|
|
||||||||



* Department of Immunology, University of Toronto, Sunnybrook and Womens Research Institute, Toronto, Ontario, Canada;
Departamento de Immunología y Oncología, Centro Nacional de Biotecnología-Consejo Superior de Investigaciones Científicas, Universidad Autónoma de Madrid, Madrid, Spain; and
Division of Hematology/Oncology, Childrens Hospital and Dana-Farber Cancer Institute, Harvard Medical School, and Howard Hughes Medical Institute, Boston MA 02115
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
One highly conserved signaling pathway, which controls multiple lineage fate decisions during development, and has been implicated in the ability of the thymus to support T lymphopoiesis, is the Notch pathway (4). In mammals, four Notch receptors (Notch-1, -2, -3, and -4) can be engaged by five ligands: Delta-like (Dll)-1, -3, and -4 and Jagged-1 and -2. Following ligand binding, two proteolytic cleavage events, mediated by a disintegrin and metalloprotease and
-secretase activity, release the intracellular domain of the Notch receptor (ICN), which translocates to the nucleus. In the canonical Notch-signaling pathway, ICN induces the expression of target genes, such as HES-1, via the DNA-binding protein CBF1/supressor of hairless/Lag-1 (CSL) (4). Alternate, CSL-independent pathways of Notch signaling have been proposed, but their importance in vertebrates is not clear (5) and deficiency in CSL, like deficiency in Notch 1, is embryonic lethal (6, 7, 8).
Within the hemopoietic system, Notch receptors and their ligands are expressed by both hemopoietic progenitors (HPC) and stromal cells (9, 10, 11). Notch receptor-ligand interactions in the thymus have been shown to favor T lymphopoiesis, and discourage commitment to other lineages (12, 13). Not surprisingly, bone marrow-derived stromal lines such as OP9 cells, which have been used to support robust in vitro myelopoiesis, erythropoiesis, and B and NK lymphopoiesis, from embryonic stem cell (ESC)-, fetal liver- and adult bone marrow-derived HPCs (14, 15, 16, 17), do not support T lymphopoiesis. In fact, HPCs are rapidly induced to commit to non-T cell fates in the OP9 stromal cell environment (18). Interestingly, neither OP9 cells nor bone marrow stroma express detectable levels of Dll-1 (19), in sharp contrast to the high levels of Dll-1 expression found on thymic epithelial cells (20, 21). We have recently demonstrated that when OP9 cells are retrovirally transduced to express Dll-1 (OP9-DL1 cells), they support T, but no longer B, lymphopoiesis from HPCs (22, 23).
In this study, we use this system to characterize the effect of Dll-1/Notch interactions on the commitment and maturation of myeloid cells, another hemopoietic lineage that is supported by the bone marrow, but not the thymic, microenvironment.
Although Pui et al. (12) observed no myelopoietic defect from bone marrow retrovirally transduced with ICN, others have reported that exposure to soluble or bound Notch ligands (24, 25, 26), or transduction with constitutively active Notch (27, 28, 29, 30) or its downstream target HES-1 (31), inhibits myelopoiesis from most hemopoietic cell lines and HPCs (32, 33). In particular, others have observed that the Jaggeds do not impede myelopoiesis (34, 35), but Dll-1 does (36, 37). In contrast, two groups found that Notch signaling promotes differentiation by the 32D cell line (38, 39, 40), while a separate report concluded that Notch signals are necessary for the differentiation of dendritic cells, but prevent their maturation (41). Similarly, Tan-Pertel et al. (40) found that constitutive Notch activation enhances granulopoiesis, but inhibits terminal differentiation. Thus, controversy still remains regarding the effect of Notch signals on the myeloid potential of uncommitted progenitors, and whether Notch signals deviate committed myeloid progenitors to other lineages (36), induce their apoptosis (42), or have no effect at all (12). Further, the targets of Notch signaling in multipotent HPCs are largely unknown.
In this study, we show that myelopoiesis from HPCs obtained from fetal liver, adult bone marrow, or ESCs is severely inhibited in OP9-DL1 vs OP9-control cell cultures. In contrast, committed myeloid progenitors complete their maturational program regardless of the presence of Dll-1. Further, we demonstrate that the Dll-1-induced inhibition of myelopoiesis is mediated by canonical Notch signals within the hemopoietic cell, as the developmental block is absent when CSL/ ESCs are cultured on OP9-DL1 cells. In agreement with others (43, 44), we find that GATA-2 expression is maintained in HPCs undergoing differentiation in the presence of Notch signals. Importantly, we extend previous findings to establish that modulation of GATA-2 expression is required to mediate the Dll-1-induced defect in myelopoiesis, as HPCs that lack GATA-2 do not demonstrate a Notch/Dll-1-mediated inhibition of myelopoiesis. Thus, our results provide a potential mechanism for the observed function of Dll-1 in mediating the lineage restriction of differentiating HPCs within specific microenvironments.
| Materials and Methods |
|---|
|
|
|---|
Timed-pregnant Swiss.NIH and C57BL/6 CD45.1 congenic mice were obtained from the National Cancer Institute, Frederick Cancer Research and Development Center (Frederick, MD).
Differentiation of ESCs and cell culture
OP9 cells were originally obtained from Dr. T. Nakano (Osaka University, Osaka, Japan) and the Riken Cell Bank (Tsukuba, Japan). The generation of OP9-DL1 cells and OP9-control (GFP only) cells is described in Schmitt and Zúñiga-Pflücker (23). ESC/OP9 differentiation cocultures, using either OP9-DL1 or OP9-control cells and ESR1, CSL+/, CSL/, GATA-2+/, or GATA-2/ ESCs were performed as previously described (15, 16). Briefly, 5 x 104 ESCs were seeded onto either OP9-DL1 or OP9-control cell monolayers in 10-cm dishes. After 5 days of coculture, cells were harvested and resuspended into single-cell suspensions by 0.25% trypsin treatment and vigorous pipetting. Cells were then washed and reseeded onto new OP9 cell monolayers, with the addition of Flt3L at a final concentration of 5 ng/ml (R&D Systems). Nonadherent cells were passed to fresh OP9 monolayers again at day 8 of coculture, and thereafter ESC/OP9 cocultures were maintained in the presence of 5 ng/ml Flt3L and 1 ng/ml IL-7 (R&D Systems) by changing media or passaging (without trypsin) to fresh OP9 monolayers every 2 days. GATA-2/ and GATA-2+/ESC cultures, because of the reduced hemopoietic efficiency of GATA-2/ progenitors, were seeded onto OP9-control stroma and either maintained on OP9-control stroma or transferred to OP9-DL1 cells at day 8. This was to relieve the GATA-2/ progenitors from the early proliferative inhibition observed in the presence of OP9-DL1 cells (R. de Pooter, unpublished observations). HPCs isolated from adult bone marrow or fetal liver were cocultured similarly to ESC-derived progenitors: in the presence of Flt3L at a final concentration of 5 ng/ml and IL-7 at 1 ng/ml.
For experiments using presenilin inhibitors, Presenilin inhibitor X (Calbiochem) was added to cultures of sorted CD117+Sca-1high fetal liver-derived HPCs on OP9-DL1 cells, at a final concentration of 0.33 or 1.0 µM. The same volume of DMSO was added to all cultures, including the control culture.
Isolation of HPCs
HPCs were isolated from day 14 fetal liver cells by enriching for CD24low lineage marker (Lin) fetal liver cells by anti-CD24 Ab-/complement-mediated depletion (45), and sorting for the expression of CD117 and Sca-1. HPC from adult bone marrow were isolated by staining for Lin (Ter119, CD11b, Gr-1, CD4, CD8, CD45R), CD117, and Sca-1, and sorting based on a phenotype of LinCD117+Sca-1high. Equal numbers of CD117+Sca-1high HPC were seeded onto a
80% confluent monolayer of either OP9-DL1 or OP9-control cells. To isolate common myeloid progenitors (CMP) and granulocyte-macrophage progenitors (GMP) from adult bone marrow (46), Lin+ (CD3, CD4, CD8, CD45R, Gr-1, Ter119, CD19, IgM), IL-7R+, and Sca-1+ cells were depleted by MACS (Miltenyi Biotec). The resulting populations were then sorted based on expression of CD16/32 and CD34: CMP as CD117+CD34+CD16/32int, and GMP as CD117+CD34+CD16/32+ (46).
For RT-PCR analysis, fetal liver cells were obtained from 13 days postcoitus (dpc) embryos, depleted of CD24high cells by anti-CD24 Ab-/complement-mediated depletion (45), stained with PE-conjugated anti-Sca-1 Ab (BD Biosciences) and anti-PE magnetic microbeads (Miltenyi Biotec), and Sca-1+ cells were isolated by two successive double-sensitive enrichments. Cocultures were harvested by vigorous pipetting at the indicated time points.
Flow cytometry and cell sorting
Flow cytometry was performed using a FACSCalibur instrument (BD Biosciences) as previously described (45). FITC-, PE-, biotin-, and allophycocyanin-conjugated Abs, and CyChrome-conjugated streptavidin were purchased from BD Biosciences. For analysis of hemopoietic cells, live cells were gated based on forward and side scatter, lack of propidium iodide uptake, and lack of GFP expression. Cells were sorted using a FACSDiVa instrument (BD Biosciences) as previously described. Sorted cells were >99% pure, as determined by postsort analysis.
MACS enrichment was performed according the manufacturers instructions (Miltenyi Biotec).
Limiting dilution assay
For the limiting dilution assay, equal numbers of sorted CD117+Sca-1high fetal liver-derived HPCs were cultured on either OP9-control or OP9-DL1 cells for 5 days, in the presence of Flt3L at a final concentration of 5 ng/ml. Following 5 days of culture, 12 replicates each of 100, 30, 10, 3, or 1 cell(s)/well were deposited by Clonecyte sorting into 96-well plates containing confluent monolayers of OP9-control cells. The fetal liver-derived cells were then cultured in the presence of Flt3L at a final concentration of 5 ng/ml and IL-3 at a final concentration of 1 ng/ml (R&D Systems), and analyzed by flow cytometry after 8 days.
PCR and RT-PCR
For RT-PCR analysis, cDNA was prepared from OP9-control and OP9-DL1 cells, freshly isolated ex vivo CD117+Sca-1high sorted fetal liver progenitors, freshly isolated ex vivo CD44+CD25CD117+ (DN1 subset) and CD44+CD25+CD117+ (DN2 subset) day 14 fetal thymocytes (47), and Sca-1+ MACS-enriched fetal liver progenitors cultured for 37 h on either OP9-DL1 or OP9-control stroma. In the latter case, contamination by OP9 cells was minimized by sorting CD45+ cells directly into TRIzol (Invitrogen Life Technologies). OP9-control and OP9-DL1 cells were also collected using TRIzol. For the time course comparing GATA-2 expression patterns in CSL/ vs CSL+/ ESC-derived hemopoietic cells, ESCs were seeded onto OP9-control cells as described above, and transferred to OP9-DL1 cells at day 8 of coculture. RNA was isolated following manufacturers instructions. All semiquantitative PCRs were performed using 3-fold serial dilutions of cDNA that had been normalized by
-actin or CD45 expression, as indicated, using the following primers:
-actin forward GTGGGCCGCTCTAGGCACCAA,
-actin reverse CTCTTTGATGTCACGCACGATTTC (535 bp, 55°C); CD45 forward CTACGCAAAGCACGGCCTG, CD45 reverse TCGAGTCTGCGTTGTCCCAC (340 bp, 52°C); GATA-2 forward ACACAC CACCCGATACCCACCTAT, GATA-2 reverse CCTACGCCATGGCAGTCACCATGCT (720 bp, 60°C) (43); PU.1 forward ATGGAAGGGTTTTCCCTCACCGCC, PU-1 reverse GTCCACGCTCTGCAGCTCTGTGAA (216 bp. 61°C) (48); CD3 forward ATGGCCAAGAGCTGC, CD3 reverse AGAATACAGGTCCCGCT (384 bp, 57°C); CD25 forward GTTGGGGTTTCTCTCATTA, CD25 reverse GGTGGTGTTCTCTTTCATC (542 bp, 55°C); TCR C
forward, AGAACCTGCTGTGTACCAGTTAA, TCR C
reverse CATGAGCAGGTTAAATCCGGCT (331 bp, 60°C). The PCR program was as follows: 95°C for 2 min, and 30 cycles (
-actin, CD45) or 34 cycles (all others) of 95°C for 30 s, annealing temperature for 30 s, 72°C for 30 s, followed by a 4-min extension at 72°C.
Immunohistochemistry
Cell smears were taken down to water, and endogenous peroxidase was blocked with 3% H2O2 for 15 min. Smears were then rinsed with water, followed by Tris buffer and blocked for 10 min with 10% nonimmune goat serum (Zymed Laboratories). Cell smears were stained with rabbit anti-myeloperoxidase at 1/2000 (DakoCytomation) at room temperature for 1 h. Cell smears were then washed three times with Tris, incubated with biotinylated goat anti-rabbit Ab (Zymed Laboratories) for 15 min at room temperature, and washed three more times. Cell smears were then labeled with peroxidase-conjugated streptavidin (Zymed Laboratories) and washed three more times with Tris before being developed in diaminobenzidine solution for 10 min. Cell smears were then washed with water and counterstained in Harris hematoxylin before being dehydrated, cleared, and mounted.
| Results |
|---|
|
|
|---|
OP9 cells, despite their failure to produce M-CSF (17), support the production of myeloid cells from various sources of HPC (14, 15) (Fig. 1A, upper panels). This allowed us to examine the effects of Dll-1 on myelopoietic potential by coculturing uncommitted HPCs on either OP9-DL1 or OP9-control cells.
|
|
|
To address whether the OP9-DL1 environment could inhibit the maturation of committed myeloid progenitors, bone-marrow-derived LinCD117+Sca-1CD34+ CMP and GMP, as defined by Akashi et al. (46) on the basis of CD16/32 expression, were cultured on either OP9-control or OP9-DL1 cells for 3 days. CD16/32int CMPs and CD16/32+ GMPs appeared to be unimpeded in their ability to generate CD11bhigh myeloid cells in OP9-DL1 cultures (Fig. 3), although CMPs showed a slight 2-fold reduction in cell yields. Thus, committed myeloid progenitors are not sensitive to an OP9-DL1-induced developmental block, as they can mature to express high cell surface levels of CD11b in the presence of either OP9-DL1 or OP9-control cells. No evidence for apoptosis was observed, as these populations persisted on both stroma for at least 7 days (data not shown).
|
To confirm that the observed defect in myelopoiesis was due to Notch signaling, we cultured fetal liver HPCs on OP9-DL1 cells in the presence or absence of a Presenilin inhibitor specific for both Presenilins-1 and -2. We found that the percentage of CD11bhigh cells increased with increasing concentrations of this inhibitor (Fig. 4A).
|
To distinguish between these two possibilities, we used HPCs derived from CSL/ ESCs. When cocultured with OP9-DL1 cells, CSL+/ ESC-derived HPCs behaved as wild-type cells (Fig. 1A), exhibiting a profound defect in myelopoiesis (Fig. 4B), and giving rise to T lineage cells at later time points (data not shown). In contrast, CSL/ ESCs produced robust populations of myeloid cells in the presence of Dll-1 (Fig. 4B). These results demonstrate that Notch signaling within the HPC is sufficient and required to mediate the block in myelopoiesis observed in cocultures with OP9-DL1 cells, and that the induced inhibition is downstream of the canonical Notch-signaling pathway mediated by CSL.
GATA-2 is differentially expressed in OP9-DL1 vs OP9-control cocultures
Our results showed that the diminished myelopoiesis from HPCs cultured on OP9-DL1 cells was the result of Notch signals within the hemopoietic cells. Thus, to address the mechanism of this block, we used semiquantitative RT-PCR to examine the expression of several genes known to be involved in hemopoiesis. To this end, RNA was isolated from fetal liver HPCs cultured on either OP9-control or OP9-DL1 cells for 37 h. This early time point was chosen to focus on events proximal to Notch signals. Although several genes were examined, strikingly, analysis by densitometry showed that GATA-2 expression was up-regulated
3.5-fold in HPCs cultured on OP9-DL1 cells, compared with those on OP9-control cells (Fig. 5A). In contrast, PU.1 expression was not differentially affected in HPCs cultured on either stroma at this early time point (Fig. 5A). In addition, we also examined whether GATA-2 is expressed by thymocyte progenitors. Fig. 5B shows that the earliest thymic immigrants, which are contained within the CD117+CD44+CD25 subset (DN1 cells), express detectable levels of GATA-2, in contrast to the T cell-specified CD117+CD44+CD25+ subset (DN2 cells). This observation suggests in vivo relevance for the increased expression of GATA-2 by fetal liver HPCs cultured on OP9-DL1 vs OP9-control cells. We then examined the expression of GATA-2 by ESC-derived cells in the presence or absence of Notch signals, by comparing GATA-2 mRNA levels in CSL+/ or CSL/ ESC-derived HPCs cultured on OP9-control cells for 8 days, and then transferred to OP9-DL1 cells to induce Notch signals. GATA-2 expression was analyzed from the ESC cocultures at the indicated culture periods, and normalized to CD45 expression levels as a gauge of hemopoietic cell contribution. Our results show that, similar to fetal liver-derived hemopoietic cells, ESC-derived HPCs sustained GATA-2 expression in the presence (CSL+/), but not the absence (CSL/), of Notch signals (Fig. 5C). These initial results suggested that sustained GATA-2 expression in HPCs, as a consequence of Dll-1-induced Notch signals, could be proximally involved in the myelopoietic block observed on OP9-DL1 cells.
|
The observed Notch signaling-dependent increase in GATA-2 expression by fetal liver- or ESC-derived HPCs was consistent with results from Kumano et al. (43) using the 32D myeloid cell line transduced with ICN. Given that overexpression of GATA-2 did not cause a maturational block in this cell line model system, we asked whether GATA-2 is required for the Dll-1-induced block of myelopoiesis observed in primary cells. GATA-2 deficiency is embryonic lethal before 10.5 dpc and embryos exhibit severe anemia due to the requirement for GATA-2 for efficient expansion of HSCs, precluding the use of GATA-2/ fetal liver or adult bone marrow (50). Nevertheless, GATA-2/ ESCs give rise to myeloid lineage cells when cultured on either OP9-control or OP9-DL1 cells (Fig. 6A). This is in marked contrast to the case of wild-type ESCs (Fig. 1A) or GATA-2+/ ESCs (Fig. 6A), which showed a dramatic reduction in myelopoiesis when cultured on OP9-DL1 cells, as compared with OP9-control cells (Fig. 6). The ability of GATA-2/ ESCs to give rise to myeloid cells is not due simply to their inability to respond to the OP9-DL1 environment, as these cells give rise to T cells when cultured on OP9-DL1 cells (Fig. 6B). Although, in keeping with their reduced potential for early hemopoietic expansion, fewer T cells were produced in the absence of GATA-2, the percentages of CD4+CD8+ cells that were generated were similar to wild-type ESC cultures.
