The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Labbe, A.
Right arrow Articles by Paige, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Labbe, A.
Right arrow Articles by Paige, C. J.
The Journal of Immunology, 2006, 176: 5354-5361.
Copyright © 2006 by The American Association of Immunologists

Murine Model of Immune-Mediated Rejection of the Acute Lymphoblastic Leukemia 70Z/31

Alain Labbe2, Anne H. Tran and Christopher J. Paige

Ontario Cancer Institute, University Health Network, Department of Immunology, University of Toronto, Toronto, Ontario, Canada


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
70Z/3 is a murine pre-B cell leukemia line derived from BDF1 mice and has been used in the study of signaling pathways in B cells. 70Z/3 cells were initially found to cause widespread disease upon injections in animals. We have isolated 70Z/3 variants divergent in their capacity to lead to morbidity after injections. One variant, 70Z/3-NL, elicits an immune response protecting the animal from tumor growth. Another variant, 70Z/3-L, does not induce an effective immune response and causes morbidity. We demonstrated that both CD4+ and CD8+ T cells are required for the rejection of 70Z/3-NL cells. Interestingly, the immune response generated against 70Z/3-NL cells was found to protect against a challenge with the lethal variant, 70Z/3-L. This indicates that although both lines can be recognized and killed by the immune system, only 70Z/3-NL is capable of inducing a protective response. Further observations, using subclones isolated from 70Z/3-NL, demonstrated that immune recognition of a portion of the cells was sufficient for protection. Depletion of CD4+ and CD8+ T cells in animals injected previously with 70Z/3-NL cells showed that T cells, and not Abs, were required for the maintenance of the protection initiated by 70Z/3-NL. We tested the capacity of 70Z/3-NL cells to treat mice challenged with 70Z/3-L. We can delay injections of 70Z/3-NL and still provide protection for the animals. We have a model of immune-mediated rejection which will allow us to dissect the requirements for the initiation of immune responses against an ALL tumor cell line.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Harnessing the power of the immune system to eliminate neoplastic cells remains a worthy, if elusive, goal. Examples of rare spontaneous elimination of cancer, as well as clinically induced immune rejection suggest that the immune system is capable of recognizing and eliminating some tumor cells (1, 2, 3, 4, 5, 6). Clinical protocols that seek to increase B cell and T cell effector functions as well as enhance tumor immunogenicity are being tested (7, 8, 9, 10, 11, 12, 13). However, immunotherapy remains a controversial treatment with only a few examples of proven success. Further progress will require a thorough understanding of both the activation and elimination phases of the antitumor immune response as well as better knowledge of what immunologically relevant traits distinguish tumor cells from normal cells. We have developed a model system to examine both of these important areas of investigation. Using the well-studied 70Z/3 pre B cell leukemia line, we have isolated variants that either rapidly lead toward mortality of injected mice or are recognized and rejected by the immune system. We show that tumor immunity in this case is T cell dependent and long-lasting and that protection extends to 70Z/3 variants which themselves are incapable of eliciting a primary immune response.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Animals

Female (C57BL/6 x DBA/2)F1 mice (BDF1), 8–12 wk old, were purchased from The Jackson Laboratory and kept under specific pathogen-free conditions in the animal facility at the Ontario Cancer Institute (Princess Margaret Hospital, Toronto, Ontario, Canada). The mice were monitored daily for signs of tumor-induced morbidity. The animal care committee of the Ontario Cancer Institute approved all experimental protocols used.

Tumor cells

70Z/3 tumor cells (previously described in Ref.14) were maintained in IMDM with 5% heat-inactivated FBS (Invitrogen Life Technologies), 100 µg/ml penicillin-streptomycin, or 100 µg/ml kanamycin (Invitrogen Life Technologies), and 5 x 10–5 M 2-ME (complete IMDM) in a humidified atmosphere at 37°C and 5% CO2. Cell concentrations were kept between 5 and 10 x 105 cells/ml. Limiting dilution was used to establish the subclones. 70Z/3 cells were plated in 96-well plates at population densities of <0.3 cell/well. 70Z/3-L and 70Z/3-NL cells lines were tested for viral contamination and no pathogens were detected by PCR assays. The cells were tested for: Mycoplasma spp., Sendai virus, mouse hepatitis virus, pneumonia virus of mice, mice minute virus, mouse parvovirus, and Theiler’s murine encephalomyelitis virus. The PCR-based testing was performed at the Research Animal Diagnostic Laboratory (RADIL) at the University of Missouri (Columbia, MO).

Southern blotting analysis of JH4 H chain gene segment

DNA isolation. Tumor cells were grown in complete IMDM and the DNA from 2 x 107 cells was extracted using DNAzol reagent as per manufacturer’s instructions (Molecular Research Center). Briefly, 2 x 107 cells were spun down and lysed by pipetting in 2 ml of DNAzol reagent. For the liver sample, the tissue (100 mg) was homogenized using 2 ml of DNAzol. The liver homogenate was then spun at 12,000 x g to remove tissue fragments and excess polysaccharides. This step was not necessary with the lysed cell suspensions. The DNA from the lysates was precipitated with 0.5 ml of 100% ethanol. The DNA was removed with a pipette tip and transferred to a new tube before being washed twice with 1 ml of 95% ethanol. The DNA was left to dry for 15 min and was dissolved in 8 mM NaOH. Once dissolved, the pH was adjusted to 8.0 by adding 0.1 M HEPES.

Gel separation and transfer. Fifteen micrograms of DNA was digested with EcoRI (40 U) in 80 µl of buffer for 4 h. Eleven micrograms of each digested DNA sample was run on a 0.8% agarose gel in Tris acetate-EDTA buffer at 14 volts for 16 h (overnight). The DNA was transferred to a nylon membrane (Hybond-N) by capillary flow in 1x SSC overnight. The DNA was bound to the membrane by UV cross-linking.

JH4 probe labeling. Labeling of the probe (5'-AAA GAC CTG CAG AGG CCA TTC TTA CC-3') was performed using the NEBlot labeling kit from NEB. Briefly, 1 µl of the DNA probe was added to 32 µl of water and boiled for 5 min before being rapidly cooled on ice. Five microliters of 10x labeling buffer, 6 µl of provided dNTP mix (dATP, dTTP, and dGTP), 5 µl of [{alpha}-32P]dCTP (50 µCi) and 1 µl of DNA polymerase I Klenow fragment were added, and the mixture was incubated for 2 h at 37°C. The reaction was terminated by adding 5 µl of 0.2 M EDTA (pH 8.0). The probe was purified using a Sepharose G-50 gel filtration column.

Hybridization. The nylon membrane was prehybridized in hybridization buffer (5x standard saline citrate-phosphate-EDTA, 2% SDS, 5x Denhardt’s solution, 100 µg/ml poly(A), 6% formamide, and 100 µg/ml salmon sperm DNA) for 2 h at 42°C before addition of the labeled radioactive probe in a rotating tube in a hybridization oven. The probe was left to hybridize overnight. Following hybridization, the membrane was washed twice with 1x SSC, 0.1% SDS for 20 min and once with 0.2x SSC, 0.1% SDS for 15 min at 65°C. The membrane was placed on a phosphoimager screen for 48 h before reading on a PhosphoImager (Storm 860; Molecular Dynamics).

Cloning and sequencing of VDJ rearrangements in 70Z/3 variants

DNA was prepared for PCR by lysing 2 x 105 cells in 200 µl of PCR lysis buffer (10 mM Tris (pH 8.3), 2 mM MgCl2, 50 mM KCl, 0.45% Nonidet P-40, 0.45% Tween 20, 60 µg/ml proteinase K), incubating at 56°C for 1 h followed by protease inactivation at 90°C for 15 min. VDJ rearrangements were amplified using the degenerate VH primer (Vhall-AGGT(C/G)(A/C)A(A/G)CTGCAG(C/G)AGTC(A/T)GGl) and the JH4 primer (AAGACCTGCAGAGGCCATTCTTACC). The PCR was performed using 3 µl of cell lysate, 1 U of Platinum Taq High Fidelity (Invitrogen Life Technologies) in a 50-µl reaction for 30 cycles. The 50-µl PCR was run on a 1.2% agarose gel and the 1.6-kb VDJ rearrangement was gel extracted with the MinElute kit (Qiagen) and cloned into TOPO TA cloning vector (Invitrogen Life Technologies). Sequencing was performed using Bigdye Terminator cycle sequencing chemistry on the Applied Biosystems 377 DNA Sequencer at the Core Molecular Biology Facility at York University (Toronto, Canada).

In vivo challenge experiments

Tumor cells were grown to 5–10 x 105 cells/ml in complete IMDM and were washed three times with 30 ml of PBS with Ca2+ and Mg2+. The cells were resuspended at 5–10 x 106 cells/ml in PBS and injected into the animals in a volume of 100–200 µl. When <1 x 106 cells were injected, the cells were diluted to obtain the required number of cells in a final volume of 100–200 µl. Mice received either i.p. injections or i.v. injections. The i.p. injections were performed on the right side of the abdomen using a 1-ml syringe with a 26-gauge needle. The i.v. injections were performed in the lateral tail vein, using a 1-ml syringe with a 26-gauge needle.

Peritoneal lavage

The peritoneal lavage procedure involved cutting open the skin layer on the abdomen, leaving the peritoneal membrane intact. The membrane was lifted with a hemostat and an injection of 4 ml of PBS (without calcium and magnesium) was done using an 18-gauge needle on a 5-ml syringe. PBS without calcium and magnesium was used to reduce the adhesion of cells to the peritoneal surfaces. With the needle still inserted in the cavity, the liquid was circulated for ~1 min by applying pressure to the outside of the cavity. The content of the peritoneal cavity was then aspirated using the syringe.

Frequency assay for 70Z/3-L and 70Z/3-NL cells

Mice that were injected with 1 x 106 70Z/3-L or -NL cells on day 0 by i.p. injections were sacrificed starting on day 1. The spleen, bone marrow, and peritoneal cells were collected. Peritoneal lavage was done as described. The cells were plated in 96-well round-bottom plates in complete IMDM at concentration ranging from 0.3–1000 cells/well. Previous experiments demonstrated that we could obtain a 1:1 cloning efficiency of the 70Z/3 cells in 96-well round-bottom plates. At 7 days following plating, the plates were scored for positive and negative wells. Using the Poisson distribution, we determined the frequency of clonable cells in the different populations (15).

Challenge in T cell-depleted animals

Mice were depleted of CD4, CD8, or both T cell subsets using Abs specific for these surface receptors. Hybridomas GK1.5 (anti-CD4) and YTS169 (anti-CD8) were the sources of anti-T cell Abs used for depletion. The hybridoma HB9147 was used to produce a control Ab. All hybridomas were obtained from the American Type Culture Collection (ATCC). All hybridoma cell lines were grown in 2.5 L of complete IMDM in Lifecell culture bags (Lifecell Tissue Culture; Baxter Biotech North America) in a humidified atmosphere at 37°C and 5% CO2 until a live cell count (using trypan blue exclusion) revealed ~30% dead cells in the culture. The medium was then centrifuged and filtered to remove cells and cell debris. The Abs were purified from the medium using an affinity column of packed Ab purification Sepharose beads (Gammabind G; Amersham Biosciences) and concentrated with Centriprep YM-30 columns (Millipore) before dialysis in PBS. The anti-T cell subset Abs and the anti- IFN-{gamma} Ab were injected in the animals on days –1, 3, 7, 10, and 14 in relation to the day of injection of the cells (day 0). The doses used were 1 mg of Ab on day –1 and 500 µg for the remaining injections. Isotype control Abs were injected following the same doses and schedule as their corresponding depleting Abs. The depletion potential of the Abs was demonstrated in vivo before their use in the experiments.

T cell depletion and 70Z/3-L challenge in 70Z/3-NL-injected animals

The mice were first injected with 1 x 106 70Z/3-NL cells in PBS and monitored for a period of 12 wk. Following that time, the mice were injected with depleting Abs against CD4, CD8, or both. Abs were prepared as described. The mice received two injections of 500 µg of Abs, either GK1.5 (anti-CD4), YTS169 (anti-CD8), or both, 4 days and 2 days before challenge with 1 x 106 70Z/3-L cells in PBS. A group of mice was also injected with a control Ab before challenge with 70Z/3-L cells.

Generation of CTLs and 51Cr release assay

Mice were injected with 1 x 106 irradiated (2000 rad) 70Z/3-NL cells on day 0 by i.p. injections. The mice were left to reject the cells for 7 days. On day 7, the mice were euthanized and the spleens were collected. Spleens from naive animals were also used as controls. The spleen cells were resuspended as a single-cell suspension using a fine mesh screen before being plated in small flasks in 10 ml of complete IMDM in the presence of irradiated 70Z/3-NL cells at a ratio of one tumor cell per 100 spleen cells. Following incubation in a humidified atmosphere at 37°C and 5% CO2 for 5 days, the cells were collected, live cells were counted and distributed in 96-well plates at 400,000, 133,000, and 44,000 effector cells/well in 200 µl of complete IMDM. Six wells were used for each experimental group. 70Z/3-NL and 70Z/3-L target cells were grown as described previously. A total of 1 x 106 cells from each variant were labeled with 51Cr by incubating the cells in 100 µl of [51Cr]chromate (NEN Life Science) in PBS with FCS (200 µCi/L x 106 cells) for 2 h at 37°C. Following labeling, the cells were washed three times before a final dilution to 40,000 cells/ml complete IMDM. One hundred microliters of medium was then removed from the wells in the 96-well plates containing the effector cells and was replaced with 4000 51Cr-labeled target cells in 100 µl of IMDM. Wells containing only targets were included to measure spontaneous release as well as total release. Total release was obtained by adding a solution of 2% acetic acid to the wells. Once the targets were added to the effectors, the plates were incubated at 37°C for 4 h. Following the incubation, 100 µl of supernatant was collected from the wells and the radioactivity measured using a gamma counter. Percent-specific lysis was calculated as (E – S)/(T – S) x 100 in which each value represents the mean of six replicates. E is the experimental value, S is the spontaneous release, and T is the total release of 51Cr from the labeled targets.

Analysis of surface molecules

Abs used for analysis were purchased from BD Pharmingen. Abs were directly conjugated to the fluorochromes FITC, PE, or allophycocyanin. The clones used: CD2 (RM2-7), CD5 (53-7.3), CD11b (M1/70), CD19 (ID3), CD22 (Lyb8.2), CD23 (B3B4), CD24 (M1/69), CD25 (7D4), CD32 (2.4G2), CD40 (3/23), CD43 (S7), CD44 (IM7), CD45 (6B2, 14.8, M189), CD48 (HM48-1), CD62L (MEL-14), CD80 (16-10A1), CD86 (GL1), CD95 (DX2), CD103 (2E7), CD106 (429), CD117 (2B8; eBiosciences), Syndecan 4 (KY/8.2), BP-1 (6C3), Ly6A/E (D7), AA4.1, {lambda}5 (FS1.3G3), {kappa} L chain (187), µ H chain (33.60), 4–1BB-L (TKS-1), H-2Db (KH95), H-2Dd (34-2-12), H-2Kb (AF6-88.5), H-2Kd (SF1-1.1), class II (M5). Cells from both variants were collected from in vitro cultures or from growth in the peritoneal cavity as described. Cells were washed with PBS with 5% heat-inactivated FCS and were diluted to 1 x 106 cells/ml PBS with FCS. Abs specific for the surface molecule examined were added to wells on a 96-well round-bottom plate in 100 µl of PBS with FCS at predetermined dilutions, usually 1 µl/200 µl total volume. A volume equivalent to 1 x 105 cells was then added to the wells. Isotype-matched Abs were included to control for nonspecific binding of the Abs. Cells and Abs were left to bind for 15 min on ice and were then washed three times. For washing, the cells were spun in a centrifuge with microplate adaptors at 1000 rpm for 5 min and the liquid was removed by flicking the plate over a sink. The cells were then resuspended with 200 µl of PBS with FCS for each wash. The cells were finally resuspended in 200–400 µl of PBS with FCS and transferred to test tubes. Flow cytometry analysis was performed using a FACSCalibur (BD Biosciences). Acquisition and analysis of the samples was done using CellQuest software, version 3.3 (BD Biosciences).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Pre-B leukemia 70Z/3 cell variants differ in their lethality

We examined the effects in vivo of two variants of 70Z/3, 70Z/3-NL (nonleukemic) and 70Z/3-L (leukemic) using both i.p. and i.v. routes of injection (Figs. 1 and 2). An i.p. injection of 1 x 106 70Z/3-L cells led to morbidity in all animals (median survival of 9 days) (Fig. 1A). In contrast, the mice injected with 1 x 106 70Z/3-NL cells remained disease-free. Intraperitoneal injection of as few as 1000 70Z/3-L cells led to disease in all animals within 20 days with a median survival of 15 days (Fig. 1B).


Figure 1
View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 1. Intraperitoneal injections of 70Z/3-L and 70Z/3-NL in BDF1 mice. A, A total of 1 x 106 70Z/3-NL and 1 x 106 70Z/3-L cells were injected i.p. in BDF1 mice (n = 20). B, Injections i.p. of 1 x 103 to 1 x 106 70Z/3-L cells in BDF1 mice (n = 5 for 1 x 103 to 1 x 105 cells, n = 6 for 1 x 106 cells). All mice were injected on day 0 with the indicated cell numbers. Animals were monitored daily and euthanized upon observation of symptoms including reduction of mobility, ruffled fur, and hunched back.

 

Figure 2
View larger version (12K):
[in this window]
[in a new window]
  		FIGURE 2. Intravenous injections with 70Z/3-L and 70Z/3–NL in BDF1 mice. A, A total of 1 x 106 70Z/3-NL and 1 x 106 70Z/3-L cells were injected i.v. in BDF1 mice (n = 20). B, Titration of 70Z/3-NL cells injected i.v. in BDF1 mice (n = 3 for 1 x 104 to 1 x 105 cells, n = 4 for 1 x 106 cells. Results representative of multiple experiments). C, Titration of 70Z/3-L cells injected i.v. in BDF1 mice (n = 5 mice for 1 x 102 cells, n = 3 mice for 1 x 104 to 1 x 106 cells. Results representative of multiple experiments). All mice were injected on day 0 with the indicated cell numbers. Animals were monitored daily and euthanized upon observation of symptoms including reduction of mobility, ruffled fur, and hunched back.

 
We next tested the i.v. route of injection and found somewhat different results. In this case, injection of 70Z/3-NL cells led to disease when 1 x 106 cells were injected i.v. (Fig. 2A). This result is very similar to what is observed when 1 x 106 70Z/3-L cells are injected i.v. The median survival of mice injected with 1 x 106 70Z/3-NL i.v. was 9 days while the median survival of mice injected with 1 x 106 70Z/3-L was 7 days. However, we found that i.v. injection with fewer 70Z/3-NL cells resulted in increased survival of mice (Fig. 2B). In contrast, the i.v. injection of mice with as few as 100 70Z/3-L cells still led to morbidity in all animals (Fig. 2C). These results suggest that 70Z/3-NL cells are capable of proliferating in mice and have the capacity to overwhelm the immune response leading to disease.

70Z/3-L and 70Z/3-NL are derived from the same tumor and have identical VDJH rearrangements

Given the significant differences between the 70Z/3 variants in their capacity to progress in mice, we judged that it was important to ensure that they were in fact derived from the same parent cell line. This was confirmed by Southern analysis of the Ig H chain locus. The analysis demonstrated the clonal origin of 70Z/3-L and 70Z/3-NL as both presented the same rearrangement pattern of the Ig H chain locus (Fig. 3A). To further confirm the identity of the Ig H chain rearrangement from 70Z/3-L and 70Z/3-NL lines, the VDJH rearrangement from each of the variants was cloned and sequenced. We compared the Ig H chain CDR3 region of the two variants to the previously reported sequence from the 70Z/3 cell line and found that they all carried the same J558.33-DSP2.2-JH1 rearrangement (16) (Fig. 3B). Analysis of the Ig H chain CDR3 region from subclones of the 70Z/3-NL variant also showed that they contained the original rearrangement.


Figure 3
View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 3. A, Southern analysis of 70Z/3-L and 70Z/3-NL using a JH4-specific probe. DNA from BDF1 mouse liver and from 70Z/3 variants, including 70Z/3-L and 70Z/3-NL, was isolated using DNAzol as described in Materials and Methods. The DNA was digested, separated, and transferred to a membrane before hybridization with a radioactive-labeled JH4 probe recognizing the J4 segment of the Ig H chain gene locus. The banding pattern is indicative of the rearrangement that took place during development of the cells and indicates the relationship of the variants. The liver DNA was unrearranged and presents the banding pattern expected when the Ig H chain is not rearranged. B, DNA sequence comparison of the CDR3 region of the rearranged Ig H chain locus from 70Z/3 variants and subclones shows sequence identity. A single 1.6-kb fragment representing a complete VDJH1 rearrangement was cloned from the genomic DNA of the 70Z/3 variants using a degenerate VH primer and a JH4 primer. The clones were sequenced and the Ig H region was analyzed using IgBlast. We compared the sequence of the Ig H chain rearrangement from the 70Z/3-L and 70Z/3-NL variants, their subclones (1D9, 2C2, 2C6, 2E4, 2G6, B10, G2, G9), and the previously published sequence from 70Z/3 mRNA (gi3978228), and found that they all possess the identical rearrangement. Only the CDR3 region is shown with the 70Z/3-L sequence on the top line. The dots denote matching nucleotides.

 
The immune response is needed to reject 70Z/3-NL cells

We next examined the malignant potential of 70Z/3 variants in different strains of mice. We found that both 70Z/3-L and 70Z/3-NL cells, which are derived from BDF1 mice, were rejected by mice of the H2b haplotype indicating that an allogenic difference was sufficient to elicit a protective immune response (data not shown). In contrast, immunocompromised mice, namely RAG-1–/–, failed to stem the growth of either variant leading to the rapid demise of these mice (data not shown). These results suggest that differences between the 70Z/3-L and 70Z/3-NL variants are based on different levels of immunogenicity in syngeneic strains.

CD4 and CD8 T cells are required for rejection

We next tested the role of T cell subsets in the protective immune response against 70Z/3-NL cells. The mice were injected with depleting Abs specific for the CD4+ or CD8+ T cell subsets. Depletion was confirmed in control animals. The mice were then challenged with 1 x 106 70Z/3-NL cells. When mice depleted of both CD4 and CD8 T cells were challenged with 70Z/3-NL, we observed tumor progression and morbidity. The appearance of disease in 70Z/3-NL-injected animals followed the same kinetics as mice injected with 1 x 106 70Z/3-L cells (Fig. 4). We observed further that depletion of either CD4 or CD8 T cell subsets also prevented rejection of 70Z/3-NL cells.


Figure 4
View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 4. Challenge with 70Z/3-NL in T cell-depleted animals. Mice were treated with 1 mg of indicated Abs on day –1 and were challenged with 1 x 106 70Z/3-NL i.p. on day 0. A group was injected with 70Z/3-L and was included as a control. Abs were reinjected every 4 days to maintain the depletion of T cell subsets (n = 12 mice/group, results combined from three experiments). The animals were monitored daily and euthanized upon the appearance of symptoms.

 
Injection of 70Z/3-NL cells induces protection against 70Z/3-L cells and generates CTLs against both 70Z/3-NL and 70Z/3-L

We next tested whether the immune response against 70Z/3-NL would be effective against the 70Z/3-L cells. We injected mice with 1 x 106 70Z/3-NL cells 10 days before injecting them with 1 x 106 70Z/3-L cells. We observed that all naive animals injected with 1 x 106 70Z/3-L i.p. rapidly progressed toward death. In contrast, the animals injected with 70Z/3-NL cells before injections of 70Z/3-L cells showed no signs of disease (Fig. 5A). These experiments demonstrate that 70Z/3-L cells can be rejected by the immune response generated against 70Z/3-NL cells. We also demonstrated that both the 70Z/3-L and the 70Z/3-NL variants are suitable targets for cytotoxic T cell killing in vitro. CTL assays were performed using spleen cells from mice injected with irradiated 70Z/3-NL. The T cell clones derived from mice injected with 70Z/3-NL cells were equally capable of killing 70Z/3-NL (Fig. 5B) and 70Z/3-L (Fig. 5C) as measured by 51Cr release assays.


Figure 5
View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 5. Challenge of mice with 70Z/3-L after injection of 70Z/3-NL and cytotoxicity of splenocytes derived from mice injected with irradiated 70Z/3-NL. A, BDF1 mice were injected i.p. at day –10 with 1 x 106 70Z/3-NL cells. On day 0, the mice were challenged with 1 x 106 70Z/3-L cells i.p. A group of naive mice was included as a control for the ability of 70Z/3-L to cause disease. The animals were monitored daily and euthanized upon the appearance of symptoms (n = 3 mice. Representative of multiple experiments). B and C, CTLs generated against 70Z/3-NL were tested for their capacity to lyse 70Z/3-NL targets (B) and 70Z/3-L targets (C). Naive BDF1 splenocytes were also used to establish the absence of CTL activity before the injection of 70Z/3-NL cells. Results are average of two mice in one experiment, representative of two separate experiments.

 
Delayed injection of 70Z/3-NL can improve survival of mice challenged with 70Z/3-L

We next tested whether we could inject the 70Z/3-NL cells to treat a mouse with a pre-established 70Z/3-L population in the peritoneal cavity. We tested the effects of injecting 1 x 106 70Z/3-NL cells on days 0–5 after injection of 1 x 104 70Z/3-L cells. A low number of 70Z/3-L cells was chosen to allow the establishment of the cells without leading to death before the potential onset of an immune response (Fig. 6). Mice that received 1 x 106 70Z/3-NL cells from days 0 to 3 following 70Z/3-L cell challenge had a significantly improved survival. Morbidity was observed in all animals injected with 70Z/3-NL cells 4 or 5 days after challenge with 70Z/3-L. We observed a statistically significant increase in the median survival time of mice injected after 4 days. The median survival increased from 15 days for mice receiving no 70Z/3-NL to 30 days for mice receiving 1 x 106 70Z/3-NL cells on day 4 (p = 0.0062 when comparing survival curves (log-rank test) from mice injected on day 4 with mice having received only 70Z/3-L). These results suggest that the immune response can be elicited in mice with an established burden of 70Z/3-L cells but that a limit is reached beyond which the balance of tumor growth vs immune response favors the tumor.


Figure 6
View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 6. Treatment of challenged mice with 70Z/3-NL. Mice were injected with 1 x 104 70Z/3-L cells i.p. on day 0. From days 0 to 5, groups of five mice injected with 70Z/3-L also received an injection of 1 x 106 70Z/3-NL cells i.p. The animals were monitored daily and euthanized upon the appearance of symptoms (n = 5 mice/group) (p = 0.0062 when comparing survival curves (log-rank test) of mice injected on day 4 and mice that received only 70Z/3-L).

 
Both CD4 and CD8 cells are able to provide some protection in the challenge of a 70Z/3-NL-treated animal

The analysis of the primary immune response against 70Z/3-NL established that both CD4+ and CD8+ T cell subsets were engaged in tumor rejection. Similar experiments were undertaken to determine the nature of the immune response in mice which had successfully rejected 70Z/3-NL cells and were subsequently challenged with 70Z/3-L cells. Animals were injected with 1 x 106 70Z/3-NL and rested for 60 days. As expected, all animals survived this treatment and successfully rejected the 70Z/3-NL cells. Mice were then subjected to T cell depletion as previously described and subsequently injected i.p. with 1 x 106 70Z/3-L cells. The mice were monitored for the appearance of morbidity. We found that animals depleted of both CD4 and CD8 failed to reject 70Z/3-L cells (Fig. 7). The groups depleted of only one T cell subset also showed increased mortality although not to the extent found when both CD4 and CD8 were depleted. We found that 47% of animals depleted of CD4 cells and 50% of animals depleted of CD8 cells survived the challenge with 70Z/3-L for >100 days.


Figure 7
View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 7. Challenge in T cell-depleted vaccinated mice. Mice were injected i.p. with 1 x 106 70Z/3-NL cells at least 60 days before depletion of CD4 and CD8 T cell subsets with Abs on days –4 and –2. On day 0, the mice were challenged with 1 x 106 70Z/3-L. The animals were monitored daily and euthanized upon the appearance of symptoms (n = 7 mice for anti-CD4, n = 8 mice/group for the remaining groups). Results combined from two experiments.

 
70Z/3-NL contains multiple clones with divergent rejection phenotypes

We next showed that simultaneous injection of 70Z/3-L and 70Z/3-NL cells in equal numbers resulted in immune elimination of both variants. In fact, we found that as few as 10% 70Z/3-NL cells in a population of 1 x 106 70Z/3-L cells could lead to rejection in nearly all cases. This observation led to the hypothesis that the 70Z/3-NL variant may not be homogeneous with respect to its ability to elicit an immune response. We tested this possibility by establishing numerous subclones of 70Z/3-NL cells. We found that the 70Z/3-NL population included cells that poorly initiated a response (Fig. 8). These clones led to morbidity in the majority of injected hosts (7 subclones). 70Z/3-NL subcloning also yielded a number of clones with different capacity to initiate a response. Injection of some of these clones led to rejection in only some animals while other clones where rejected in all the animals tested.


Figure 8
View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 8. Injection of subclones of 70Z/3-NL. The 70Z/3-NL variant was subcloned and mice were challenged with 1 x 106 cells i.p. from the isolated clones. The animals were monitored daily and euthanized upon the appearance of symptoms (n = 3 to n = 9, results from multiple combined experiments).

 
Analysis of sub clones of 70Z/3-NL

We next made secondary subclones to test the stability of the trait that results in immune rejection. When these clones were tested (Fig. 9), we found that the traits leading to rejection were relatively stable. For example, all of the 70Z/3-NL-2E4 subclones, including the 70Z/3-NL-2E4, itself were rejected. One subclone of 70Z/3-NL-2E4, 70Z/3-NL-2E4.3, did lead to morbidity in one animal. More variability was noted in subclones that failed to elicit immune responses. For example, the subclones of 70Z/3-NL-2G6 varied from complete protection to 75% mortality.


Figure 9
View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 9. Injections of subclones of 70Z/3-NL-2E4 and 70Z/3-L-2G6. A, Clones 2E4.1–2E4.6, isolated from 70Z/3-NL-2E4 and (B) clones 2G6.1–2G6.6 isolated 70Z/3-NL-2G6, were injected i.p. (1 x 106 cells) in BDF1 mice. The animals were monitored daily and euthanized upon the appearance of symptoms (n = 4 mice/group).

 
Surface phenotype of 70Z/3-L and 70Z/3-NL did not reveal differences

We next analyzed the surface phenotype of 70Z/3-NL and 70Z/3-L cells using fluorescent-labeled Abs against a number of surface molecules (Table I). This analysis failed to reveal significant differences in expression of a variety of cell surface proteins involved in B cell signaling, function, or Ag presentation. One difference that was found was that 70Z/3-L cells consisted of populations that either expressed or failed to express CD19, in contrast to 70Z/3-NL cells which were uniformly positive. However, it is unlikely that this is relevant for immunogenicity because we have found that even 10% of 70Z/3-NL like cells is sufficient to elicit an immune response and 70Z/3-L cell populations, presumably containing a 1:1 ratio of CD19-positive and -negative cells failed to elicit a protective immune response.


View this table:
[in this window]
[in a new window]
  		Table I. Surface phenotype of 70Z/3-L and 70Z/3-NLa

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
In this study, we demonstrate that the well-studied murine ALL cell line 70Z/3, which normally leads to rapid morbidity after injection into mice, has variants which can be recognized and eliminated by the immune system. We found that the difference in these variants is apparent only during the activation of the immune response. 70Z/3-NL cells elicit an immune response and are eliminated by that immune response. 70Z/3-L cells cannot elicit an effective immune response but if one is elicited for it, e.g., by coinjection of 70Z/3-NL cells, they are readily eliminated by that immune response. This result also eliminates the possibility that 70Z/3-L cells are more resistant to immune killing or have growth properties that allow them to escape an immune response.

The simplest interpretation of our results is that the 70Z/3-NL cells possess traits which are critical for initiating the immune response and which 70Z/3-L cells lack. An alternative hypothesis, namely that 70Z/3-L cells suppress the initiation of an immune response, seems unreasonable given that a mixed population of 70Z/3-NL and 70Z/3-L cells leads to tumor rejection. In those experiments, populations containing 10% 70Z/3-NL + 90% 70Z/3-L cells still elicited an immune response which was protective against both variants. Thus, if 70Z/3-L cells are capable of suppressing immune activation they do so by a route which is easily overcome by the activating properties of 70Z/3-NL cells.

Our results indicate that immune-mediated elimination of 70Z/3 cells is T cell dependent. We base this conclusion on experiments which show that depletion of either CD4+ or CD8+ cells reduces survival of mice injected with 70Z/3-NL cells. When both T cell subsets are depleted, protection is completely eliminated. This was found to be the case both for acute rejection and later in mice that were 60 days postimmunization. The later set of experiments also suggest that B cells play little or no role in the rejection process. This is based on the argument that while 60 days is sufficient time for Ab-mediated responses to develop, we found that elimination of T cells alone was sufficient to abrogate protective immunity.

To test for detrimental effects on normal B cell populations, we examined mice that had successfully rejected the 70Z/3NL tumor. We undertook FACS analysis using common cell surface markers to determine the percentage and absolute number of B lineage cells in the spleen and bone marrow of such mice along with controls. For example, we found normal numbers of mature splenic B cells (µ + {delta}high) (controls: 24.8; 20.4 (x106) experimental: 23.2, 26.5 (x106)), bone marrow pre-B cells (B220low, µ–, CD43–) (controls: 4.4; 3.9 (x106) experimental: 5.6, 4.2 (x106)), and bone marrow pro-B cells (B220+CD43+) (controls: 0.79; 0.54 (x106) experimental: 0.80, 0.55 (x106)). This suggests that 70Z/3-NL and 70Z/3-L cells, which are also eliminated after activation induced by 70Z/3-NL cells, may possess tumor-associated Ags (TAA)3 not found on normal B lineage cells.

TAAs have been identified from a number of tumors. TAAs were expected to lead to potent vaccination procedures as they offered targets that were relatively specific to the tumors. They also represented interesting therapeutic targets as they could be generated in vitro as peptides or proteins, both of which can be used for vaccination. It was found, however, that obtaining effective vaccination and tumor destruction is difficult even with the help of TAAs. We demonstrated that both variants express common CTL Ags recognized by the immune system. The 70Z/3-L cells were shown to be sensitive to killing by CTLs generated against the 70Z/3-NL, indicating that the recognized Ag is also present in 70Z/3-L cells. The fact that 70Z/3-L is unable to initiate rejection emphasizes the importance of context in the presentation of tumor Ags to the immune system. The ability of 70Z/3-NL to induce an immune response may not be dependant on a TAA. Alternatively, the 70Z/3-NL cells may be expressing molecules which assist in the presentation of Ags to T cells which the 70Z/3-L cells lack. Another possibility is that 70Z/3-NL cells contain receptors or factors that modulate the ability of host APCs to capture and present Ags. We have not ruled out the possibility that an Ag is found only on 70Z/3-NL and that once a reaction is initiated against it, other epitopes are also recognized. These responses could be leading to the rejection of 70Z/3-L. The rapid appearance of protective immunity against 70Z/3-L after 70Z/3-NL injection suggests, however, that the recognized tumor epitopes are likely to be present on both 70Z/3-L and 70Z/3-NL.

The isolation of 70Z/3-NL clones raises questions regarding the nature of the difference between the variants. The 2E4 and 2G6 cell lines were isolated from the variant 70Z/3-NL. We further isolated clones from both 2E4 and 2G6 and challenged mice with these clones. The 2G6 line, derived from 70Z/3-NL, presented a phenotype very similar to 70Z/3-L yet its subclones allowed some mice to survive after injection. One 2G6 subclone behaved like 70Z/3-NL. We did observe that 2G6 itself also reverted to a much milder phenotype where only some mice died from injections. As 2E4 and 2G6 were both derived from a single cell, they could not initially contain immunogenic and nonimmunogenic cells, as does the 70Z/3-NL variant. This indicates that intrinsic changes happened in the cells leading to the appearance of immunogenic and nonimmunogenic populations. It furthers shows that the immunogenicity of the cells can be quite unstable as the phenotype of 2G6 changed within a few cell culture passages. Although the stability and absolute nature of our results with 70Z/3-L and 70Z/3-NL point to a well-defined trait leading to rejection being present or absent, the variability observed in the 2G6 subclones shows that the mechanisms leading to rejection may be more complex. One possible explanation for the phenotype variations of 2G6 is not the absence of a trait but rather a difference in the level of expression of this trait. This could explain the intermediate phenotype of lines derived from 70Z/3-NL. Some lines could express lower levels of the gene associated with the rejection. The effects of this gene may not be totally absent but near the threshold of activity. In some cases, when the proper immune cells are present, the signals could be sufficient for the initiation of a response, in other instances, the same cells could not stimulate the immune system. Alternatively, the variability of the immunogenicity of the subclones of 70Z/3-NL could be observed if multiple genes were involved in the rejection. In this case, the clones with intermediate ability to cause disease could have lost expression of one or multiple markers involved in the strong induction of the immune response caused by 70Z/3-NL. The remaining genes could still provide some measure of protection but again only when proper conditions occur in the mouse.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the National Cancer Institute of Canada/Terry Fox Foundation. Back

2 Address correspondence and reprint requests to Dr. Alain Labbe, Ontario Cancer Institute, 8-105 Princess Margaret Hospital, Toronto, Ontario M5G 2M9, Canada. E-mail address: alain.labbe{at}gmail.com Back

3 Abbreviation used in this paper: TAA, tumor-associated Ag. Back

Received for publication November 15, 2005. Accepted for publication February 14, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Bilgrami, S., M. Silva, A. Cardoso, K. B. Miller, J. L. Ascensao. 1994. Immunotherapy with autologous bone-marrow transplantation: rationale and results. Exp. Hematol. 22: 1039-1050. [Medline]
  2. Rosenberg, N.. 1994. Abl-mediated transformation, immunoglobulin gene rearrangements and arrest of B lymphocyte differentiation. Semin. Cancer Biol. 5: 95-102. [Medline]
  3. Figlin, R. A., W. C. Pierce, R. Kaboo, C. L. Tso, N. Moldawer, B. Gitlitz, J. deKernion, A. Belldegrun. 1997. Treatment of metastatic renal cell carcinoma with nephrectomy, interleukin-2 and cytokine-primed or CD8+ selected tumor infiltrating lymphocytes from primary tumor. J. Urol. 158: 740-745. [Medline]
  4. Dudley, M. E., J. Wunderlich, M. I. Nishimura, D. Yu, J. C. Yang, S. L. Topalian, D. J. Schwartzentruber, P. Hwu, F. M. Marincola, R. Sherry, et al 2001. Adoptive transfer of cloned melanoma-reactive T lymphocytes for the treatment of patients with metastatic melanoma. J. Immunother. 24: 363-373.
  5. Becker, C., H. Pohla, B. Frankenberger, T. Schuler, M. Assenmacher, D. J. Schendel, T. Blankenstein. 2001. Adoptive tumor therapy with T lymphocytes enriched through an IFN-{gamma} capture assay. Nat. Med. 7: 1159-1162. [Medline]
  6. Cardoso, A. A., M. J. Seamon, H. M. Afonso, P. Ghia, V. A. Boussiotis, G. J. Freeman, J. G. Gribben, S. E. Sallan, L. M. Nadler. 1997. Ex vivo generation of human anti-pre-B leukemia-specific autologous cytolytic T cells. Blood 90: 549-561. [Abstract/Free Full Text]
  7. Stripecke, R., A. M. Levine, V. Pullarkat, A. A. Cardoso. 2002. Immunotherapy with acute leukemia cells modified into antigen-presenting cells: ex vivo culture and gene transfer methods. Leukemia 16: 1974-1983. [Medline]
  8. Eklund, J. W., T. M. Kuzel. 2004. A review of recent findings involving interleukin-2-based cancer therapy. Curr. Opin. Oncol. 16: 542-546. [Medline]
  9. Manzke, O., F. Berthold, K. Huebel, H. Tesch, V. Diehl, H. Bohlen. 1999. CD3xCD19 bispecific antibodies and CD28 bivalent antibodies enhance T-cell reactivity against autologous leukemic cells in pediatric B-ALL bone marrow. Int. J. Cancer 80: 715-722. [Medline]
  10. van Mierlo, G. J., A. T. den Boer, J. P. Medema, E. I. van der Voort, M. F. Fransen, R. Offringa, C. J. Melief, R. E. Toes. 2002. CD40 stimulation leads to effective therapy of CD40– tumors through induction of strong systemic cytotoxic T lymphocyte immunity. Proc. Natl. Acad. Sci. USA 99: 5561-5566. [Abstract/Free Full Text]
  11. Cardoso, A. A., J. L. Schultze, V. A. Boussiotis, G. J. Freeman, M. J. Seamon, S. Laszlo, A. Billet, S. E. Sallan, J. G. Gribben, L. M. Nadler. 1996. Pre-B acute lymphoblastic leukemia cells may induce T-cell anergy to alloantigen. Blood 88: 41-48. [Abstract/Free Full Text]
  12. Kosmas, C., K. Stamatopoulos, N. Stavroyianni, N. Tsavaris, T. Papadaki. 2002. Anti-CD20-based therapy of B cell lymphoma: state of the art. Leukemia 16: 2004-2015. [Medline]
  13. Dilloo, D., M. Brown, M. Roskrow, W. Zhong, M. Holladay, W. Holden, M. Brenner. 1997. CD40 ligand induces an antileukemia immune response in vivo. Blood 90: 1927-1933. [Abstract/Free Full Text]
  14. Paige, C. J., P. W. Kincade, P. Ralph. 1978. Murine B cell leukemia line with inducible surface immunoglobulin expression. J. Immunol. 121: 641-647. [Abstract/Free Full Text]
  15. Lefkovitz, I.. 1972. Induction of antibody-forming cell clones in microcultures. Eur. J. Immunol. 2: 360-366. [Medline]
  16. Saleque, S., M. Singh, B. K. Birshtein. 1999. Ig heavy chain expression and class switching in vitro from an allele lacking the 3' enhancers DNase I-hypersensitive hs3A and hs1,2. J. Immunol. 162: 2791-2803. [Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Labbe, A.
Right arrow Articles by Paige, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Labbe, A.
Right arrow Articles by Paige, C. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS