| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Production in CXCR3–/– Mice with Experimental Autoimmune Encephalomyelitis1
* Department of Neurosciences, Lerner Research Institute, Cleveland Clinic Foundation, Cleveland, OH 44195;
Department of Immunology Research, Merck Research Laboratories, Rahway, NJ, 07065; and
Ina Sue Perlmutter Laboratory, Children’s Hospital and Harvard Medical School, Boston, MA 02115
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, associated with reduced inducible NO synthase immunoreactivity, and lymph node T cells from CXCR3–/– mice primed with MOG35–55 secreted less IFN- in Ag-driven recall responses than cells from CXCR3+/+ animals. CXCR3–/– lymph node T cells also showed enhanced Ag-driven proliferation, which was reduced by addition of IFN-. Taken with prior findings, our data show that CXCL10 is the most relevant ligand for CXCR3 in EAE. CXCR3 does not govern leukocyte trafficking in EAE but modulates T cell IFN- production and downstream events that affect disease severity. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Although it is clear that activated T cells cross the impaired blood-brain barrier (BBB) in EAE (7), the molecular mechanisms by which encephalitogenic T cells enter and persist in the CNS have not been comprehensively elucidated (8). Numerous cytokines, chemokines, and adhesion molecules play varied and complex roles in leukocyte migration during EAE, but a comprehensive account of their function during the explosive accumulation of leukocytes in the CNS during EAE has not been achieved.
Chemokines and their receptors are canonical regulators of monocyte and T-lymphocytes extravasation at sites of inflammation. In common with other family members, the type 3 CXC chemokine receptor (CXCR3), which responds to CXCL10/IP-10, CXCL9/MIG, and CXCL11/I-TAC (
-R1, H174, and SCYB11) (9, 10, 11, 12, 13), is a seven-transmembrane, G protein-coupled receptor (14, 15, 16, 17). Human and mouse CXCR3 are both located on the X chromosome (15, 16) and expressed on activated T cells, NK cells, monocytes, dendritic cells, and microglia (14, 18, 19, 20, 21, 22, 23, 24, 25, 26). Th1 but not Th2 T cell lines express CXCR3 at high levels (27). Circulating CXCR3+ T cells are mostly CD45RO+ memory cells, and CD4+CXCR3+ cells express Th1 cytokines in vivo (18). ThIL-17 cells have recently been characterized as a distinct lineage, and their chemokine receptor expression and trafficking determinants remain to be characterized (28, 29, 30).
Ample evidence suggested a role for CXCL10 and CXCR3 in the pathogenesis of EAE and MS. CNS levels of CXCL10 message and protein correlate to clinical relapses in mice with EAE (31, 32, 33, 34). CXCL10 is expressed in EAE by CNS astrocytes (35) and CXCR3 by CNS-infiltrating lymphocytes. CXCR3 is consistently detected on CD4+ memory T cells in cerebrospinal fluid (Csf) (36), and enrichment for CXCR3 on >90% of Csf T cells is relatively selective among lymphocyte chemokine receptors. Csf CXCL10 levels are elevated during attacks of MS (37). Studies of autopsy brain sections demonstrated abundant accumulations of CXCR3+ T cells in >99% of perivascular CD3+ leukocyte aggregates in active MS lesions (37). Moreover, CXCR3 and CXCL10 are colocalized in active MS lesions (38).
Given these results, it seemed plausible that CXCR3 and CXCL10 would be implicated in the pathogenesis of EAE and MS by directing pathogenic CD4+ T cells to sites of inflammation. However, this simplistic view of the function of CXCR3 and CXCL10 does not explain all observations in EAE and other disease models. As an example, we recently found that CXCR3 was not required for transendothelial migration of human CD4+ T cells to cross BBB in vitro (39). Furthermore, contradictory data have emerged from studies of CXCR3 and its ligands in animal models of MS. Some workers reported a protective role for CXCL10 blockade in actively induced EAE using either anti-CXCL10 Abs induced by DNA vaccination or by antisense oligonucleotides against CXCL10 (40, 41). In adoptive transfer EAE, administration of anti-CXCL10 Abs decreased disease severity (31). However, others used CXCL10-neutralizing Abs in actively induced EAE, and observed significantly worse disease (42). Finally, CXCL10-deficient mice exhibited a reduced threshold for EAE induction and developed severe EAE after immunization with low doses of MOG35–55 that produced minimal disease in wild-type littermates (43). Therefore, the role of CXCR3 in EAE deserves further exploration and clarification. This issue is of interest because recent reports suggested that CXCR3 might play an important role in autoimmune diseases, arteriosclerosis, transplant rejection, and viral infections, positioning this receptor as a potential therapeutic target (44, 45, 46).
The current study was designed to address the role of CXCR3 and its ligands in the pathogenesis of EAE, using both CXCR3–/– mice and neutralizing anti-CXCR3 Abs. Our data showed increased severity of EAE, with reduced peripheral and CNS expression of IFN-. Furthermore, the current studies demonstrated that the absence of this chemokine receptor has no impact on leukocyte migration to, or retention in, the inflamed CNS tissue during EAE. Together with other recent reports, these findings may stimulate increased attention to the role of CXCR3 in regulating lymphocyte effector properties including induction of IFN- production during inflammation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The generation of CXCR3-deficient mice has been described previously (47). The animals used in these experiments had been backcrossed to C57BL/6J (B6) mice for 11 generations. All comparisons in the current studies were made between littermate mice in the F12 generation, with cohorts of mice being matched for both gender and age. CXCR3 genotype was done using PCR-based genomic DNA analyses. The following primers were used to amplify the CXCR3 wild-type and mutant allele, respectively: CXCR3F, GCACCTCTCCCTACGATTATGG and CXCR3R, GAGGCGCTGATCGTAGTTGG; and NeuF, TGGGATCGGCCATTGAACAAGATGG and NeuR, ATACTTTCTCGGCAGGAGCA. SWR x SJL F1 (SWXJ (H-2qs)) mice were purchased from The Jackson Laboratory. All experimental mice were 8–10 wk of age and housed under pathogen-free environment in the animal facility at the Cleveland Clinic Foundation. All protocols for animal research met the requirements of the Animal Research Committee of the Cleveland Clinic Foundation in compliance with the Public Health Service policy on humane care and use of laboratory animals.
Peptides
Rat MOG35–55 and mouse proteolipid protein (PLP139–151) peptides were obtained from Biosynth International and purified by HPLC, and the purity of the peptide was >95%. The sequence of MOG35–55 and PLP139–151 were MEVGWYRSPFSRVVHLYRNGK and HSLGKWLGHPDKF, respectively.
Induction of EAE with MOG35–55 and PLP139–151 peptides, treatments with neutralizing Abs, and neurobehavioral evaluation
Induction of EAE was performed as previously described (48) with modification. Eight- to 10-wk-old mice received s.c. injections with different doses of MOG35–55 emulsified in CFA (Difco Laboratories) containing 400 µg of Mycobacterium tuberculosis. Mice received i.v. injections with 200 ng of pertussis toxin (PTX) (Sigma-Aldrich) on day 0 and 2 postimmunization (p.i.). Chronic EAE in SWXJ mice was induced with PLP135–151, as described previously (48, 49). During the course of chronic EAE in SWXJ mice, rabbit anti-mouse CXCR3 Abs or control IgG (200 µg/injection) were i.p. injected on days 9, 13, and 16 p.i. The preparations of anti-mouse CXCR3 Abs and control serum were coded, and all mice were weighed, examined, and graded daily for neurological signs in a blinded manner as follows: 0, no disease; 1, decreased tail tone or slightly clumsy gait; 2, tail atony and moderately clumsy gait and/or poor righting ability; 3, limb weakness; 4, limb paralysis; and 5, moribund state. Disease relapse was determined when an increase of one EAE score unit was observed. Signs of neurological impairment were typically accompanied by an abrupt, substantial weight loss (>7%). The average day of EAE onset was calculated by adding the first day of clinical signs for individual mice and dividing by the number of mice in the group. The EAE index was calculated by adding all the daily EAE scores to obtain cumulative score and dividing by day of EAE onset (50). Active immunization with MOG35–55 induced monophasic EAE in B6 mice and was followed for 30 days. Chronic relapsing EAE induced by PLP139–151 was monitored for 90 days. Animals were euthanized if found to be worse than grade 4. We took the conservative approach of grading moribund mice at 5 on the day of sacrifice and subsequently removing them from analysis. Water-soaked food was provided on the cage floor when animals reached grade 3 or worse. Deaths before day 7 p.i. were attributed to reaction to immunization or injection of PTX, not EAE.
Immunohistochemistry and quantitation of immunoreactivity
Staining. For histological and immunohistochemical analysis of CNS tissues at different stages of EAE, mice were sacrificed by intracardiac perfusion with ice-cold PBS, followed by 4% paraformaldehyde solution, under anesthesia. Brains and spinal cords were rapidly dissected; 6-µm cryostat sections were prepared, rinsed in PBS, steamed for 30 min in citrate buffer (pH 6.0), then cooled down for 30 min, incubated with 0.3% hydrogen peroxide, blocked by incubation with 10% goat serum at room temperature for 1 h, then incubated overnight at 4°C with primary Abs at the dilution indicated: rat anti-mouse CD45 mAbs, 1/2000 (clone MCA 1388; Serotec); rabbit anti-human von Willebrand factor (vWF) polyclonal Abs, 1/4000 (DakoCytomation); rabbit anti-rat/mouse inducible NO synthase (iNOS) polyclonal Abs, 1/2000 (Chemicon International). On day 2, tissues were incubated with appropriate biotinylated secondary Abs (goat anti-rat or goat anti-rabbit (DakoCytomation; 1/400), then with ABC (avidin-biotin complex) (DakoCytomation; 1/400). Sections were washed thrice with PBS after each incubation step (except for goat serum). All Abs, as well as ABC, were diluted in 1% BSA in PBS. Sections were developed with 3,3'-diaminobenzidine tetrahydrochloride with hydrogen peroxide for 5 min at room temperature. Following development with 3,3'-diaminobenzidine tetrahydrochloride, tissues were rinsed in double distilled H2O, dehydrated, and mounted. Negative controls were incubated with preimmune IgG (Sigma-Aldrich).
Quantitation of immunoreactivity. Immunoreactivity, defined as area occupied by reaction product, expressed as percentage of total axial spinal cord area, was calculated on digitized images using an integrated image analysis system attached to a microscope (Leica Microsystems). Five slides from each block of an immunostained spinal cord, with each slide containing five fields of view, were digitized under a 40x objective, using a 3-CCD color video camera interfaced with a MagnaFIRE Image Analysis System (Optronics International). For comparison of results obtained in CXCR3+/+ and CXCR3–/– mice, levels of spinal cord sections were carefully matched. Digitized images were analyzed with National Institutes of Health ImageJ1.34s software. A thresholding procedure was established to determine the proportion of immunoreactive area within each fixed field of view. These parameters were then held constant for each set of images obtained at equal objectives and light intensities, on slides that were processed at one session. The data represent the mean area occupied by immunoreactivity, expressed as a percentage of total spinal cord area.
For correlation with quantitative analysis of inflammation, as defined by CD45 immunoreactivity, hematoxylin/eosin-stained slides were assessed for inflammation using the following scoring system: 0, no evidence of inflammation; 1, rare, scattered small foci of infiltrating cells; 2, multiple, isolated foci of cellular infiltration; 3, multiple, confluent foci of inflammation; and 4, foci of necrosis/and or neutrophil infiltration.
Analyses of mRNA levels for cytokines and lymphocyte cell surface Ags by RNase protection assay (RPA)
Mice were anesthetized with pentobarbital sodium and perfused through the left ventricle with ice-cold PBS. Spinal cords, draining lymph nodes, and brains were dissected, harvested, and immediately snap frozen in liquid nitrogen. Samples were kept at –80°C until RNA extraction. Total RNA was extracted using TRIzol reagent (Invitrogen Life Technologies) according to the manufacturer’s instructions. Concentrations of RNA were determined by UV spectroscopy at 260 nm/280 nm. RPAs were performed using multiprobe kits (RiboQuant; BD Pharmingen) according to the manufacturer’s protocol. In brief, a set of 32P-labeled anti-sense RNA probes synthesized from DNA templates using T7 polymerase were hybridized with 20 µg of total RNA; free probes and other ssRNAs were digested with RNase T2. The remaining protected duplexes were purified and analyzed on denaturing polyacrylamide gels, which were dried and subjected to autoradiography on a Storm Phosphorimager. Individual bands were quantified, and data were expressed as arbitrary densitometric units, after normalization to GAPDH or L32 signal. Template set mCD1 (BD Pharmingen) was used for determination of the following mRNAs: CD45, F4/80, CD8, CD8
, CD4, CD3, TCR-, TCR-
, L32, and GAPDH. For the detection of cytokines, we used template set mCK3b (BD Pharmingen) to detect the following mRNAs: TNF-, LT-, TNF-, IL-6, IFN-, IFN-, TGF-1, TGF-2, TGF-3, MIF, L32, and GAPDH, whereas mCK2b detects mRNA encoding IL-12p35, IL-12p40, IL-10, IL-12, IL-18, IL-6, IFN-, MIF, L32, and GAPDH.
Analyses of the migration of Con A-activated T cells into EAE lesions
Single-cell suspensions prepared from spleens and lymph nodes of healthy mice were collected and cultured in complete medium (RPMI 1640 supplemented with 10% (v/v) FCS, 1 mM sodium pyruvate, 4 mM L-glutamine, 100 µg/ml streptomycin, and 100 IU/ml penicillin (Invitrogen Life Technologies)) at 2 x 106 cells/ml with 1 µg/ml Con A for 48 h at 37°C in 5% CO2–95% air. The effect of Con A on T cell activation was verified using a cell proliferation assay. Activated cells were labeled with 0.2 µM CFSE (Molecular Probes) at 37°C for 15 min. CFSE is a nontoxic dye that has no effect on cell proliferation. Labeling efficacy was examined using flow cytometry, and cells that were used for in vivo migration assays had labeling efficacy exceeding 99%. CFSE-labeled leukocytes were adoptively transferred via venous injections. Mice receiving CFSE-labeled leukocytes had been immunized with MOG35–55 in CFA and PTX, and had EAE scores 
2.0 at the time of cell transfer. Mice were sacrificed by perfusion under anesthesia, 24 h posttransfer of CFSE-labeled leukocytes. Spinal cords were collected, and 6-µm sagittal cryostat sections (7) were cut from the lumbosacral spinal cord. These sections were obtained at minimum intervals of 15 µm to prevent duplicate counting of any single cell in adjacent sections (51).
Isolation of cells from CNS and draining lymph nodes
Isolation of cells from the CNS was performed as described previously (52). Briefly, mice were anesthetized with pentobarbital sodium and perfused with 20 ml of cold PBS. Spinal cords were extruded by flushing the vertebral canal with PBS and rinsed in PBS. Tissues were forced through 70-µm nylon cell strainers (BD Falcon), after which brain and spinal cord cell suspensions were incubated with collagenase/dispase (1 mg/ml; Roche) at 37°C for 30 min, and passed again through 70-µm nylon cell strainers to give single-cell suspensions. CNS mononuclear cells were isolated by centrifugation (500 x g) at 24°C for 20 min over a 30%/70% discontinuous Percoll gradient (Amersham Biosciences). Cells were collected from the interphase, washed in HBSS (Invitrogen Life Technologies), and immediately studied by flow cytometry as described below. For direct comparisons, lymph nodes and spleens were also removed and placed in HBSS, and single-cell suspensions were obtained by mechanically forcing through 70-µm nylon cell strainers.
Flow cytometry
Single-cell suspensions from CNS, lymph nodes, or spleens, obtained as described above, were washed and resuspended in FACS buffer (1% FCS and 0.1% sodium azide in PBS). After blocking with CD16/CD32 Abs at 4°C for 30 min, cells were stained for surface markers with directly conjugated Abs in FACS buffer at 4°C for 30 min. Cells were washed twice and resuspended in the 200–400 µl of PBS for flow cytometry analysis as described before (53, 54). Abs used in our experiments were CD4-PE, CD8-Cy, CD45-Cy. All Abs including isotype control Abs were purchased from BD Pharmingen. Analysis was performed with a FACSCalibur (BD Biosciences) equipped with CellQuest software (BD Biosciences), and 50,000 events were acquired. Data were analyzed with FlowJo software (Tree Star).
In vitro T cell proliferation and cytokine production
T cell proliferation assays and cytokine quantification were performed as described previously (52). For T cell proliferation, draining lymph node cells from MOG35–55-immunized mice were incubated in a 96-well plate (1 x 105/well) in the presence of MOG35–55 or Con A (Sigma-Aldrich) at the indicated concentration or in medium alone (background). For testing the role of exogenous IFN- in T cell proliferation, draining lymph nodes cells from MOG35–55-immunized CXCR3–/– or CXCR3+/+ mice were incubated in a 96-well plate (1 x 105/well) with MOG35–55 (20 µg/ml), with or without IFN- (2000 U/ml; R&D Systems). For all experiments, culture medium was RPMI 1640, supplemented with 10% FBS (Invitrogen Life Technologies), 2 mM L-glutamine, 1 mM sodium pyruvate, 100 IU/ml penicillin/streptomycin, and 2 x 10–5 M 2-ME (Invitrogen Life Technologies). During the final 16 h of a total 72 h in culture, cells were pulsed with 1 µCi/well of [3H]thymidine (Amersham Biosciences); plates were harvested using a Tomtec harvester and analyzed with a 1450 Microbeta Wallac Trilux liquid scintillation and luminescence counter (PerkinElmer).
For cytokine quantification, draining lymph node cells isolated from MOG35–55-immunized CXCR3–/– or CXCR3+/+ mice were incubated (5 x 105 cells/ml) in 24-well plates with MOG35–55 (20 µg/ml). After 24, 48, and 72 h, supernatants were collected for cytokine detection. ELISA kit for IFN- was obtained from R&D Systems. A standard curve was generated with each assay (sensitivity = 4.0 pg/ml). All samples were measured in duplicate and diluted if necessary.
Analysis of BBB disruption with Evans blue dye (EBD)
Integrity of the BBB was examined with EBD as described previously (55, 56). To verify that perfusion effectively removed the EBD from the CNS circulation, mice received injections with EBD (250 µl of 10 mg/ml; Sigma-Aldrich) and perfused with 60 ml of HBSS supplemented with heparin (5 U/ml) 30 min after injection, and before removal of the CNS tissue. The effective clearance of dye by the perfusion step was confirmed by the appearance of a colorless perfusate. Portions of liver and spinal cord were removed, washed briefly with double distilled H2O, dried, and weighed. Tissues from perfused, untreated, unimmunized mice were simultaneously prepared as fluorometric blanks. EBD in tissue was extracted for 24 h at 50°C in glass tubes containing 0.5–1 ml of formamide (Sigma-Aldrich), normalized to tissue mass. Fluorescence intensity was determined with a SPECTRAmax Gemini XS (Molecular Devices) (excitation at 590 ± 20 nm; emission at 645 ± 40 nm). A standard curve of EBD (in formamide) was established, and data were expressed as milligrams of EBD per gram of tissue.
Statistical analyses
The Student t test was used for the comparisons of disease severity, severity of pathological changes, levels of EBD in tissues, levels of T cell proliferations, cytokine and chemokine gene expression, and percentage area of immunoreactivity in comparisons between CXCR3+/+ and CXCR3–/– mice. A 
2 test was used for the comparisons of disease incidence or mortality between CXCR3+/+ and CXCR3–/– mice, or between anti-CXCR3 Ab-treated and control mice. A p value <0.05 was considered as significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Table I summarizes the neurobehavioral features of MOG35–55-induced EAE in CXCR3+/+ and CXCR3–/– mice. Unexpectedly, the disease was more severe in CXCR3–/– animals: in the initial experiment, 5 of 15 (33%) CXCR3–/– mice developed fatal EAE, whereas no CXCR3+/+ mice (0 of 12) died (p < 0.05). When MOG35–55 was reduced from 300 to 100 µg, we again found that 4 of 14 (29%) CXCR3–/– mice died of EAE, whereas no CXCR3+/+ mice (0 of 10) died of EAE (p < 0.05). EAE induced with 100 µg of MOG35–55 was more severe in surviving CXCR3–/– than in CXCR3+/+ littermates, with higher peak scores and imperfect recovery, with more residual neurological impairment (Table I and Fig. 1). CXCR3–/– mice had higher EAE scores at day 30 p.i. than did CXCR3+/+ animals (Fig. 1), indicating more extensive tissue injury. Even at a low concentration of Ag (10 µg of MOG35–55), CXCR3–/– mice developed severe EAE, which was significantly worse than in CXCR3+/+ mice (p < 0.05; Table I), as previously reported for CXCL10–/– mice (43). These results indicated that absence of CXCR3 increases the severity of EAE in mice.
|
|
Insights from knockout mice are invaluable, but interpretation may be limited due to developmental effects of the genetic defect. To lessen this concern, and to examine the role of CXCR3 in chronic-relapsing EAE, we evaluated the activity of neutralizing anti-CXCR3 Abs in PLP139–151-induced EAE in SWXJ mice (52) (57), using an EAE protocol that was modified to minimize fatal EAE attacks. To block chemokine receptor function during the effector phase of EAE, neutralizing anti-CXCR3 Abs or control preimmune serum were administrated on days 9, 13, and 16 p.i. The incidence of EAE in both groups was 100%. Disease severity was significantly worse in recipients of anti-CXCR3 Abs, as monitored by mean EAE score (Fig. 2). Cumulative EAE scores in anti-CXCR3 Ab-treated mice were also significantly higher than in control mice (data not shown). Two of 12 anti-CXCR3 Ab-treated mice died of EAE, whereas none from the control group died. These results were consistent with those obtained using CXCR3–/– mice, and demonstrated that deficient CXCR3 signaling whether genetic or acquired, worsens EAE severity. Furthermore, because anti-CXCR3 Ab treatment began on day 9 p.i., it seemed most likely that the effector phase of disease was affected.
|
It was important to determine whether EAE in CXCR3–/– mice was accompanied by altered pathologic expression of disease. Histopathologic examination of CNS tissues was performed at the peak of EAE and EAE recovery (day 30 p.i.). Axial lumbar spinal cord sections from CXCR3+/+ and CXCR3–/– mice showed similar cellular inflammation at the peak of EAE, as determined by quantitative immunohistochemistry using Abs to CD45 (Fig. 3A). This result was confirmed using semiquantitative analysis of cellular infiltrates in hematoxylin/eosin stained sections, which were examined both at the peak of EAE and after recovery (data not shown). Because EAE-mediated neurological impairment is usually related closely to leukocyte infiltrates during initial attack (58), it was surprising that EAE was more severe in CXCR3–/– mice, despite equivalent extent of infiltrates.
|
T cells, and TCR T cells by RPA at the peak of EAE and EAE recovery. There was no difference in the abundance of leukocyte lineage marker mRNA in CNS tissue from CXCR3+/+ and CXCR3–/– mice at the peak of EAE or EAE recovery (Fig. 3, B and C). These results were supported by flow cytometric analysis of leukocytes that were isolated from EAE CNS tissues from CXCR3+/+ and CXCR3–/– mice (Fig. 3D). In particular, there was no difference in the absolute numbers or percentages of CD4+ and CD8+ T cells in the CNS tissue infiltrates in CXCR3+/+ and CXCR3–/– mice at the peak of EAE. Given previous results from studying bleomycin-induced pulmonary fibrosis in CXCR3–/– mice (46), we also used flow cytometry to monitor accumulation of NK1.1+/CD3+ NK-T cells and NK1.1+/CD3– NK cells in the CNS of mice with EAE. There were no differences between CXCR3–/– and CXCR3+/+ mice (data not shown).
Flow cytometric analysis (Fig. 3D) of lymph node and spleen cells showed no differences between CXCR3+/+ and CXCR3–/– mice at the peak of EAE. By RPA, draining lymph nodes and spleens from CXCR3–/– mice had comparable levels of mRNA specific for leukocyte lineage indicator genes CD45, F4/80, CD4, CD8, CD3, TCR, and TCR (data not shown).
We have previously proposed that CXCR3 might promote retention of activated T cells in inflammatory foci, while being dispensable for their initial entry (59). To address this possibility, we adoptively transferred CSFE-labeled, Con A activated CXCR3+/+ or CXCR3–/– spleen cells into wild-type mice with ongoing EAE. The accumulation of adoptively transferred, CSFE-labeled activated leukocytes in the inflamed spinal cord was examined by microscopy. Numbers of infiltrated, CSFE labeled activated CXCR3+/+, and CXCR3–/– cells did not differ (data not shown). Taken together, these results indicated that CXCR3 does not play a significant role in the migration or retention of activated, myelin-specific or nonspecific lymphocytes in the inflamed CNS during EAE.
Increased in vitro T cell proliferative response to MOG35–55 in CXCR3–/– mice is accompanied by reduced IFN- production and corrected by exogenous IFN-
CXCR3–/– mice showed worse EAE severity than did wild-type littermates, despite equivalent inflammatory infiltrates, suggesting the possibility of altered T cell effector function. Draining lymph node T cells from MOG35–55-immunized CXCR3+/+ and CXCR3–/– mice showed robust, dose-dependent proliferation in response to MOG35–55 peptide or Con A (Fig. 4, A and B). Compared with CXCR3+/+ T cells, an increased proliferative response toward MOG35–55 restimulation was observed in T cells from CXCR3–/– mice (Fig. 4B). CXCR3+/+ and CXCR3–/– T cell proliferation in response to Con A stimulation was indistinguishable (Fig. 4A). Because CXCR3 has also been implicated in T cell production of IFN- (60, 61), we examined levels of IFN- in the supernatants from MOG35–55-stimulated T cells. T cells from draining lymph nodes of CXCR3–/– mice produced significantly less IFN- following MOG35–55 stimulation in vitro than did T cells from CXCR3+/+ mice (Fig. 4C). Interestingly, proliferation of primed CXCR3–/– T cells toward MOG35–55 in the presence of exogenous recombinant mouse IFN- was comparable to CXCR3+/+ T cell recall proliferation (Fig. 4D).
|
during EAE
We measured cytokine gene expression in the CNS of mice with EAE (Table II), to address whether our in vitro results were pertinent for effector cytokine production in vivo. Spinal cord cytokine mRNAs in were low and equivalent before EAE onset (day 8) and at the time of EAE recovery (day 30) in CXCR3+/+ and CXCR3–/– mice (data not shown). At the peak of EAE, levels of IFN- and IL-6 transcripts in spinal cords from CXCR3–/– mice were significantly lower than in CXCR3+/+mice (Table II). Levels of mRNA specific for TNF-, LT-, TNF-, IL-18, IL-1, IL-1, or IL-10 did not differ significantly in EAE spinal cord tissues from CXCR3+/+ and CXCR3–/– mice (Table II).
|
were further examined in the serum of mice immunized with MOG35–55 before EAE onset, at the peak of EAE and after EAE recovery, using ELISA. Before EAE onset and after EAE recovery, serum levels of IFN- in CXCR3+/+ and CXCR3–/– mice were similar (Fig. 5). At the peak of EAE, serum IFN- levels in CXCR3–/– mice were markedly lower than those in CXCR3+/+ animals (Fig. 5). IFN- protein and mRNA levels at the different stages of EAE were consistent (Fig. 5, Table II, and data not shown).
|
Mice deficient for IFN- or its receptor exhibit increased severity of EAE, associated with reduced CNS expression of iNOS, whose catalytic product, NO, mediates inhibition of T cell proliferation in this disease (62, 63). We evaluated iNOS expression in the CNS of CXCR3–/– and CXCR3+/+ mice at the peak of EAE, to address whether reduced IFN- production might be correlated with impaired generation of NO during active disease. In common with prior reports, we found that iNOS was expressed by CD45-immunoreactive infiltrating leukocytes, primarily in subpial inflammatory aggregates (data not shown). Therefore, we evaluated iNOS immunoreactivity only where CD45 immunoreactivity was equivalent (Fig. 6A). We found that iNOS immunoreactivity was strikingly reduced in inflamed regions of the CNS of CXCR3–/– mice with EAE (Fig. 6, A and B), possibly as a physiological consequence of the reduced production of IFN- by CXCR3–/– lymphocytes.
|
BBB disruption is a quantitative reflection of CNS inflammation, and correlates directly with the neurobehavioral severity of EAE (56, 64). We examined BBB integrity in mice with EAE. Healthy CXCR3–/– mice had equivalent BBB integrity as their wild-type littermates. By inspection (Fig. 7A) and by quantitating EBD extravasation (Fig. 7B), spinal cords from CXCR3–/– mice with EAE showed significantly worse BBB disruption, as compared with CXCR3+/+ animals.
|
In summary, our results indicated that EAE in CXCR3–/– mice was characterized by worsened neurobehavioral severity, aggravated BBB disruption and increased tissue damage, and accompanied by reduced production of IFN- and impaired expression of iNOS, despite equivalent leukocyte infiltrates. Taken together, these findings indicated that CXCR3 regulates EAE pathogenesis at the effector phase rather than by controlling leukocyte trafficking.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production might underlie increased EAE severity in CXCR3–/– mice. Consistent with this proposal, we observed reduced expression of iNOS within lesions of CXCR3–/– mice, as previously observed in IFN-R1–/– mice with EAE (63). We also noted worsened disruption of the BBB in CXCR3–/– mice with EAE, along with increased vWF immunoreactive vessels, suggesting the possibility that elevated levels of angiogenesis might underlie this observation. Given that Th1 T cells have high levels of CXCR3 surface expression, it was surprising that CXCR3–/– and CXCR3+/+ mice had comparable leukocyte numbers and equivalent T lymphocyte subsets in CNS tissues at the peak of EAE, demonstrated by histology, flow cytometry, and levels of leukocyte lineage-specific mRNA. Our current results are consistent with recent reports that CXCR3 is not required for transendothelial migration of memory CD4+ T cells in an in vitro BBB model or in a pulmonary fibrosis model in vivo (39, 46).
Classical studies suggested that chemokines and their receptors not only play an important role in lymphocyte recruitment to inflammatory sites, but also participate in T cell activation (67). Our results, showing increased in vitro T cell recall response to MOG35–55 in CXCR3–/– T cells, accompanied by reduced IFN- production and corrected by exogenous IFN-, are consistent with this concept. More specifically, it is increasingly tempting to speculate about the possibility of a positive amplification loop involving CXCR3, its ligands (CXCL9, CXCL10, CXCL11), and IFN- in vivo. Complex and intricate mutual regulatory interactions among all three elements of this amplification loop have now been demonstrated. In particular, optimal transcriptional induction of all three CXCR3 ligands requires IFN-, as illustrated by the trivial names for these chemokines (monokine induced by IFN-, MIG/CXCL9; IFN--inducible protein of 10 kDa, IP-10/CXCL10; IFN--inducible T cell chemoattractant, I-TAC/CXCL11) (68, 69). Prior results suggested that expression of CXCR3 by activated T cells required transient signaling through the TCR, along with IFN- (70). Recently, evidence was provided that the transcription factor t-bet, which is essential for generating Th1 cells, is necessary and sufficient for inducing CXCR3, even in the absence of IFN- (71). Production of IFN- by human T cells is strongly augmented by CXCL10 engagement of CXCR3 (60). In this study, we show that mice deficient for CXCR3 exhibit selective impairment in the production of IFN- during an autoimmune response in vivo. Together, these observations indicate a complete amplification loop, by which t-bet governs production of IFN- and, together with IFN-, regulates expression of both CXCR3 (on T cells). IFN- drives expression of CXCL10 (produced mainly by parenchymal tissue elements), and stimulation of CXCR3 by CXCL10 elicits further elaboration of IFN-, which initiates subsequent turns of the amplification loop. The cellular source(s) of IFN- in the CNS of mice with EAE have not been conclusively defined. CD4+ and CD8+ T cells as well as NK and NK-T cells express CXCR3 and can express IFN- abundantly. It will be of interest to establish which of the infiltrating cell populations in EAE tissues produces IFN-. Interestingly, recent results suggest that CD4+ Th1 cells exert regulatory effects on pathogenic ThIL-17 cells, via production of IFN- (29, 30). It is plausible that Th1 cells that fail to express CXCR3 and show impaired IFN- production are defective for mediating counterregulatory properties toward autoimmune Th-IL17 cells in EAE.
The roles of IFN- in the pathology of EAE and MS have been extensively studied both in patients and in animal models, and were found to be highly complex and partially paradoxical (2). Lymphocytes from MS patients produce elevated levels of IFN- in vitro compared with controls (72). The protective effect of IFN- therapy in MS patients has been attributed, at least in part, to down-regulation of IFN- production (73). Myelin Ag-induced IFN- production is more efficient in female MS patients as compared with males (74). MS patients treated with systemic IFN- had a dramatic worsening of the disease (75). In contrast, administration of anti-IFN- Abs to mice or rats aggravated EAE (76). On a susceptible background, IFN-–/– mice developed more severe EAE, whereas IFN-–/– mice on resistant genetic backgrounds became EAE-susceptible (77). CXCR3–/– mice exhibit some but not all features of IFN- (or IFN-R1–/–)-deficient mice during EAE. In particular, CNS iNOS expression was blunted in both IFN-R1–/– and CXCR3–/– mice with EAE, raising the possibility that Ag-reactive T cell proliferation may be unrestrained due to reduced NO in the inflamed brain and spinal cords of CXCR3–/– mice with EAE (62, 63). In this regard, several lines of evidence have shown that IFN- mediates inhibition of proliferation of myelin protein-specific T cells in vitro (78, 79, 80) and in vivo (77). T cells from draining lymph nodes of CXCR3–/– mice produced IFN- poorly and showed augmented proliferative responses in vitro upon restimulation with MOG35–55 as compared with T cells from CXCR3+/+ mice, with correction to wild-type levels of proliferation upon addition of exogenous IFN-. We were not able to demonstrate enhanced T cell proliferation in the CNS of CXCR3–/– mice with EAE, possibly due to technical limitations (data not shown).
Our data, including detailed analyses of quantitative and qualitative aspects of lymphocyte accumulation in CNS EAE tissue, suggest that CXCR3 does not govern lymphocyte migration or retention during EAE. Instead, we propose that CXCR3 equips migrating lymphocytes to modulate tissue-based effector responses, in part by IFN- production. Supporting our overall hypothesis, BBB disruption, a reliable correlate of tissue injury, was significantly worse in CXCR3–/– mice with EAE. Interestingly, loss of BBB integrity was associated with increased vWF immunoreactive vascular areas in inflamed spinal cords of CXCR3–/– mice. This observation raised the possibility that angiogenesis with formation of leaky vessels might underlie loss of BBB integrity during EAE in CXCR3–/– mice. It has been proposed that CXCR3 exerts antiangiogenic effects in human cancer (81), opposing the effects of ELR+ CXC chemokines. It remains speculative whether similar rules would apply during EAE, in part because the CXCR3-B alternatively spliced variant reported on human vascular structures is absent from the mouse genome (82). In a broader sense, immune-mediated inflammation is associated with angiogenesis (65), and it is worth considering whether CXCR3, or mediators released downstream of CXCR3 signaling influence angiogenesis in EAE. One potential candidate is IL-6, an angiogenic cytokine (83), whose chronic overexpression in the CNS of transgenic mice impaired BBB function (84). Arguing against this possibility, we found that IL-6 levels were decreased, rather than increased, in the CNS of CXCR3–/– mice with EAE. Given that IL-6–/– mice are relatively protected from EAE (85, 86), and that IL-6 expression can be induced by IFN- in macrophage cells (87), we propose that the relative deficit of IL-6 expression is a consequence of reduced availability of IFN- in the CNS of CXCR3–/– mice with EAE.
What are the implications of these observations for the use of CXCR3 blockade for the treatment of inflammatory diseases such as MS? There are certainly caveats for trying to use EAE findings to predict response to MS therapeutics (2, 88). Given these reservations and taking into account the divergent functions of IFN- in MS and EAE, one would predict that anti-CXCR3 agents would need to obstruct receptor function within the CNS (either by BBB penetration or by remaining receptor-associated after cells transmigrate across the endothelium) to modulate effector function. Furthermore, it would be anticipated that resistance to neurotrophic virus infection might be impaired (89, 90). CXCR3 is also expressed by microglia (25, 91) and might mediate either neuroprotective or destructive functions (92), so that blockade might have unanticipated benefits or liabilities.
In summary, whereas the role of CXCR3 in leukocyte recruitment and accumulation in CNS during murine EAE is minimal, the effector properties of autoreactive CXCR3-deficient T cells are altered. In particular, reduced IFN- production, impaired iNOS expression, and increased BBB disruption were all associated with exaggerated neurobehavioral EAE severity in CXCR3–/– mice.
|
Footnotes |
|---|
1 This work was supported by grants from the National Institute of Health (3RO1 NS32151; to R.M.R.) and fellowships from the Nancy Davis Center Without Walls (to L.L. and D.H.). 
2 Address correspondence and reprint requests to Dr. Richard M. Ransohoff, Neuroinflammation Research Center, Department of Neurosciences, NC30, Lerner Research Institute, the Cleveland Clinic Foundation, 9500-10000 Euclid Avenue, Cleveland, OH 44195. E-mail address: ransohr{at}ccf.org
3 Current address: Department of Neurology, Kanazawa Medical University, 1-1 Daigaku, Uchinada, Kahoku-gun, Ishikawa, 920-0293, Japan.
4 Abbreviations used in this paper: MS, multiple sclerosis; EAE, experimental autoimmune encephalomyelitis; MOG, myelin oligodendroglial glycoprotein; BBB, blood-brain barrier; Csf, cerebrospinal fluid; PLP, proteolipid protein; PTX, pertussis toxin; p.i., postimmunization; vWF, von Willebrand factor; iNOS, inducible NO synthase; RPA, RNase protection assay; EBD, Evans blue dye.
Received for publication September 20, 2005. Accepted for publication January 14, 2006.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
expression of encephalitogenic T cells. Eur. J. Immunol. 25: 1951-1959. [Medline]-Interferon transcriptionally regulates an early-response gene containing homology to platelet proteins. Nature 315: 672-676. [Medline]-interferon encodes a member of the platelet factor 4 family of cytokines. Proc. Natl. Acad. Sci. USA 87: 5238-5242. -R1, a gene that is selectively induced by interferon (IFN-) compared with IFN-. J. Biol. Chem. 271: 22878-22884. -inducible protein-10) control of encephalitogenic CD4+ T cell accumulation in the central nervous system during experimental autoimmune encephalomyelitis. J. Immunol. 166: 7617-7624. - and -chemokines by cells of diverse lineage in the central nervous system of mice with relapses of chronic experimental autoimmune encephalomyelitis. Am. J. Pathol. 150: 617-630. [Abstract]-inducible protein 10 redirects antigen-specific T cell polarization and suppresses experimental autoimmune encephalomyelitis. J. Immunol. 168: 5885-5892. 
B activation for constitutive expression of VCAM-1 and ICAM-1 on B lymphocytes and plasma cells. Biochem. Biophys. Res. Commun. 289: 851-856. [Medline]B. Biochem. Biophys. Res. Commun. 286: 281-291. [Medline] is critical to the control of murine autoimmune encephalomyelitis and regulates both in the periphery and in the target tissue: a possible role for nitric oxide. J. Immunol. 163: 5278-5286. Chemokines costimulate lymphocyte cytolysis, proliferation, and lymphokine production. J. Leukocyte Biol. 59: 81-89. [Abstract] inducible chemokines in endocrine autoimmunity: an expanding field. J. Endocrinol. Invest. 26: 177-180. [Medline] inducible protein 10 kD (IP-10): a novel, pleiotropic member of the C-X-C chemokine superfamily. Cytokine Growth Factor Rev. 8: 207-219. [Medline] stimulation. Eur. J. Immunol. 32: 1792-1801. [Medline] interferon in vitro. J. Clin. Immunol. 5: 386-389. [Medline] treatment in multiple sclerosis patients decreases the number of circulating T cells producing interferon- and interleukin-4. J. Neuroimmunol. 111: 86-92. [Medline] interferon. Lancet 1: 893-895. [Medline]: an update. Ann. NY Acad. Sci. 856: 22-32. [Medline]-deficient mice leads to exacerbation of experimental autoimmune encephalomyelitis. J. Exp. Med. 192: 123-128. on myelin basic protein-specific T cell line proliferation in response to antigen-pulsed accessory cells. Cell. Immunol. 145: 311-323. [Medline] shapes immune invasion of the central nervous system via regulation of chemokines. J. Immunol. 164: 2759-2768. is required for activation-induced death of T lymphocytes. J. Exp. Med. 196: 999-1005. and tumor necrosis factor- in human monocytic cell line (THP-1): priming effect of IFN-. J. Immunol. 147: 2630-2637. -inducible protein 10 (IP-10; CXCL10)-deficient mice reveal a role for IP-10 in effector T cell generation and trafficking. J. Immunol. 168: 3195-3204. This article has been cited by other articles:
|
|
 |
|
  N. Fissolo, S. Haag, K. L. de Graaf, O. Drews, S. Stevanovic, H. G. Rammensee, and R. Weissert Naturally Presented Peptides on Major Histocompatibility Complex I and II Molecules Eluted from Central Nervous System of Multiple Sclerosis Patients Mol. Cell. Proteomics, September 1, 2009; 8(9): 2090 - 2101. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Huang, X. S. Zhao, M. Fields, R. M. Ransohoff, and L. Zhou Imatinib attenuates skeletal muscle dystrophy in mdx mice FASEB J, August 1, 2009; 23(8): 2539 - 2548. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Kivisakk, B. C. Healy, V. Viglietta, F. J. Quintana, M. A. Hootstein, H. L. Weiner, and S. J. Khoury Natalizumab treatment is associated with peripheral sequestration of proinflammatory T cells Neurology, June 2, 2009; 72(22): 1922 - 1930. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M. Omari, S. E. Lutz, L. Santambrogio, S. A. Lira, and C. S. Raine Neuroprotection and Remyelination after Autoimmune Demyelination in Mice that Inducibly Overexpress CXCL1 Am. J. Pathol., January 1, 2009; 174(1): 164 - 176. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Riemer, J. Schultz, M. Burwinkel, A. Schwarz, S. W. F. Mok, S. Gultner, T. Bamme, S. Norley, F. van Landeghem, B. Lu, et al. Accelerated Prion Replication in, but Prolonged Survival Times of, Prion-Infected CXCR3-/- Mice J. Virol., December 15, 2008; 82(24): 12464 - 12471. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Fox, P Kivisakk, E Fisher, B Tucky, J. Lee, R. Rudick, and R. Ransohoff Multiple sclerosis: chemokine receptor expression on circulating lymphocytes in correlation with radiographic measures of tissue injury Multiple Sclerosis, September 1, 2008; 14(8): 1036 - 1043. [Abstract] [PDF]
|
|
|
|
|
|
W. Elyaman, P. Kivisakk, J. Reddy, T. Chitnis, K. Raddassi, J. Imitola, E. Bradshaw, V. K. Kuchroo, H. Yagita, M. H. Sayegh, et al. Distinct Functions of Autoreactive Memory and Effector CD4+ T Cells in Experimental Autoimmune Encephalomyelitis Am. J. Pathol., August 1, 2008; 173(2): 411 - 422. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R.-N. E. Dogan, A. Elhofy, and W. J. Karpus Production of CCL2 by Central Nervous System Cells Regulates Development of Murine Experimental Autoimmune Encephalomyelitis through the Recruitment of TNF- and iNOS-Expressing Macrophages and Myeloid Dendritic Cells J. Immunol., June 1, 2008; 180(11): 7376 - 7384. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Zhang, Y. K. Chan, B. Lu, M. S. Diamond, and R. S. Klein CXCR3 Mediates Region-Specific Antiviral T Cell Trafficking within the Central Nervous System during West Nile Virus Encephalitis J. Immunol., February 15, 2008; 180(4): 2641 - 2649. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Miu, A. J. Mitchell, M. Muller, S. L. Carter, P. M. Manders, J. A. McQuillan, B. M. Saunders, H. J. Ball, B. Lu, I. L. Campbell, et al. Chemokine Gene Expression during Fatal Murine Cerebral Malaria and Protection Due to CXCR3 Deficiency J. Immunol., January 15, 2008; 180(2): 1217 - 1230. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Cabrelle, I. Dell'Aica, L. Melchiori, S. Carraro, E. Brunetta, R. Niero, E. Scquizzato, G. D'Intino, L. Calza, S. Garbisa, et al. Hyperforin down-regulates effector function of activated T lymphocytes and shows efficacy against Th1-triggered CNS inflammatory-demyelinating disease J. Leukoc. Biol., January 1, 2008; 83(1): 212 - 219. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Kwun, H. Hu, E. Schadde, D. Roenneburg, K. A. Sullivan, J. DeMartino, W. J. Burlingham, and S. J. Knechtle Altered Distribution of H60 Minor H Antigen-Specific CD8 T Cells and Attenuated Chronic Vasculopathy in Minor Histocompatibility Antigen Mismatched Heart Transplantation in Cxcr3 / Mouse Recipients J. Immunol., December 15, 2007; 179(12): 8016 - 8025. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Muller, S. L. Carter, M. J. Hofer, P. Manders, D. R. Getts, M. T. Getts, A. Dreykluft, B. Lu, C. Gerard, N. J. C. King, et al. CXCR3 Signaling Reduces the Severity of Experimental Autoimmune Encephalomyelitis by Controlling the Parenchymal Distribution of Effector and Regulatory T Cells in the Central Nervous System J. Immunol., September 1, 2007; 179(5): 2774 - 2786. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. B. Walsh, R. A. Edwards, K. M. Romero, M. V. Kotlajich, S. A. Stohlman, and T. E. Lane Expression of CXC Chemokine Ligand 10 from the Mouse Hepatitis Virus Genome Results in Protection from Viral-Induced Neurological and Liver Disease J. Immunol., July 15, 2007; 179(2): 1155 - 1165. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Nakae, Y. Iwakura, H. Suto, and S. J. Galli Phenotypic differences between Th1 and Th17 cells and negative regulation of Th1 cell differentiation by IL-17 J. Leukoc. Biol., May 1, 2007; 81(5): 1258 - 1268. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. E. Cabbage, E. S. Huseby, B. D. Sather, T. Brabb, D. Liggitt, and J. Goverman Regulatory T Cells Maintain Long-Term Tolerance to Myelin Basic Protein by Inducing a Novel, Dynamic State of T Cell Tolerance J. Immunol., January 15, 2007; 178(2): 887 - 896. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. N. Stiles, J. L. Hardison, C. S. Schaumburg, L. M. Whitman, and T. E. Lane T Cell Antiviral Effector Function Is Not Dependent on CXCL10 Following Murine Coronavirus Infection J. Immunol., December 15, 2006; 177(12): 8372 - 8380. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Liu, G. J. Graham, A. Damodaran, T. Hu, S. A. Lira, M. Sasse, C. Canasto-Chibuque, D. N. Cook, and R. M. Ransohoff Cutting Edge: The Silent Chemokine Receptor D6 Is Required for Generating T Cell Responses That Mediate Experimental Autoimmune Encephalomyelitis J. Immunol., July 1, 2006; 177(1): 17 - 21. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
; n = 10) and CXCR3–/– (
; n = 14) mice were immunized with 100 µg of MOG35–55 emulsified in CFA containing 400 µg of M. tuberculosis and i.v. injected twice on day 0 and day 2 with 200 ng of PTX. The mice were weighed and scored for 37 days after immunization. Four of 14 CXCR3–/– mice died of EAE and were not included in the analysis after the day of death. None of the CXCR3+/+ mice died of EAE. Results are expressed as mean EAE score (mean ± SD) in each group of mice.
) (n = 4 for each group) at the peak of EAE. B and C, RPA analysis of cell populations in the spinal cord of mice with active EAE. CXCR3+/+ (
) mice on day 8 p.i., restimulated in triplicate (1 x 105 cells/well) with the indicated concentrations of MOG35–55 (B) or Con A (A) for 72 h, and pulsed with 1 µCi [3H]thymidine for the last 16 h. The background cpm values were subtracted. Each curve (±SE) represents the mean cpm of three wells. Data shown were pooled from two mice per group and are representative of two independent experiments. p value is indicated. C, IFN-