|
| Discussion |
|---|
|
|
|---|
Although it has been suggested that signals downstream of Notch are involved in inhibiting myelopoiesis, there are conflicting reports regarding this and potential underlying mechanisms. Our results suggest that some of these contradictions might have arisen because only uncommitted progenitors are susceptible to a Notch-mediated inhibition in myelopoiesis. Indeed, two recent findings using the same model system, but starting with different types of HPC, have shown differing degrees of myeloid inhibition in response to Notch-induced signals (44, 55). On one hand, fetal liver CD117+ progenitors showed nearly a 3-fold reduction in myelopoiesis (44), while purified bone marrow CD117+Sca-1high HSCs showed considerably greater 14-fold change between OP9-DL1 and OP9-control cultures (55). This discrepancy in fold change is probably the result of committed myeloid progenitors present in the CD117+Sca-1 population, consistent with our unpublished observations that this population contains sufficient committed myeloid progenitors to obscure any defect in myelopoiesis in the cultures with OP9-DL1 stroma. Furthermore, other models using the 32D cell line have yielded disparate conclusions regarding the role of Notch in myelopoiesis. However, as it is unclear where the 32D cell line falls on the gradient between specification and commitment to the myeloid lineage, it is possible that the conflicting results obtained using this cell line, finding either that Notch signals inhibit (26, 29, 30, 43) or promote myeloid differentiation (38, 39, 40), may reflect clonal variation in this regard. The requirement to transfect 32D cells with exogenous Notch to render them responsive to Notch ligands, despite the presence of endogenous Notch expression (40), might also reflect a resistance to physiological levels of Notch signaling.
Although previous analysis of Notch1 deficient in vivo models did not report an accumulation of myeloid cells, this does not exclude a physiological relevance for Dll-1-mediated signals in inhibiting myeloid commitment, as such an accumulation might not have been examined. Further, in the absence of Notch signaling, the B cell fate is available to progenitors entering the thymus, and in the IL-7-rich lymphopoietic thymic environment, B cells would have a proliferative advantage over myeloid cells.
An important aspect of the OP9 model system is differentiation kinetics, as HSCs do not undergo long-term self-renewal in this environment, and the various lineages arise in successive waves. Specifically, erythroid and myeloid lineages appear first, followed by lymphoid cells (16). Notably, at the time points shown here, neither culture is composed predominantly of lymphocytes, thus the defect in myelopoiesis observed in OP9-DL1 cocultures is not due to the same number of myeloid cells being masked by large numbers of T cell progenitors. Additionally, the block in myelopoiesis is not due to a rapid commitment of HPCs to the T cell fate on OP9-DL1 cells, as the ability of GATA-2/ ESCs to give rise to both myeloid and T lineage cells on OP9-DL1 cells demonstrates that the defect in myelopoiesis and commitment to the T cell fate are mechanistically distinct events. Nor does the defect in myelopoiesis appear to be one of delayed kinetics, despite the evidence that Notch signals can delay cell cycle (32, 56), as myeloid populations do not arise even at later time points. Neither is Dll-1 simply preventing all hemopoietic differentiation, as OP9-DL1 cocultures produce robust populations of T lineage cells at later time points (23, 49).
Our results showing that GATA-2 expression is up-regulated by fetal liver- or ESC-derived HPCs in the presence of Dll-1 agree with observations by Kumano et al. (43), who also found that myeloid maturation in the 32D myeloid cell line could be blocked by transduction with ICN or HES-1. However, while this inhibition could be overcome by further transducing 32D cells with either a dominant-negative form of GATA-3 (DN-GATA3), which inhibits all GATA family members, or PU.1, overexpression of GATA-2 itself did not block myeloid maturation. As neither DN-GATA3 nor PU.1 is a specific inhibitor of GATA-2 function, these results, while suggestive, did not allow the conclusion that Notch acts through GATA-2 to interfere with normal myelopoiesis (43).
Recent findings in both nonhemopoietic systems (57) and peripheral T cells (58) have demonstrated regulatory interactions between Notch signals and GATA family transcription factors during differentiation. Importantly, given our hypothesis that Notch signaling-induced modulation of GATA-2 expression is involved in restricting non-T lineage fate choices within the thymus, we find that DN1 thymocytes express GATA-2. As GATA-2 expression is lost by the T cell-committed DN2 stage of thymocyte development, other mechanisms must later assume the role of excluding the myeloid fate, indicating that GATA-2 is not required for maintenance of the T cell fate. In fact, we have demonstrated that GATA-2 is not required for T lymphopoiesis, as GATA-2/ ESCs produce CD4+CD8+ T lineage cells when cultured on OP9-DL1 cells (Fig. 6). In contrast, we have directly assessed the role of GATA-2 in mediating the Dll-1/Notch-induced block of myelopoiesis, and demonstrate that the absence of GATA-2 alleviates the defect in myelopoiesis observed in the presence of Dll-1. Although our results do not allow us to draw conclusions regarding how Notch signals control GATA-2 up-regulation, recent work by others has demonstrated the presence of CSL-binding sites in the regulatory regions of the GATA-2 gene (57), suggesting that ICN can directly up-regulate GATA-2 expression.
We chose to examine a system in which GATA-2 was absent, instead of one in which GATA-2 was overexpressed. This avoided the inherent, confounding problems of forced overexpression of GATA-2 in hemopoiesis (59, 60).
Although GATA-2 is required for the efficient expansion of the HSC pool during development, and its homeostasis in the adult, GATA-2-deficient cells appear to be capable of the full range of hemopoietic differentiation (50, 61, 62), suggesting that hemopoietic commitment in the absence of GATA-2 is not sufficiently perturbed to preclude the conclusions drawn from our model system.
A role for GATA-2 in inhibiting myelopoiesis is consistent with the ability of GATA-2 to physically interact with the Ets transcription factor PU.1 and interfere with its ability to transactivate target genes (60, 63, 64). This suggests that the inability of Notch signals to inhibit myelopoiesis from committed progenitors might be due to the high levels of PU.1 expressed by committed myeloid progenitors, which could preclude effective inhibition by GATA-2. Alternatively, myeloid progenitors may no longer be responsive to Notch signals. Initially, GATA-2 does not appear to down-regulate the expression of PU.1, but rather to interfere with its function (64), although GATA-2 may inhibit PU.1 expression at later time points (60). This mechanism is consistent with our observation that PU.1 expression is equivalent between HPCs cultured on either OP9-control or OP9-DL1 cells, and with antagonism between PU.1 and another GATA family member, GATA-1, during erythropoiesis (64, 65, 66, 67). Furthermore, while GATA-2 expression is required for efficient early hemopoiesis (50, 68, 69), it is dispensable for myeloid terminal differentiation (69), and is antagonized by PU.1 during macrophage differentiation (63).
In turn, while PU.1/ embryos lack significant numbers of T cells, B cells, and macrophages (70, 71), PU.1 seems to be only absolutely required for B lymphopoiesis and myelopoiesis, as adult PU.1/ HPCs are capable of low levels of T cell development (72). Thus, taken with other findings demonstrating that graded expression of PU.1 is involved in B cell vs macrophage lineage commitment (73), it is possible that Notch/Dll-1 interactions could inhibit PU.1 function to below the level required for B and myeloid cell production without abrogating T cell development.
Taken together, our results, and the existing literature on the role of GATA-2 in hemopoiesis and its interactions with other hemopoietic transcription factors (74), lead us to propose a model in which sustained GATA-2 expression downstream of Dll-1/Notch receptor interactions may contribute to the lineage restriction of early thymic immigrants.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by the National Cancer Institute of Canada, with funds from the Canadian Cancer Society. R.F.d.P. is supported by a Doctoral Research Award from the Canadian Institute of Health Research. J.C.Z.-P. is supported by a Canada Research Chair in Developmental Immunology. ![]()
2 Address correspondence and reprint requests to Dr. Juan Carlos Zúñiga-Pflücker, Department of Immunology, University of Toronto, Sunnybrook & Womens Research Institute, 2075 Bayview Avenue, Room A-331, Toronto, Ontario M4N 3M5, Canada. E-mail address: jczp{at}swri.ca ![]()
3 Abbreviations used in this paper: HSC, hemopoietic stem cell; Dll, Delta-like; ESC, embryonic stem cell; HPC, hemopoietic progenitor; CMP, common myeloid progenitor; CSL, CBF1/supressor of hairless/Lag-1; dpc, days postcoitus; GMP, granulocyte-macrophage progenitor; ICN, intracellular Notch. ![]()
Received for publication December 12, 2005. Accepted for publication February 20, 2006.
| References |
|---|
|
|
|---|
gene results in early embryonic death. Development 121: 3291-3301. [Abstract]
T lymphocyte lineage commitment. Immunity 9: 187-197. [Medline]
-dependent Notch function regulates Gata2 and is essential for the formation of intra-embryonic hematopoietic cells. Development 132: 1117-1126. This article has been cited by other articles:
![]() |
R. Holmes and J. C. Zuniga-Pflucker The OP9-DL1 System: Generation of T-Lymphocytes from Embryonic or Hematopoietic Stem Cells In Vitro CSH Protocols, February 1, 2009; 2009(2): pdb.prot5156 - pdb.prot5156. [Abstract] [Full Text] |
||||
![]() |
N. P. Rodrigues, A. S. Boyd, C. Fugazza, G. E. May, Y. Guo, A. J. Tipping, D. T. Scadden, P. Vyas, and T. Enver GATA-2 regulates granulocyte-macrophage progenitor cell function Blood, December 15, 2008; 112(13): 4862 - 4873. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-J. Yoon, B.-K. Koo, R. Song, H.-W. Jeong, J. Shin, Y.-W. Kim, Y.-Y. Kong, and P.-G. Suh Mind bomb-1 Is Essential for Intraembryonic Hematopoiesis in the Aortic Endothelium and the Subaortic Patches Mol. Cell. Biol., August 1, 2008; 28(15): 4794 - 4804. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhou, L. W. Li, Q. Yan, B. Petryniak, Y. Man, C. Su, J. Shim, S. Chervin, and J. B. Lowe Notch-dependent control of myelopoiesis is regulated by fucosylation Blood, July 15, 2008; 112(2): 308 - 319. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sakata-Yanagimoto, E. Nakagami-Yamaguchi, T. Saito, K. Kumano, K. Yasutomo, S. Ogawa, M. Kurokawa, and S. Chiba From the Cover: Coordinated regulation of transcription factors through Notch2 is an important mediator of mast cell fate PNAS, June 3, 2008; 105(22): 7839 - 7844. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Naujokat and T. Saric Concise Review: Role and Function of the Ubiquitin-Proteasome System in Mammalian Stem and Progenitor Cells Stem Cells, October 1, 2007; 25(10): 2408 - 2418. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Caton, M. R. Smith-Raska, and B. Reizis Notch-RBP-J signaling controls the homeostasis of CD8- dendritic cells in the spleen J. Exp. Med., July 9, 2007; 204(7): 1653 - 1664. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Ma, M. J. Renda, L. Wang, E.-c. Cheng, C. Niu, S. W. Morris, A. S. Chi, and D. S. Krause Rbm15 Modulates Notch-Induced Transcriptional Activation and Affects Myeloid Differentiation Mol. Cell. Biol., April 15, 2007; 27(8): 3056 - 3064. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |