effects they have on hemopoietic stem cells (G. Vaccarelli, C. Claus, D. Wang, and M. Anderson, unpublished observations). Therefore, the highly regulated expression of HEBAlt and HEBCan during T cell development is likely to reflect stage-specific roles for each factor that shift at major developmental checkpoints.
In conclusion, our results indicate that HEBAlt is a functionally distinct transcription factor that plays a specific role in guiding hemopoietic stem cells into the T cell lineage. We have linked the regulation of HEBAlt to Delta-Notch signaling and HEBCan function, and shown that transient expression of HEBAlt has long lasting effects on the generation of T cell precursors. It will be interesting to see how germline deletion of the Alt exon affects T cell development, in work that is now under way.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by Grant MOP64185 from Canadian Institutes of Health Research (to M.K.A.), by Grant R01 CA90233 from the National Institutes of Health (to E.V.R.), the Sunnybrook Research Institute, and the Stowers Institute for Medical Research. ![]()
2 Address correspondence and reprint requests to Dr. Michele K. Anderson, Sunnybrook Research Institute, 2075 Bayview Avenue, Room A340, Toronto, Ontario M4N 3M5, Canada. E-mail address: manderso{at}swri.ca ![]()
3 Abbreviations used in this paper: bHLH, basic helix-loop-helix; DP, double positive; DN, double negative; ISP, immature single positive; SCF, stem cell factor. ![]()
Received for publication June 21, 2005. Accepted for publication April 12, 2006.
| References |
|---|
|
|
|---|

T-cell development and to rapid development of T-cell lymphomas. Mol. Cell. Biol. 17: 4782-4791. [Abstract]
thymopoiesis. J. Immunol. 163: 3331-3343.
enhancer and characteristics of its DNA-binding proteins. Mol. Cell. Biol. 10: 5027-5035.
/
repertoire by the helix-loop-helix proteins E2A and HEB in nonlymphoid cells. J. Exp. Med. 193: 769-776.
promoter during immature T cell development. J. Immunol. 167: 2157-2163.
promoter and enhancer are direct targets for transactivation by E box-binding proteins. Eur. J. Immunol. 32: 911-920. [Medline]
, but not by surface pre-TCR complexes, are able to induce maturation of an early thymic lymphoma in vitro. J. Immunol. 163: 2576-2585. This article has been cited by other articles:
![]() |
C. Guo, Q. Hu, C. Yan, and J. Zhang Multivalent Binding of the ETO Corepressor to E Proteins Facilitates Dual Repression Controls Targeting Chromatin and the Basal Transcription Machinery Mol. Cell. Biol., May 15, 2009; 29(10): 2644 - 2657. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Georgescu, W. J. R. Longabaugh, D. D. Scripture-Adams, E.-S. David-Fung, M. A. Yui, M. A. Zarnegar, H. Bolouri, and E. V. Rothenberg Gene Networks in Development and Evolution Special Feature Sackler Colloquium: A gene regulatory network armature for T lymphocyte specification PNAS, December 23, 2008; 105(51): 20100 - 20105. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bhalla, C. Spaulding, R. L. Brumbaugh, D. E. Zagort, M. E. Massari, C. Murre, and B. L. Kee Differential Roles for the E2A Activation Domains in B Lymphocytes and Macrophages J. Immunol., February 1, 2008; 180(3): 1694 - 1703. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Tydell, E.-S. David-Fung, J. E. Moore, L. Rowen, T. Taghon, and E. V. Rothenberg Molecular Dissection of Prethymic Progenitor Entry into the T Lymphocyte Developmental Pathway J. Immunol., July 1, 2007; 179(1): 421 - 438. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Xu and B. L. Kee Growth factor independent 1B (Gfi1b) is an E2A target gene that modulates Gata3 in T-cell lymphomas Blood, May 15, 2007; 109(10): 4406 - 4414. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |