|
|
||||||||


* Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London, United Kingdom; and
Department of Immunology, Toho University School of Medicine, Tokyo, Japan
| Abstract |
|---|
|
|
|---|
and IL-4 mRNA accumulation was comparable in wild-type and plt/plt mice. In contrast, accumulation of mRNA for IL-10 was elevated in plt/plt mice. In addition, plt/plt mice mounted a delayed hepatic granulomatous response and fewer effector T cells migrated into the liver. Taken together, we conclude that DC migration from the MZ to the PALS is necessary for full activation of DC and the optimal induction of protective immunity against L. donovani. | Introduction |
|---|
|
|
|---|
Infection of mice with amastigotes of Leishmania donovani is a well-established experimental model of visceral leishmaniasis ( 12). Injected amastigotes are mostly phagocytosed by macrophages in the marginal zone (MZ) of the spleen, and perhaps rarely by DC ( 13). We and other groups have shown previously that early production of IL-12, localized by immunochemistry to DC in the T cell area of the spleen (the periarteriolar lymphoid sheath (PALS)), plays a key role in the innate and Ag-specific immune response against L. donovani ( 14, 15). IL-12 plays a key role in skewing naive T cells into IFN-
-producing Th1 cells, and IFN-
is essential for the activation of macrophages and elimination of parasites ( 16, 17). These findings suggest that DC in the MZ, which either acquire parasites or parasite-derived Ags, are stimulated to produce IL-12p40 and IL-12p70, migrate into the PALS, and induce effector T cells. However, the sequence of such events, at which the site of IL-12 induction is initiated, which cytokines regulate DC migration in this context, and the requirement for DC migration in the priming of host protective T cells all remain unknown.
To address some of these questions, we have now investigated the course of L. donovani infection using CCL19/21-deficient plt/plt mice. We demonstrate that plt/plt mice are more susceptible to L. donovani infection than normal mice. DC activation is limited early after infection, accompanied by lack of DC migration from the MZ to the PALS. These defects in early DC activation in plt/plt mice were mirrored by enhanced susceptibility to infection and elevated IL-10 mRNA accumulation and, in the liver, granuloma formation was delayed and effector CD4+ and CD8+ T cell recruitment limited. Taken together, these data indicate that chemokine-dependent encounters between DC and T cells are critical for optimal protection against L. donovani infection.
| Materials and Methods |
|---|
|
|
|---|
The plt/plt mice backcrossed to the C57BL/6 (B6) background were provided by H. Hengartner and T. Junt (University of Zurich, Switzerland) and bred at the London School of Hygiene and Tropical Medicine under barrier conditions. B6 mice were purchased from Charles River Laboratories and were housed under specific pathogen-free conditions. L. donovani (LV9) amastigotes were isolated from infected hamsters, as previously described ( 18). Mice were infected at 68 wk of age by injecting 2 x 107 or 2 x 108 amastigotes i.v. via the lateral tail vein. Mice were killed by cervical dislocation and parasite burden in livers and spleens determined from Giemsa-stained impression smears. Parasite burden was expressed in Leishman-Donovan units ( 18). A total of 500 ng of pertussis toxin (PTX; List Biological Laboratories) in saline was administrated by i.p. injection twice, at 1 and 3 days before L. donovani infection. All animal procedures were approved by the London School of Hygiene and Tropical Medicine Animal Procedures Ethics Committee and under license from the U.K. Home Office.
Flow cytometry
Spleens were harvested and digested in RPMI 1640 (Invitrogen Life Technologies) containing 0.05% collagenase (Worthington Biochemical) and 100 µg/ml DNase I (Sigma-Aldrich) at 37°C for 30 min. After washing with calcium-free medium, cells were stained for FITC-, PE-labeled, or biotinylated CD11c (HL3), I-Ab (M5/117 and 2G9), CD40 (3/23), CD80 (16-10A1), and CD86 (GL1) (BD Pharmingen), followed by incubation with allophycocyanin-labeled streptavidin. Cells were analyzed using a FACSCalibur (BD Biosciences).
Immunohistochemistry
Immunohistochemistry was performed on 6-mm frozen sections, as described before ( 19). Primary Abs were purified or biotinylated HL3 (mouse CD11c), 53-6.7 (CD8a), RM4-5 (CD4), Gr-1 (RB6-8C5) (BD Pharmingen), CI:A3-1 (anti-F4/80), FA-11 (CD68), 3D6.112 (anti-CD169) (Serotec), C17.8 (anti-IL-12p40), ER-TR9 (anti-specific ICAM-3 grabbing non-integrin-related 1; a gift from G. Kraal, Free University, Amsterdam, The Netherlands), or hamster antisera to L. donovani amastigotes. Secondary Abs were biotinylated rabbit anti-rat IgG (Vector Laboratories), 10% mouse serum-containing goat anti-hamster IgG (for L. donovani; Vector Laboratories), biotinylated rabbit anti-rat Ig (for confocal microscope; DakoCytomation), Alexa 488-conjugated goat anti-hamster IgG, or Alexa 546-conjugated streptavidin (Molecular Probes). As appropriate, sections were developed with Vector Elite-ABC kit, followed by Vector 3,3'-diaminobenzidine substrate kit (Vector Laboratories), or directly viewed using a Zeiss LSM510 confocal microscope. In some experiments, mice were injected i.v. with 200 µl of 5% (v/v in 0.9% NaCl) india ink (Rowney) to allow visualization of MZ macrophages in the spleen.
Restimulation assay
Spleens from mice infected for 7 days were digested with collagenase, as described above. Dead cells and RBC were removed using a Histopaque 1083 (Sigma-Aldrich) density gradient. A total of 2 x 105 spleen cells was incubated with or without 2 x 106 paraformaldehyde-fixed L. donovani amastigotes in 10% FCS (Sigma-Aldrich) containing RPMI 1640 medium in a 24-well plate at 37°C for 72 h. For proliferation assays, the cells were pulsed with 1 µCi of [3H]thymidine for final 6 h of culture and then harvested onto glass fiber filters. The incorporated [3H]thymidine was determined by liquid scintillation spectrometry ( 20). Supernatants from the assays were collected after a 72-h incubation. IFN-
-specific ELISA was performed using IFN-
ELISA kit (R&D Systems), as described previously ( 20).
Evaluation of granulomatous response
Paraffin sections of liver tissue, stained with H&E, were prepared by conventional methods. In some cases, frozen sections of liver tissue were stained with hamster anti-L. donovani serum. The granuloma response in the infected livers was graded as follows: 1) an infected Kupffer cell without cellular infiltrate; 2) an immature granuloma composing an infected Kupffer cell surrounded by a few inflammatory cells, but without organization; 3) a mature granuloma having an organized structure; or 4) an empty granuloma, in which amastigotes had been killed as a result of effective antileishmanial immunity ( 21). At least 2550 high magnification fields per mouse were counted and evaluated.
Real-time RT-PCR
RNA was isolated from spleen tissue using an RNeasy Mini Kit with on-column DNase digestion (Qiagen), according to the manufacturers instructions. RNA was reverse transcribed into cDNA, as described previously ( 22). Oligonucleotides (5'-3') used for specific amplification were: IL-4, CCTCACAGCAACGAAGAACA (sense) and TGGACTCATTCATGGTGCAG (antisense); IL-10, AGGGTTACTTGGGTTGCCAA (sense) and CACAGGGGAGAAATCGATGA (antisense); IL-12p40, GGAAGCACGGCAGCAGAATA (sense) and AACTTGAGGGAGAAGTAGGAATGG (antisense); IFN-
, CCTCCTGCGGCCTAGCTC (sense) and TAACAGCCAGAAACAGCCATG (antisense); and for amplification of the housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (HPRT) were GTTGGATACAGGCCAGACTTTGTTG (sense) and GATTCAACCTTGCGCTCATCTTAGGC (antisense). The number of cytokines and HPRT cDNA molecules in each sample was calculated by real-time RT-PCR using QuantiTect SYBR green master mix (Qiagen) and an ABI prism 7000 (Applied Biosystems), according to the manufacturers instructions. Standard curves were constructed with known amounts of cytokines and HPRT cDNA, and the number of cytokine molecules per 1000 HPRT molecules in each sample was calculated.
| Results |
|---|
|
|
|---|
First, we determined the outcome of infection with L. donovani in plt/plt mice compared with wild-type B6 mice. Fig. 1A shows the outcome of infection in the liver, an organ associated with acquisition of cell-mediated immunity to L. donovani and thus with the capacity to clear intracellular amastigotes ( 23). Compared with B6 mice, liver parasite burdens were significantly higher in plt/plt mice at day 28 postinfection (p.i.), and although these mice eventually were able to resolve hepatic infection, even at day 56, amastigote numbers in the tissue remained somewhat higher than seen in B6 mice. In contrast to the curing response observed in the liver, the spleen is a site of parasite persistence, extending over the 56-day time period studied. Strikingly, although parasite numbers were equivalent in these two mouse strains at days 14 and 28, plt/plt mice ultimately failed to exert control over parasite growth, and at day 56 spleen parasite burden was
5-fold higher in plt/plt mice than in B6 mice (Fig. 1B). These data indicate that plt/plt mice are more susceptible to L. donovani infection than B6 mice.
|
In the spleen, L. donovani amastigotes were phagocytosed mainly by macrophages in the MZ ( 13). However, we have demonstrated previously that plt/plt mice are deficient in MZ macrophages (MZM), a highly phagocytic subset of macrophages in the MZ ( 24). To determine whether the lack of MZM influenced initial splenic infection in plt/plt mice, we determined the number and location of amastigotes in the spleen at 1 h postinfection, when blood clearance is essentially complete ( 13). Double immunohistochemistry to identify amastigotes within subsets of splenic macrophages illustrated that CD68+ macrophages in the MZ, but not F4/80+ red pulp macrophages, are mainly responsible for uptake of L. donovani in plt/plt mice (Fig. 2A and data not shown). The localization (Fig. 2B, left panel) and absolute number (Fig. 2B, right panel) of amastigotes in the spleen of plt/plt mice were not altered compared with wild-type mice, with uptake being predominantly within the MZ in both strains. Thus, the deficiency of MZM in plt/plt mice does not compromise initial splenic infection, and most amastigotes are taken up by alternate CD68+ macrophages in the MZ.
|
The pattern of infection observed in plt/plt mice was remarkably similar to that previously described in studies in which IL-12p40 was targeted by neutralizing Abs ( 14) or in IL-12p40-deficient mice ( 15). As IL-12p40 is produced solely by DC in the early phase of immunity to L. donovani ( 13), we examined whether IL-12p40 responses were intact in plt/plt mice, using immunohistochemistry to identify both the number and localization of cells producing this cytokine. IL-12p40+ cells were rarely observed in naive mice of either strain. Five hours after infection of B6 mice, IL-12p40+ cells were readily observed in the spleen, mainly localizing, as previously described ( 13), to the deep periarteriolar region (Fig. 2C). In contrast, few IL-12p40+ cells were identified in the spleens of plt/plt mice, and those that were seen were localized in the MZ (Fig. 2D). To quantify this observation in more detail, we scored the number of IL-12p40+ cells in multiple tissue sections from multiple mice. As shown in Fig. 2E, the frequency of IL-12p40+ cells per white pulp section was significantly reduced in plt/plt mice compared with B6 mice. As an independent means of evaluating the IL-12p40 response, we used real-time RT-PCR to determine the accumulation of IL-12p40 mRNA in spleen samples from naive and infected B6 and plt/plt mice. This analysis confirmed at the level of mRNA expression that the IL-12p40 response of plt/plt mice was indeed significantly reduced (Fig. 2F).
To examine whether altered localization of IL-12-producing cells in plt/plt mice is associated with abnormal distribution of DC, we visualized DC in the spleen of B6 and plt/plt mice, with or without L. donovani infection. DC in noninfected B6 mice distributed mostly in the MZ, with a few found in the PALS, as previously reported ( 25) (Fig. 2G). In contrast, DC in plt/plt mice were absent from the PALS and accumulated in the MZ and red pulp ( 9) (Fig. 2H). After 5 h of infection, most DC in B6 mice had migrated into the PALS (Fig. 2I), but the distribution of DC in plt/plt mice was not altered following infection (Fig. 2J). These data demonstrate that DC in plt/plt mice fail to migrate into the PALS and rather accumulate in the MZ.
Impaired IL-12 production in PTX-treated mice
To further define the importance of chemokine-dependent migration of DC in the introduction of IL-12 production, we treated B6 mice with PTX, which blocks chemokine signaling ( 26). DC in PTX-treated mice failed to migrate from the MZ into the PALS after 5 h of L. donovani infection, and showed a scattered distribution throughout the white pulp and red pulp (data not shown). As shown in Fig. 3, IL-12 p40 mRNA accumulation did not increase in the spleen of infected B6 mice treated with PTX as compared with control infected mice. These findings further support the notion that chemokine signaling at the early stage of L. donovani infection is critical for DC migration and optimal IL-12 production from splenic DC.
|
IL-12p40 production is only one of a number of alterations that accompany the activation and maturation of splenic DC. To extend this analysis, we evaluated the expression of CD80, CD86, and CD40 on splenic CD11chighMHC-IIhigh DC isolated from naive and infected B6 or plt/plt mice. As shown in Fig. 4, CD11chighMHC-IIhigh DC isolated from B6 mice 5 h p.i. have slightly, but reproducibly increased levels of expression of CD80 and CD40 compared with naive B6 mice. In contrast, CD86 shows a more significant response in these mice. DC in plt/plt mice were comparable in their expression of CD11c and MHC-II with those in B6 mice (data not shown, Fig. 4B). However, following infection, no alteration in expression of CD80 and CD40 was observed on DC from plt/plt mice. Furthermore, although CD86 was up-regulated, the increase was relatively weak compared with that observed in B6 mice (Fig. 4B). Thus, by various criteria, DC in plt/plt mice appear to be muted in their response to L. donovani infection compared with those in B6 mice.
|
To evaluate whether the restricted activation of DC observed in plt/plt mice was translated into defective T cell priming ( 27), we isolated spleen cells from naive and infected B6 and plt/plt mice and restimulated them with L. donovani Ags in vitro. We observed that both the proliferative response (Fig. 5A) and the Ag-dependent production of IFN-
(Fig. 5B) were comparable in these two mouse strains. To extend this analysis to other cytokines and to determine without any in vitro bias whether any form of immune deviation had occurred in these mice, we used real-time RT-PCR to evaluate the accumulation of mRNA for IFN-
, IL-4, and IL-10 in naive and infected B6 and plt/plt mice. At day 14 p.i., the level of IFN-
mRNA accumulation was identical in both strains (Fig. 5C), mirroring the data obtained from in vitro cultured spleen cells. IL-4 has also been shown to be coexpressed at the early stages of L. donovani infection ( 28), and although IL-4 mRNA was detected in infected mice, no difference was observed between B6 and plt/plt mice (Fig. 5D). In contrast, when we measured IL-10 mRNA accumulation, it was evident that expression of this cytokine was significantly enhanced in plt/plt mice compared with B6 mice (Fig. 5E). Thus, plt/plt mice show immune deviation toward production of a cytokine with known ability to inhibit antileishmanial immunity ( 29).
|
Expression of immunity to L. donovani is most evident in the liver, and studies with asplenic mice indicate that T cell priming and differentiation to effector T cells in the spleen contribute significantly to the hepatic immune response (C. Engwerda, A. Stanley, C. Alexander, and P. Kaye, unpublished observations). We therefore wished to determine whether potential changes to T cell priming in the spleen of plt/plt mice were translated into reduced hepatic immunity as expressed by granuloma function. Tissue sections from the livers of infected B6 and plt/plt mice were evaluated throughout the time course of infection, and granuloma maturation was quantitated. As shown in Fig. 6, granuloma maturation was significantly retarded in plt/plt mice compared with B6 mice. Although amastigotes were abundant in the liver of both strains of mice at day 14 p.i. (Figs. 1 and 6, A and D), in plt/plt mice there was minimal initiation of a granulomatous response around infected Kupffer cells (Fig. 6D). At day 28 p.i., granuloma formation was detected in both B6 and plt/plt mice (Fig. 6, B and E), and by day 56, empty granulomas were observed in B6 mice, but less frequently in plt/plt mice (Fig. 6, C and F). Although absolute number of inflammatory foci was similar (Fig. 6G), the delay in maturation was observed throughout the time course studied, and at day 56 p.i., almost 20% of infected foci in plt/plt mice had still failed to generate a significant histologic response (Fig. 6H). Immunohistochemistry indicated that the defect in granuloma formation was associated with a lack of infiltration of both CD4+ and CD8+ T cells, whereas the accumulation of F4/80+ macrophages was comparable (Fig. 7). These data suggest therefore that although IFN-
production is equivalent in B6 and plt/plt mice, this response fails to efficiently drive granuloma maturation in plt/plt mice, possibly as a consequence of the elevated IL-10 response.
|
|
| Discussion |
|---|
|
|
|---|
In a mouse model of visceral leishmaniasis, we and other groups have demonstrated previously that macrophages in the MZ of the spleen phagocytosed the majority of parasites in the first hours after injection ( 13, 38), whereas IL-12-producing DC were observed deep in the T cell area of the spleen ( 13). These findings strongly suggested that either a small proportion of infected DC, or DC that had captured parasite-derived Ags in the MZ, migrated to the PALS, where they could encounter T cells for priming host-protective immune responses. In this study, we have demonstrated that the chemokines CCL19/21 are necessary for the migration of DC in this early phase of L. donovani infection. Many aspects of DC migration and activation in Leishmania infection appear different from that induced by LPS or STAg, however. In contrast to LPS or STAg administration, L. donovani infection induces migration of only a fraction of the DC population, and clustering of DC in the PALS is not as evident as with these other stimuli. Whereas DC in wild-type mice up-regulated both MHC class II and costimulatory molecules homogeneously at 5 h p.i., DC from plt/plt mice can up-regulate MHC class II to a similar extent, but a notably poor response was observed in terms of CD86 expression (Fig. 2). Another study of L. donovani infection using MyD88-deficient mice, which lack this common signaling pathway of TLR, has indicated that activation of DC was severely impaired, but that migration from the MZ to the PALS was not affected by loss of TLR signaling ( 39). These facts suggest there are at least two different stimuli acting on DC in L. donovani infection, which differentially affect DC migration and activation phenotype.
In plt/plt mice, although IL-12-producing cells were seen after 5 h of infection, the total amount of IL-12p40 mRNA was markedly decreased compared with that induced in B6 mice. In addition, all IL-12p40-producing DC were localized at the MZ in plt/plt mice. These findings indicate that partially activated DC can produce only small amounts of IL-12p40, whereas DC that have migrated into the PALS may become more fully activated and produce large amounts of IL-12p40. Although not studied in this work, this result may also imply that IL-23, which uses the IL-12p40 submit ( 40), may have differential expression in the MZ and PALS. Although plt/plt mice are deficient in MZM ( 24), our data demonstrate that CD68+ macrophages in the MZ substitute as the main phagocytes for amastigotes in plt/plt mice (Fig. 2), and also suggest that reduced parasite uptake in the spleen does not underlie the defect in DC IL-12p40 production seen in these mice. Animals rendered MZM deficient by clodronate treatment (data not shown), and mice treated with PTX, an inhibitor of chemokine receptor signaling, also showed markedly decreased IL-12 production from DC at 5 h p.i. (Fig. 3). Thus, DC may be unable to become fully activated until they encounter CD4+ T cells in T cell area. The precise molecular interactions involved in this cell-cell cooperation remain to be elucidated.
In our previous studies, IL-12 production in the early period after infection was shown to determine the course of infection in the spleen, and it is striking that plt/plt mice appear similar to B6 mice in which IL-12 has been neutralized and to B6 IL-12/-deficient mice ( 14, 15). The data reported in this work might, therefore, suggest that the increased susceptibility of plt/plt mice is a direct consequence of the lack of IL-12 production early after infection. The relative importance of IL-12 in determining disease outcome could thus explain why there are discrepancies between the responses of plt/plt mice to Leishmania (this work), murine hepatitis virus ( 9), and LCMV infection ( 41). IL-12 is not required for induction of protective immunity for LCMV ( 42), and expansion of Ag-specific effector CD8+ T cells in LCMV-infected plt/plt mice is comparable to that of wild-type mice. LCMV can also directly activate DC ( 37), whereas amastigotes of L. donovani infect very few DC in vivo ( 13) and DC migration is necessary to achieve full activation (Figs. 2 and 4). Furthermore, loss of CCR7-depending migration of DC is one of the critical factors associated with the chronic stage of L. donovani infection ( 43), whereas this event is less important for the host-protective response against LCMV infection ( 41). Alternatively, reduced IL-12 production may merely serve as another indicator of poor activation of DC in plt/plt mice, because our data do not directly address whether decreased IL-12 production is the most significant defect in DC activation, in terms of the ultimately lowered resistance of plt/plt mice to L. donovani infection. Surprisingly, in preliminary experiments, we have been unable to enhance resistance in either plt/plt mice or wild-type mice by a single administration of 1 µg of rIL-12 at 5 h postinfection (M. Ato and P. Kaye, unpublished observations). These data contrast with the host-protective effects of sustained (7-day) administration of rIL-12, as reported by others ( 44), suggesting that either IL-12 produced at later times during infection is also important for host resistance, or that other defects in DC activation in plt/plt mice, as noted above, play an important role in determining the outcome of infection.
Given the above findings, it was also surprising to observe that the induction of IFN-
and IL-4, key cytokines involved in optimal host resistance and granuloma development following L. donovani infection ( 16, 45), was similar in both wild-type and plt/plt mice. Thus, the defects reported in this study in plt/plt mice clearly do not block T cell priming completely, as anticipated from other studies ( 46). In contrast, the accumulation of mRNA for IL-10, a cytokine with notable inhibitory effects on host resistance ( 28, 47), was increased in plt/plt compared with wild-type mice. IL-10 has multiple cellular sources during active infection with L. donovani, with IL-10 mRNA being most abundant (on a cell per cell basis) in CD4+ T cells, NK cells, DC, and macrophages, and to a lesser extent in CD8+ T cells, B cells, and neutrophils (A. Maroof, M. Svensson, S. Stager, and P. Kaye, unpublished observations). However, the broad expression of IL-10, difficulties associated with identifying IL-10-producing cells directly ex vivo, and a similarly wide cellular distribution of IL-10R expression together pose significant challenges for identifying functionally relevant cellular interactions mediated through IL-10. These are only likely to be addressable in vivo by the future development of mice, allowing cell-specific and regulated targeting of IL-10 and its receptor.
Resolution of hepatic infection is dependent on granuloma formation, in which various effector cells are recruited and produce cytokines. Both CD4+ and CD8+ T cells are required to induce granuloma formation in the liver ( 21). plt/plt mice have delayed granulomatous responses and an associated reduction in the recruitment of effector T cells. The lack of T cell recruitment is unlikely to be due to a lack of CCL19/21 in the liver, because CCL21 is detected in afferent lymphatics in the liver of plt/plt mice to the same extent as in the livers of wild mice (data not shown) ( 11). Rather, our data suggest that this lack of granuloma maturation is directly linked either to the altered functional development of effector CD4+ and/or CD8+ T cells, or their homing potential in an IL-10-rich environment. These speculations may be supported by the fact that IL-10 suppresses granuloma formation and recruitment of effector cells to the infected liver, independently of IFN-
production ( 47).
In conclusion, plt/plt mice have a deficiency in DC activation resulting from impaired CCL21/CCL19-dependent migration of DC in these mice, which, most likely acting in concert with established defects in T cell migration ( 9), leads to a demonstrable increase in susceptibility to L. donovani infection. This study, therefore, reveals for the first time the potential link between migration-dependent DC activation and protection against L. donovani infection, substantiating the importance of an appropriate chemokine environment for the generation and expression of optimal host-protective immune responses.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by the Wellcome Trust and the British Medical Research Council. M.A. was a recipient of a Wellcome Trust International Travelling Fellow. ![]()
2 Current address: Department of Immunology, National Institute of Infectious Diseases, 1-23-1 Toyama, Shinjuku, Tokyo 162-0864, Japan. ![]()
3 Current address: Immunology and Infection Unit, Hull York Medical School, and Department of Biology, University of York, P.O. Box 373, York YO10 5YW, U.K. ![]()
4 Current address: Department of Immunology, Duke University Medical Center, Durham, NC 27710. ![]()
5 Address correspondence and reprint requests to Dr. Paul M. Kaye, Department of Biology, University of York, P.O. Box 373, York YO10 5YW, U.K. E-mail address: pmk2{at}york.ac.uk ![]()
6 Abbreviations used in this paper: DC, dendritic cell; HPRT, hypoxanthine-guanine phosphoribosyltransferase; LCMV, lymphocytic choriomeningitis virus; MZ, marginal zone; MZM, MZ macrophages; PALS, periarteriolar lymphoid sheath; p.i., postinfection; PTX, pertussis toxin; STAg, soluble Toxoplasma Ag. ![]()
Received for publication March 16, 2005. Accepted for publication February 21, 2006.
| References |
|---|
|
|
|---|
are potent chemoattractants for in vitro- and in vivo-derived dendritic cells. J. Immunol. 162: 3859-3864.
in host defense and tissue granulomatous response. J. Immunol. 143: 4244-4429. [Abstract]
: effect of interleukin-12 in experimental visceral leishmaniasis in interferon-
gene-disrupted mice. J. Exp. Med. 185: 1231-129.
and tumor necrosis factor in the control of Leishmania donovani infection. Am. J. Pathol. 165: 2123-2133.
+ dendritic cells. Nat. Immunol. 1: 83-87. [Medline]
signalling contribute to the development of hepatic granulomas with optimal antileishmanial activity. Infect. Immun. 71: 4804-487. This article has been cited by other articles:
![]() |
A. Maroof and P. M. Kaye Temporal Regulation of Interleukin-12p70 (IL-12p70) and IL-12-Related Cytokines in Splenic Dendritic Cell Subsets during Leishmania donovani Infection Infect. Immun., January 1, 2008; 76(1): 239 - 249. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Unsoeld, K. Mueller, U. Schleicher, C. Bogdan, J. Zwirner, D. Voehringer, and H. Pircher Abrogation of CCL21 chemokine function by transgenic over-expression impairs T cell immunity to local infections Int. Immunol., November 1, 2007; 19(11): 1281 - 1289. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |