The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heinsbroek, S. E. M.
Right arrow Articles by Brown, G. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heinsbroek, S. E. M.
Right arrow Articles by Brown, G. D.
The Journal of Immunology, 2006, 176: 5513-5518.
Copyright © 2006 by The American Association of Immunologists

Expression of Functionally Different Dectin-1 Isoforms by Murine Macrophages1

Sigrid E. M. Heinsbroek*, Philip R. Taylor*, Marcela Rosas*, Janet A. Willment{dagger}, David L. Williams{ddagger}, Siamon Gordon2,* and Gordon D. Brown2,3,{dagger}

* Sir William Dunn School of Pathology, University of Oxford, Oxford, United Kingdom; {dagger} Institute of Infectious Disease and Molecular Medicine, University of Cape Town, Cape Town, South Africa; and {ddagger} Department of Surgery, James H. Quillen College of Medicine, East Tennessee State University, Johnson City, Tennessee 37614


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Dectin-1 is a specific receptor for beta-glucans and a major receptor for fungal particles on macrophages (M{phi}). It is a type II membrane receptor that has a C-terminal, NK-like, C-type lectin-like domain separated from the cell membrane by a short stalk region and a cytoplasmic immunoreceptor tyrosine-based activation-like motif. We observed functional differences in dectin-1-dependent recognition of fungal particles by M{phi} from different mouse strains. RT-PCR analysis revealed that mice have at least two splice forms of dectin-1, generated by differential usage of exon 3, encoding the full-length dectin-1A and a stalkless M{phi} dectin-1B. M{phi} from BALB/c mice and genetically related mice expressed both isoforms in similar amounts, whereas M{phi} from C57BL/6 and related mice mainly expressed the smaller isoform. NIH-3T3 fibroblast and RAW264.7 macrophage cell lines stably expressing either isoform were able to bind and phagocytose zymosan at 37°C. However, binding by the smaller dectin-1B isoform was significantly affected at lower temperatures. These properties were shared by the equivalent human isoforms. The relative ability of each of the isoforms to induce TNF-{alpha} production in RAW264.7 M{phi} was also found to be different. These results are the first evidence that dectin-1 isoforms are functionally distinct and indicate that differential isoform usage may represent a mechanism of regulating cellular responses to beta-glucans.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Pattern recognition receptors play an important role in the orchestration of an immune response by recognition of pathogen-associated molecular pattern(s) ( 1). Pathogen-associated molecular patterns include carbohydrates, lipids, nucleic acids, and proteins ( 1). beta-Glucans, a major carbohydrate component of fungal cell walls (also found in plants and some bacteria) ( 2), are known to activate leukocytes, stimulating phagocytic activity and the production of reactive oxygen intermediates and inflammatory mediators, such as TNF-{alpha} ( 3, 4). Because the binding of live fungi such as Candida albicans is complicated by the presence of alternative receptors and fungal adhesins ( 5), zymosan, a crude beta-glucan-rich cell wall extract of Saccharomyces cereviciae ( 6), is often used as a model fungal particle. Zymosan is also used to study the proinflammatory responses of leukocytes and is now known to interact with these cells via the nonopsonic receptor, dectin-1 ( 7, 8).

Dectin-1 is a type II membrane receptor that has a C-terminal, C-type lectin-like domain, separated from the cell membrane by a short stalk region, and an intracellular domain containing an immunoreceptor tyrosine-based activation-like motif ( 9). It is a major receptor for the recognition of soluble and particulate beta-glucans ( 8). After particle recognition, the receptor is able to mediate phagocytosis, induce an oxidative burst via Syk kinase, and stimulate TNF-{alpha} production in collaboration with TLR2 ( 7, 10, 11, 12). In mice, dectin-1 is expressed by monocytes, macrophages (M{phi}),4 neutrophils, dendritic cells (DC), and a subset of T cells ( 13). It is regulated by different immune stimuli; GM-CSF and IL-4 up-regulate surface expression, whereas IL-10 and LPS down-regulate the expression ( 14). Murine dectin-1 has been suggested to have an alternative splice form that lacks the stalk region ( 15).

In humans, eight isoforms of the homologue of dectin-1 have been described ( 16). The most common isoforms, BGR-A and BGR-B (beta-glucan receptor/dectin-1), represent full-length and stalkless isoforms, respectively, and both mediate the recognition of yeast particles in a beta-glucan-dependent manner ( 16). The human homologue is expressed by cells similar to those in the mouse as well as by peripheral B cells and eosinophils ( 17). Human dectin-1 undergoes cell-specific isoform expression during monocyte maturation. Monocytes express both BGR-A and BGR-B, but during maturation to M{phi}, the expression levels of BGR-A decrease with time. Immature DC express high levels of both isoforms; however, DC lose the expression of both isoforms when matured with LPS ( 17).

In this paper we have characterized two isoforms in mice that are identical in structure and function to the two most common human isoforms, suggesting conservation of gene function between the species. The two isoforms exhibited differences in their ability to recognize zymosan and to induce cellular responses upon zymosan recognition. These results are the first evidence that dectin-1 isoforms are functionally different and indicate that differential isoform usage in mouse and human cells may represent a mechanism of regulating cellular responses to beta-glucans. It also suggests that differences in the regulation of isoform usage may influence the inflammatory response to fungal pathogens.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Primary macrophage cultures

Mice used in this study (C57BL/6, B10.BR, C3H/HeN, CBA/Ca, 129/SvEv, and BALB/c) were bred within our own institutional colonies, sex matched, and between 8 and 12 wk of age at the time of study. Animals were kept and handled in accordance with institutional guidelines. Thioglycolate-elicited peritoneal M{phi} were isolated 5 days after i.p. injection of 1 ml of 4% (w/v) Brewer’s thioglycolate medium (BD Biosciences). Primary M{phi} were cultured overnight in OptiMEM-I (Invitrogen Life Technologies) with 50 IU/ml penicillin, 50 ml/ml streptomycin, and 2 mM L-glutamine (OptiMEM medium) at 37°C in 5% CO2.

Cell lines and growth conditions

All cell lines were obtained from the cell bank of the Sir William Dunn School of Pathology. NIH-3T3 fibroblasts and the HEK293T-based Phoenix ecotropic retroviral packaging cell line (a gift from Dr. G. Nolan, Stanford University, Stanford, CA) were maintained in DMEM (Invitrogen Life Technologies) supplemented with 10% heat-inactivated FCS, 100 IU/ml penicillin, 0.1 mg/ml streptomycin, and 2 mM L-glutamine. RAW264.7 cells were grown in RPMI 1640 medium (Invitrogen Life Technologies) supplemented as described above. All cell lines were grown at 37°C in 5% CO2. BGR-A and BGR-B NIH-3T3 cells were generated and maintained as described by Willment et al. ( 16).

Cloning, sequencing, and generation of stable cell lines

All routine nucleic acid manipulation techniques were performed essentially as described by Sambrook et al. ( 18). RNA was isolated from resident or thioglycolate-elicited peritoneal M{phi} of different mouse strains using the RNeasy spin protocol (Qiagen). cDNA synthesis was performed using an Advantage RT-PCR kit (BD Biosciences) with oligo(dT) primers (Sigma-Aldrich) as described by the manufacturer. Dectin-1 isoforms were amplified by PCR from the cDNA using the following 5' and 3' primers, respectively: 5'-ACCGGATCCCAAGTGCTCTGCCTACCTAG-3' and 5'-AGGGGATCCCACCATCTTTATATTCTCACATAC-3'. The following primers were used to generate hemagglutinin (HA)-tagged versions of the isoforms: 5'-AAGGAATTCACGCATAATCGGGGACATCGTATGGGTACAGTTCCTTCTCACAGATAC and 5'-AAGGAATTCCACCATGAAATATCACTCTCATATAG-3'. PCR products were separated by electrophoresis on a 1% (w/v) agarose gel and purified by means of a QIAquick Gel Extraction kit (Qiagen). The isoforms were cloned into pCR3.1 vector (Invitrogen Life Technologies) and sequenced by the Sir William Dunn School of Pathology sequencing service.

Stable cell lines were made by subcloning into the retroviral vector pFB(neo) (Stratagene) and were transfected into Phoenix ecotropic packaging cells using FuGene 6 (Roche). Retroviral supernatants were collected after 48 h and used to transduce NIH-3T3 or RAW264.7 cell lines in the presence of 5 µg/ml polybrene (Sigma-Aldrich) as previously described ( 7, 14, 19, 20). RAW264.7 cells were pretreated with 0.2 µg/ml tunicamycin (Sigma-Aldrich) to increase transduction efficiency. Stable cell lines were selected and maintained in 0.6 mg/ml geneticin (Sigma-Aldrich).

Flow cytometry assays

For FACS assays 2.5 x 105 cells/well were cultured overnight in 24-well tissue culture plates. Cells were cooled to 4°C and incubated in a blocking buffer (5% heat-inactivated rabbit serum, 0.5% BSA, 5 mM EDTA, and 2 mM NaN3) for 30 min at 4°C; rabbit serum was omitted from the blocking buffer when the 2.4G2 mAb was used for detection of Fc{gamma}RII/III. Cells were incubated with primary Abs for 1 h at 4°C in blocking buffer and washed three times with a washing buffer containing 0.5% BSA, 5 mM EDTA, and 2 mM NaN3. Secondary Ab was incubated with the cells for 1 h at 4°C in blocking buffer, and the cells were washed three times as described above. Cells were detached by scraping in washing buffer, fixed in 1% formaldehyde, and analyzed on a FACScan using CellQuest software. The primary Abs used in this study were 2A11 (rat IgG2b anti-mouse dectin-1 mAb) ( 8); GE2 (mouse IgG1 anti-human dectin-1 mAb ( 17); 5D3 (rat IgG2a anti-mannose receptor mAb ( 21)); 5C6 (rat IgG2b anti-CD11b mAb) ( 22); 2.4G2 (rat IgG2b anti-Fc{gamma}RII/III mAb; BD PharMingen); rat IgG2a, rat IgG2b, and mouse IgG1 isotype controls with irrelevant specificity (produced in-house); and biotinylated rat IgG1 isotype control (BD Pharmingen).

Alexa 488-labeled goat anti-rat IgG (Molecular Probes) or Alexa 488-labeled anti-mouse IgG (Molecular Probes) were used as secondary Abs to detect unlabeled primary Abs.

C. albicans culture and labeling

C. albicans 5c5314 strain was cultured in 50 ml of Sabouraud’s dextrose broth (Difco Laboratories) in a shaking culture for 16 h at 37°C. C. albicans was fluorescently labeled with Rhodamine Green X (Molecular Probes) for 1 h at room temperature. C. albicans binding assays where performed as described below.

Binding and TNF-{alpha} assays

Cells were plated at 2.5 x 105 cells/well in 24-well plates in the appropriate medium and cultured for 12 h. Cells were cooled to 4°C and washed three times with prechilled PBS. To block dectin-1, 100 µg/ml glucan phosphate in medium was added for 30 min at 4°C before adding FITC-labeled zymosan (Molecular Probes). Zymosan was added at a M{phi}:particle ratio of 1:20 and was incubated for 1 h at 4°C or for 30 min at 37°C. After incubation, unbound particles were removed by washing four times with prechilled PBS. The cells in complete medium were incubated for an additional 3 h at 37°C in 5% CO2, after which samples of supernatant were taken for TNF-{alpha} measurements. The amount of FITC-zymosan associated with the cells was quantified after lysis with 3% (w/v) Triton X-100 solution (pH 8) using a Fluoroscan II fluorometer (Titer-Tek) at an excitation:emission ratio of 485:538 nm.

TNF-{alpha} was measured using the OptEIA murine TNF-{alpha} ELISA kit (BD Biosciences) as described by the manufacturer. All experiments were repeated at least three times. All data are presented as the mean ± SEM from a representative or pooled experiments. Statistics were calculated using GraphPad PRISM (version 4). One-way ANOVA with Bonferroni multiple comparison test was applied unless stated differently. To ensure that differences in cell plating did not contribute to differences in results, the number of cells plated in parallel wells was determined by incubation with CFSE from Molecular Probes using the Fluoroskan II fluorometer (data not shown).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Differences in zymosan association and dectin-1 expression between BALB/c and C57BL/6 elicited peritoneal M{phi}

While studying the function of dectin-1 in thioglycolate-elicited peritoneal M{phi} from BALB/c and C57BL/6 mouse strains, we found significant differences in their zymosan recognition. The recognition assays were performed at 4 and 37°C. At 4°C, BALB/c M{phi} bound zymosan significantly better than C57BL/6 M{phi} (Fig. 1A); however, at 37°C, C57BL/6 M{phi} recognition was significantly greater than that by BALB/c M{phi}. Similar results where obtained with cultured resident peritoneal M{phi} (data not shown). To block dectin-1 specifically, we added soluble glucans such as glucan phosphate (Fig. 1A) or laminarin (data not shown) ( 8, 13, 19); this significantly reduced the recognition of zymosan by macrophages isolated from both strains, indicating that dectin-1 was the main receptor involved.


Figure 1
View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 1. Comparison of BALB/c and C57BL/6 thioglycolate-elicited M{phi}. A, Ability of thioglycolate M{phi} from both strains to recognize zymosan. The contribution of dectin-1 was confirmed with the specific inhibitor glucan phosphate (GluP). The data shown are the pooled results from three independent experiments normalized to the BALB/c untreated value. Error bars indicate the SEM. *, p < 0.05. B, Representative FACS profiles demonstrating the surface expression of dectin-1, mannose receptor (MR), complement receptor 3 (CR3), and Fc{gamma}RII/III. The dotted histograms represent the isotype controls, the thin line represents BALB/c staining, and the thick line represents C57BL/6 staining.

 
We examined the cell surface expression levels of a number of phagocytic receptors previously thought to play a role in zymosan recognition ( 23, 24), to understand these differences in zymosan recognition (Fig. 1B). Although complement receptor 3, mannose receptor, and Fc{gamma}RII/III were expressed at similar levels on M{phi} from both mouse strains, dectin-1 levels were found to be significantly higher (>5-fold) on C57BL/6 vs BALB/c M{phi}. Although these results could explain the better association of zymosan with C57BL/6 M{phi} at 37°C, it did not account for the lower zymosan binding of these cells observed at 4°C, suggesting that other, more fundamental, differences in dectin-1 may exist between the two mouse strains.

Dectin-1 isoforms

To investigate this phenomenon, we performed RT-PCR analysis on RNA isolated from M{phi} of several different mouse strains (Fig. 2A). All strains showed two different transcripts, one of the full-length dectin-1 at 813 kb (dectin-1A) and a second at 696 kb (dectin-1B). Interestingly, there seemed to be differences in the levels of the various transcripts among the different mouse strains. The mouse strains could be divided into two groups: 1) C3H/HeH, CBA/ca, and BALB/c, which had similar levels of both transcripts, and 2) C57BL/6, 129/SvEv, and B10.BR, which predominantly expressed the smaller isoform. The RAW264.7 macrophage cell line was produced from BAB-14 mice, a congenic strain with C57BL/ka-derived IgCH on a BALB/c background ( 25); this cell line was found to express both isoforms at the transcript level, but is known to express only low levels of protein on the cell surface ( 7, 16).


Figure 2
View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 2. Isoforms of dectin-1 are differentially expressed by various mouse strains. A, RT-PCR analysis of resident (Res) and thioglycolate-elicited peritoneal M{phi} from different mouse strains shows the expression of two isoforms of dectin-1. Plasmids containing dectin-1A and dectin-1B were used as positive controls. H2O was used as a negative control. B, Schematic representation of the dectin-1-encoded peptides, showing a cytoplasmic domain (CD), a transmembrane domain (TMD), a stalk region (STALK), and a carbohydrate recognition domain (CRD).

 
To determine the nature of the various transcripts, we cloned both isoforms from BALB/c cDNA. Dectin-1A corresponded to the full-length dectin-1 described previously ( 8), whereas dectin-1B lacked the 39 aa from the stalk region encoded by exon 3 (Fig. 2B).

Zymosan recognition by dectin-1 isoforms expressed in NIH-3T3 fibroblasts

As mentioned above, zymosan is commonly used to study the proinflammatory response, and it exhibits high specificity for dectin-1 ( 7, 8). We used zymosan for both cell binding and stimulation assays. To determine the expression and function of the different isoforms, we generated NIH-3T3 fibroblast transductants expressing these constructs. Flow cytometric analysis demonstrated that both isoforms were expressed on the surface of NIH-3T3 cells at similar levels (Fig. 3A). We next compared the abilities of the transductants to recognize zymosan at different temperatures (Fig. 3B). Although there was similar zymosan association of the two isoforms at 37°C, dectin-1A bound more zymosan than dectin-1B at lower temperatures. Indeed, there was an obvious correlation between temperature and zymosan binding for dectin-1B. In all experiments the addition of the soluble glucans, glucan phosphate (Fig. 3B) and laminarin (data not shown), reduced binding to background levels, confirming the glucan specificity of the interaction. These data show that the lack of a stalk region in dectin-1 significantly reduces binding efficiency at 4, 25, and 30°C, an effect that is overcome at 37°C.


Figure 3
View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 3. Dectin-1 isoforms show differences in zymosan recognition. A, FACS profile of live NIH-3T3 cells stably expressing the two isoforms of dectin-1 at the surface. B, Zymosan recognition of transduced cells at different temperatures; control cells were transduced with empty vector. The contribution of dectin-1 was confirmed with the specific inhibitor glucan phosphate (GluP). These data are representative of three independent experiments. Error bars indicate the SEM. *, p < 0.05.

 
Zymosan association and TNF-{alpha} production by RAW264.7 M{phi} overexpressing the dectin-1 isoforms

Dectin-1 is known to induce TNF-{alpha} production upon zymosan recognition ( 7, 10). To assess whether both isoforms were able to produce a cellular response upon zymosan recognition, we stably transduced RAW264.7 M{phi} with dectin-1A and dectin-1B. Although this cell line expresses the transcripts for both isoforms (Fig. 2A), dectin-1 protein is only found at low levels on the cell surface ( 7). FACS analysis showed that dectin-1B was expressed at higher levels than dectin-1A (Fig. 4A, left panel). To ensure that our results were not affected by this difference in expression, we generated a second set of transduced cell lines expressing human influenza virus HA-tagged isoforms. In contrast to the cells expressing the untagged receptors, these cells were found to express the dectin-1A-HA isoform at higher levels than the dectin-1B-HA using both the 2A11 mAb (Fig. 4A) and an anti-HA mAb (not shown).


Figure 4
View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 4. Dectin-1 isoforms show differences in TNF-{alpha} production. A, FACS profile of RAW264.7 cell lines stably expressing the dectin-1 isoforms with or without HA tags, using 2A11 for detection. MFI, mean fluorescence intensity. B, Zymosan binding and TNF-{alpha} production by transduced cells at 37°C. C, Relationship of TNF-{alpha} and zymosan recognition by the two isoforms expressed as a ratio of TNF-{alpha}:zymosan recognition at 37°C. RAW254.7 stably expressing empty vector was used as the control. The data shown are the pooled average of at least four independent experiments, normalized to the dectin-1A value. Error bars indicate the SEM. *, p < 0.05. D, Live C. albicans association with RAW264.7 cells transduced with either dectin-1A or dectin-1B. The data shown are representative of three independent experiments performed in triplicate. Error bars indicate the SEM.

 
We then examined the ability of these transductants to recognize and respond to zymosan (Fig. 4B). At 4°C, RAW264.7 cells transduced with dectin-1A isoforms showed better binding than cells transduced with the dectin-1B isoforms (data not shown), consistent with the data obtained in NIH-3T3 cells. The differences between the abilities of the two isoforms to recognize zymosan at 4 and 37°C was also observed when live C. albicans was used in binding assays (Fig. 4D). At 37°C, the relative amount of zymosan binding by the various isoforms was approximately dependent on the level of receptor expression. However, compared with the amount of zymosan bound, the dectin-1B isoform always induced higher levels of TNF-{alpha} in both cell lines. This is clearly demonstrated by expressing the TNF-{alpha} as at ratio of the amount of zymosan association (Fig. 4C). Thus, these data show that the presence or the absence of the stalk of dectin-1 influences the cellular response to zymosan.

Temperature dependency of zymosan recognition by human dectin-1 isoforms

Because humans express equivalent dectin-1 isoforms ( 16, 17), we determined whether they exhibited similar functional characteristics. Although BGR-A and BGR-B were expressed at different levels in stably transduced NIH-3T3 cells (Fig. 5A), the recognition of zymosan by the stalkless isoform of human dectin-1 (BGR-B), but not the full-length BGR-A, was temperature dependent (Fig. 5B). The short isoforms of both mice and humans exhibited ~10-fold greater recognition at 37°C compared with that at 4°C (see Figs. 3B and 5B), whereas recognition by the full-length dectin-1 was similar at both temperatures. To compare the mouse and human isoforms directly, we assessed the binding of each isoform at 4 and 37°C as a ratio (Fig. 5C). These data confirm a role for the stalk region in binding efficiency and show that the human isoforms behave like the mouse isoforms.


Figure 5
View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 5. Human dectin-1 isoforms show differences in the ability to recognize zymosan. A, Representative FACS profile of live NIH-3T3 cells stably expressing the two main isoforms of human dectin-1 (BGR-A and BGR-B). B, Zymosan recognition by transduced cells at 4 and 37°C. NIH-3T3 cells stably expressing empty vector were used as control cells. These data are representative of three independent experiments. C, Ratio of zymosan recognition at 37:4°C, showing the temperature dependence of zymosan recognition of stalkless human and murine dectin-1. The data shown are the pooled average of at least three independent experiments. Error bars indicate the SEM.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
We observed that M{phi} from different mouse strains exhibited differences in their ability to bind zymosan, and RT-PCR analysis identified differential expression of two dectin-1 transcripts. These transcripts correspond to two isoforms of dectin-1, a full-length dectin-1A that contains a C-type lectin-like domain, a short stalk region, a transmembrane region, and a cytoplasmic immunoreceptor tyrosine-based activation-like motif, as previously described ( 8); and a stalkless dectin-1B isoform, which results from omission of exon 3 of six exons. BALB/c, C3H/HeH, and CBA/ca mice expressed transcripts for both isoforms in equal amounts, whereas C57BL/6, 129/SvEv, and B10.BR expressed predominantly the smaller transcript. The BALB/c-containing group of mice are more closely related ( 26), suggesting that isoform usage in mice is genetically determined. Binding studies showed that both isoforms are equally efficient in recognizing zymosan at 37°C; however, the ability to recognize zymosan at 4°C is greatly compromised in dectin-1B (Fig. 3B). This finding explains the differences in zymosan recognition between BALB/c and C57BL/6 primary M{phi}. At 37°C, C57BL/6 mice recognize zymosan slightly better than BALB/c M{phi}, which can be explained by their higher surface expression of dectin-1 (Fig. 1B). The significantly reduced recognition of zymosan by C57BL/6 M{phi} at 4°C can be explained by their predominant expression of dectin-1B. This suggests that the dectin-1 isoform expressed by M{phi} may influence their ability to interact with fungal particles.

Binding at 4°C is commonly used to study receptor binding efficiency. However, we have demonstrated that the cell-bound stalkless dectin-1B (both human and murine) is less efficient in recognition of this particulate ligand at 4°C than at 37°C, whereas full-length dectin-1A does not exhibit temperature-dependent recognition of zymosan. The temperature of 4°C is not physiological; it is known to change membrane viscosity, interfering with membrane fluidity ( 27), and may be a factor that influences the efficiency of zymosan recognition by dectin-1B. Recently, Gantner et al. ( 28) suggested that C57BL/6 M{phi} do not use dectin-1 to recognize C. albicans at 4°C and that other receptors may be involved in the initial binding. Our data show that the 4°C assay does not give an accurate measure of the contribution of dectin-1 to yeast recognition when dectin-1B is the predominant isoform, as it is in C57BL/6. Indeed, we have found that dectin-1 is involved in the recognition of C. albicans by C57BL/6 M{phi} at 37°C (S. E. M. Heinsbroek, manuscript in preparation). Human M{phi}, which express mainly BGR-B, also have poor recognition of C. albicans or zymosan at 4°C (our unpublished observations), but exhibit dectin-1 dependency for recognition and response at 37°C ( 17).

We show in this study that although both isoforms are able to induce TNF-{alpha} production upon zymosan recognition, dectin-1B-expressing cells produce significantly more TNF-{alpha} (Fig. 4). This suggests that TNF-{alpha} induction is influenced by dectin-1 structure. Although the mechanism behind this effect is unclear, C-type lectins related to dectin-1 are often able to form dimers through their stalk region ( 29), and it is possible that the increased proinflammatory signaling may relate to the ability of this receptor to form multimers. However, this effect may also be the result of differing interactions with other molecules, such as TLR2 ( 7, 10) and CD63 ( 30), which are known to interact with dectin-1. Interestingly, although BALB/c and C57BL/6 mice are both C. albicans-resistant strains, they show a substantial difference in the production of defensins, chemokines, and cytokines upon gastric candidiasis ( 31), which may reflect the differential isoform usage in these strains. We have also found that the dectin-1-coding sequence differs between BALB/c and C57BL/6 by three single nucleotide polymorphisms, which result in the amino acid substitutions R37Q, S73P, and V165A (from BALB/c to C57BL/6). Preliminary data, however, suggest that these single nucleotide polymorphisms do not interfere with zymosan recognition (data not shown).

The discovery of different functional outcomes after ligation of the murine dectin-1 isoforms has relevance for the human receptor, which is alternatively spliced into similar isoforms that possess the same temperature-dependent binding properties. Because the expression of these isoforms is cell and activation specific ( 17), it is likely that regulation of isoform usage represents a mechanism of control that is important for the function of dectin-1 in the immune system.


   Acknowledgments
 
We thank the staff of our animal facility for care of the animals used in this study.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the Wellcome Trust, the Medical Research Council (United Kingdom), and the E. P. Abraham Cephalosporin fund. G.D.B. is a Wellcome Trust International Senior Research Fellow in Biomedical Science in South Africa. P.R.T. is a Wellcome Trust Research career development fellow. This work was also supported in part by U.S. Public Health Service Grants GM53522 from the National Institute of General Medical Sciences and AI45829 from the National Institute of Allergy and Infectious Diseases (to D.W.). Back

2 S.G. and G.D.B. contributed equally to senior authorship. Back

3 Address correspondence and reprint requests to Dr. Gordon D. Brown, Institute of Infectious Disease and Molecular Medicine, University of Cape Town, Observatory, 7925 Cape Town, South Africa. E-mail address: gordon.brown{at}mweb.co.za Back

4 Abbreviations used in this paper: M{phi}, macrophage; BGR, beta-glucan receptor/dectin-1; DC, dendritic cell; HA, hemagglutinin. Back

Received for publication July 8, 2005. Accepted for publication February 13, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Janeway, C. A., Jr. 1992. The immune system evolved to discriminate infectious nonself from noninfectious self. Immunol. Today 13: 11-16. [Medline]
  2. Brown, G. D., S. Gordon. 2003. Fungal beta-glucans and mammalian immunity. Immunity 19: 311-315. [Medline]
  3. Williams, D. L., A. Mueller, W. Browder. 1996. Glucan-based macrophage stimulators. Clin. Immunother. 5: 392-399.
  4. Czop, J. K.. 1986. The role of beta-glucan receptors on blood and tissue leukocytes in phagocytosis and metabolic activation. Pathol. Immunopathol. Res. 5: 286-296. [Medline]
  5. Sundstrom, P.. 2002. Adhesion in Candida spp. Cell. Microbiol. 4: 461-469. [Medline]
  6. Di Carlo, F. J., J. V. Fiore. 1958. On the composition of zymosan. Science 127: 756-757. [Free Full Text]
  7. Brown, G. D., J. Herre, D. L. Williams, J. A. Willment, A. S. Marshall, S. Gordon. 2003. Dectin-1 mediates the biological effects of beta-glucans. J. Exp. Med. 197: 1119-1124. [Abstract/Free Full Text]
  8. Brown, G. D., P. R. Taylor, D. M. Reid, J. A. Willment, D. L. Williams, L. Martinez-Pomares, S. Y. Wong, S. Gordon. 2002. Dectin-1 is a major beta-glucan receptor on macrophages. J. Exp. Med. 196: 407-412. [Abstract/Free Full Text]
  9. Brown, G. D., S. Gordon. 2001. Immune recognition: a new receptor for beta-glucans. Nature 413: 36-37. [Medline]
  10. Gantner, B. N., R. M. Simmons, S. J. Canavera, S. Akira, D. M. Underhill. 2003. Collaborative induction of inflammatory responses by dectin-1 and Toll-like receptor 2. J. Exp. Med. 197: 1107-1117. [Abstract/Free Full Text]
  11. Rogers, N. C., E. C. Slack, A. D. Edwards, M. A. Nolte, O. Schulz, E. Schweighoffer, D. L. Williams, S. Gordon, V. L. Tybulewicz, G. D. Brown, et al 2005. Syk-dependent cytokine induction by dectin-1 reveals a novel pattern recognition pathway for C type lectins. Immunity 22: 507-517. [Medline]
  12. Underhill, D. M., E. Rossnagle, C. A. Lowell, R. M. Simmons. 2005. Dectin-1 activates Syk tyrosine kinase in a dynamic subset of macrophages for reactive oxygen production. Blood 106: 2543-2550. [Abstract/Free Full Text]
  13. Taylor, P. R., G. D. Brown, D. M. Reid, J. A. Willment, L. Martinez-Pomares, S. Gordon, S. Y. Wong. 2002. The beta-glucan receptor, dectin-1, is predominantly expressed on the surface of cells of the monocyte/macrophage and neutrophil lineages. J. Immunol. 169: 3876-3882. [Abstract/Free Full Text]
  14. Willment, J. A., H. H. Lin, D. M. Reid, P. R. Taylor, D. L. Williams, S. Y. Wong, S. Gordon, G. D. Brown. 2003. Dectin-1 expression and function are enhanced on alternatively activated and GM-CSF-treated macrophages and are negatively regulated by IL-10, dexamethasone, and lipopolysaccharide. J. Immunol. 171: 4569-4573. [Abstract/Free Full Text]
  15. Yokota, K., A. Takashima, P. R. Bergstresser, K. Ariizumi. 2001. Identification of a human homologue of the dendritic cell-associated C-type lectin-1, dectin-1. Gene 272: 51-60. [Medline]
  16. Willment, J. A., S. Gordon, G. D. Brown. 2001. Characterization of the human beta-glucan receptor and its alternatively spliced isoforms. J. Biol. Chem. 276: 43818-43823. [Abstract/Free Full Text]
  17. Willment, J. A., A. S. Marshall, D. M. Reid, D. L. Williams, S. Y. Wong, S. Gordon, G. D. Brown. 2005. The human beta-glucan receptor is widely expressed and functionally equivalent to murine dectin-1 on primary cells. Eur. J. Immunol. 35: 1539-1547. [Medline]
  18. Sambrook, J., E. F. Fritsch, R. D. Campbell. 1989. Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratory Press, Plainview.
  19. Taylor, P. R., G. D. Brown, J. Herre, D. L. Williams, J. A. Willment, S. Gordon. 2004. The role of SIGNR1 and the beta-glucan receptor (dectin-1) in the nonopsonic recognition of yeast by specific macrophages. J. Immunol. 172: 1157-1162. [Abstract/Free Full Text]
  20. Marshall, A. S., J. A. Willment, H. H. Lin, D. L. Williams, S. Gordon, G. D. Brown. 2004. Identification and characterization of a novel human myeloid inhibitory C-type lectin-like receptor (MICL) that is predominantly expressed on granulocytes and monocytes. J. Biol. Chem. 279: 14792-14802. [Abstract/Free Full Text]
  21. Martinez-Pomares, L., D. M. Reid, G. D. Brown, P. R. Taylor, R. J. Stillion, S. A. Linehan, S. Zamze, S. Gordon, S. Y. C. Wong. 2003. Analysis of mannose receptor regulation by IL-4, IL-10, and proteolytic processing using novel monoclonal antibodies. J. Leukocyte Biol. 73: 604-613. [Abstract/Free Full Text]
  22. Rosen, H., S. Gordon. 1987. Monoclonal antibody to the murine type 3 complement receptor inhibits adhesion of myelomonocytic cells in vitro and inflammatory cell recruitment in vivo. J. Exp. Med. 166: 1685-1701. [Abstract/Free Full Text]
  23. Ross, G. D., R. A. Thompson, M. J. Walport, T. A. Springer, J. V. Watson, R. H. Ward, J. Lida, S. L. Newman, R. A. Harrison, P. J. Lachmann. 1985. Characterization of patients with an increased susceptibility to bacterial infections and a genetic deficiency of leukocyte membrane complement receptor type 3 and the related membrane antigen LFA-1. Blood 66: 882-890. [Abstract/Free Full Text]
  24. Speert, D. P., S. C. Silverstein. 1985. Phagocytosis of unopsonized zymosan by human monocyte-derived macrophages: maturation and inhibition by mannan. J. Leukocyte Biol. 38: 655-658. [Abstract]
  25. Raschke, W. C., S. Baird, P. Ralph, I. Nakoinz. 1978. Functional macrophage cell lines transformed by Abelson leukemia virus. Cell 15: 261-267. [Medline]
  26. Beck, J. A., S. Lloyd, M. Hafezparast, M. Lennon-Pierce, J. T. Eppig, M. F. Festing, E. M. Fisher. 2000. Genealogies of mouse inbred strains. Nat. Genet. 24: 23-25. [Medline]
  27. Frye, L. D., M. Edidin. 1970. The rapid intermixing of cell surface antigens after formation of mouse-human heterokaryons. J. Cell Sci. 7: 319-335. [Abstract/Free Full Text]
  28. Gantner, B. N., R. M. Simmons, D. M. Underhill. 2005. Dectin-1 mediates macrophage recognition of Candida albicans yeast but not filaments. EMBO J. 24: 1277-1286. [Medline]
  29. Marshall, A. S., S. Gordon. 2004. Commentary: C-type lectins on the macrophage cell surface: recent findings. Eur. J. Immunol. 34: 18-24. [Medline]
  30. Mantegazza, A. R., M. M. Barrio, S. Moutel, L. Bover, M. Weck, P. Brossart, J. L. Teillaud, J. Mordoh. 2004. CD63 tetraspanin slows down cell migration and translocates to the endosomal-lysosomal-MIICs route after extracellular stimuli in human immature dendritic cells. Blood 104: 1183-1190. [Abstract/Free Full Text]
  31. Schofield, D. A., C. Westwater, E. Balish. 2005. Divergent chemokine, cytokine and beta-defensin responses to gastric candidiasis in immunocompetent C57BL/6 and BALB/c mice. J. Med. Microbiol. 54: 87-92. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
M. Rosas, K. Liddiard, M. Kimberg, I. Faro-Trindade, J. U. McDonald, D. L. Williams, G. D. Brown, and P. R. Taylor
The Induction of Inflammation by Dectin-1 In Vivo Is Dependent on Myeloid Cell Programming and the Progression of Phagocytosis
J. Immunol., September 1, 2008; 181(5): 3549 - 3557.
[Abstract] [Full Text] [PDF]

Home page
 Exp. Biol. Med.Home page
A. T. Borchers, A. Krishnamurthy, C. L. Keen, F. J. Meyers, and M. E. Gershwin
The Immunobiology of Mushrooms
Experimental Biology and Medicine, March 1, 2008; 233(3): 259 - 276.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. A. Rappleye, L. G. Eissenberg, and W. E. Goldman
Histoplasma capsulatum {alpha}-(1,3)-glucan blocks innate immune recognition by the beta-glucan receptor
PNAS, January 23, 2007; 104(4): 1366 - 1370.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
F. Meyer-Wentrup, C. G. Figdor, M. Ansems, P. Brossart, M. D. Wright, G. J. Adema, and A. B. van Spriel
Dectin-1 Interaction with Tetraspanin CD37 Inhibits IL-6 Production
J. Immunol., January 1, 2007; 178(1): 154 - 162.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heinsbroek, S. E. M.
Right arrow Articles by Brown, G. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heinsbroek, S. E. M.
Right arrow Articles by Brown, G. D.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS