The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vickers, T. A.
Right arrow Articles by Dean, N. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vickers, T. A.
Right arrow Articles by Dean, N. M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
The Journal of Immunology, 2006, 176: 3652-3661.
Copyright © 2006 by The American Association of Immunologists

Modification of MyD88 mRNA Splicing and Inhibition of IL-1beta Signaling in Cell Culture and in Mice with a 2'-O-Methoxyethyl-Modified Oligonucleotide

Timothy A. Vickers1, Hong Zhang, Mark J. Graham, Kristina M. Lemonidis, Chenguang Zhao and Nicholas M. Dean

Isis Pharmaceuticals, Department of Functional Genomics, Carlsbad, CA 92008


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
A number of proinflammatory cytokines, including IL-1beta, signal through the adaptor protein MyD88. This signaling leads to phosphorylation of IL-1R-associated kinase-1 (IRAK-1) and, ultimately, activation of the NF-{kappa}B transcription factor. A splice variant of MyD88 (MyD88S), which lacks the ability to couple IRAK-1 to NF-{kappa}B, has been described. A chemically modified antisense oligonucleotide (ASO) that alters the splicing ratio of MyD88 to MyD88S in both cell culture and in animals has been identified. The ASO (ISIS 337846) binds to exon II donor sites in the MyD88 pre-mRNA. By manipulating levels of MyD88 splicing, proinflammatory signaling through the IL-1R has been shown to be diminished, both in cell culture and in mouse liver. To our knowledge, this represents the first example of modulation of RNA splicing of an endogenous gene target in animals after systemic ASO dosing and suggests that this mechanism may be useful as a novel modulator of inflammatory stimuli.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The adaptor protein MyD88 is involved in IL-1R and TLR-induced activation of NF-{kappa}B (1, 2, 3). Both human and mouse MyD88 proteins are composed of a C-terminal Toll/IL-1R homology domain and an N-terminal death domain. These domains are separated by a small intermediate domain (ID)2. MyD88 links the Toll/IL-1R homology domain of IL-1R/TLR with the death domain of the Ser/Thr kinase, IL-1R-associated kinase (IRAK)-1. MyD88 also recruits IRAK-4 via its ID. This enables IRAK-4 to phosphorylate IRAK-1. Phosphorylated IRAK-1 then interacts with TRAF6, which in turn transmits a signal leading to activation of the I{kappa}B kinase complex and JNK (4). This eventually results in the activation of transcription factor NF-{kappa}B. As MyD88 is known to play a central role in regulating signaling through IL-1 and Toll receptors, various strategies have been used to demonstrate that inhibition of MyD88 function results in an alleviation of inflammatory responses. For example, in vitro, this has been clearly demonstrated using MyD88-deficient cells (5, 6). In animals, genetic ablation of MyD88 produces a diminution of responses to IL-1beta and an overall reduction in models of inflammation (7, 8, 9). Hyperlipidemic mice deficient in MyD88 expression develop reduced atherosclerosis (8). MyD88-deficient mice also demonstrate reduced pathology associated with polymicrobial sepsis (10) and defects in T cell proliferation and induction of acute phase proteins in response to IL-1beta (9).

A LPS-induced splice variant of MyD88, MyD88S, which has been reported to function as a dominant-negative regulator of IL-1beta- and LPS-induced NF-{kappa}B activation, has been identified recently (11). The MyD88 gene contains five exons (12). MyD88S is produced as the result of complete excision of exon 2 from the mature mRNA by alternative splicing. This leads to an in-frame deletion of the complete ID (aa 110–154). Although MyD88S still binds the IL-1R and IRAK-1, it is defective in its ability to recruit IRAK-4 and induce subsequent IRAK-1 phosphorylation and NF-{kappa}B activation (13). The ability of MyD88S to function as a dominant-negative regulator of IL-1beta and LPS signaling suggests that strategies to modify MyD88 RNA splicing, such that MyD88S is expressed preferentially to the larger MyD88 isoform (henceforth referred to as MyD88L), might be therapeutically valuable in treating inflammatory diseases associated with excessive IL-1R signaling.

Although variations in alternative splicing are widely recognized as a mechanism to generate molecular diversity and clearly contribute to certain diseases (14, 15, 16), the development of pharmacological agents capable of controlling RNA splicing has remained challenging. An approach that has gained significant acceptance recently is the use of chemically modified antisense oligonucleotides (ASOs). When appropriately designed and directed to hybridize to RNA sequences adjacent to splice junctions, these have been shown to effectively modulate pre-RNA splicing (17, 18, 19).

The goal of the studies described here was to determine whether novel ASOs capable of increasing expression of Myd88S relative to MyD88L, by inhibiting the use of exon II splice sites, could be identified. To do this, oligonucleotides containing 2'-O-(2-methoxy)ethyl (2'-MOE) modifications have been used. Incorporation of these modifications results in an oligonucleotide with a very high affinity for targeted mRNA, resistance to both exo- and endonucleases, and an inability to support cleavage of hybridized mRNA by RNase H (20, 21). Previous studies have demonstrated the use of this approach against a number of targets, including Bcl-X and IL-5R in cell culture (18, 22).

Other mechanisms exist by which short synthetic oligonucleotides can be used to modulate gene expression in mammalian cells (23). A commonly exploited antisense mechanism is RNase H-dependent degradation of the targeted RNA. Small-interfering RNAs (siRNAs) are another, more recently described mechanism by which gene expression can be modulated. It has been shown that transfection of synthetic 21-nt siRNA duplexes into mammalian cells can effectively inhibit expression of endogenous genes in a sequence-specific manner (24, 25). However, neither of these technologies is conducive to use in the modulation of splice site selection as they both result in degradation of the target messenger RNA.

In the present study, the successful identification of 2'-MOE-modified ASOs that decrease MyD88L expression and increase MyD88S expression, in a concentration- and sequence-dependent manner in both cell culture and in mice, is described. The lead ASO identified also was shown to modulate IL-1beta-dependent NF-{kappa}B activation both in cell culture and in animals. This represents the first reported example of modulation of RNA splicing of an endogenous gene target by a systemically delivered ASO in the absence of any carrier lipid.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Oligonucleotide synthesis

Synthesis and purification phosphorothioate/2'-MOE oligonucleotides was performed using an Applied Biosystems 380B automated DNA synthesizer as described previously (26). Sequences of oligonucleotides are detailed in Tables I and II. To identify an active RNase H-dependent ASO targeting MyD88, a series of 78 chimeric 2'-MOE/deoxyphosphorothioate oligonucleotides were evaluated in T24 cells for the ability to reduce MyD88 mRNA. At a concentration of 150 nM, 24 of 78 oligos tested reduced MyD88 mRNA by >75%. The most active oligonucleotide, 191015, reduced target expression to ~90% of untreated levels at a concentration of 150 nM. RNA oligonucleotides were synthesized at Dharmacon Research. siRNA duplexes were formed by combining 30 µl of each 50 µM RNA oligonucleotide solution and 15 µl of 5x annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH (pH 7.4), and 2 mM magnesium acetate), followed by heating for 1 min at 90°C, then 1 h at 37°C. Human MyD88 siRNA sequence: sense-CUGGAACAGACAAACUAUCdTdT; antisense strand- GAUAGUUUGUCUGUUCCAGdTdT (27).


View this table:
[in this window]
[in a new window]
  		Table I. Sequence of human splice switchingoligonucleotides

 

View this table:
[in this window]
[in a new window]
  		Table II. Sequence of mouse splice switching oligonucleotidesa

 
Cell culture and oligonucleotide treatment

T24, A549, MCF-7, T47D, bEND-3, RAW 264.7, (American Type Tissue Culture Collection), and 293FT cells (Invitrogen Life Technologies) were cultivated in DMEM supplemented with 10% FBS in 6-well culture dishes at a density of 150,000–250,000 cells/well. Cells were treated with oligonucleotides as described previously (28, 29). For ASOs, cells were incubated with a mixture of 3 µg/ml Lipofectin reagent (Invitrogen Life Technologies) per 100 nM oligonucleotide in OptiMem medium (Invitrogen Life Technologies). The Lipofectin concentration used with siRNAs was 6 µg/ml per 100 nM RNA duplex. Concentrations reported in the article represent concentration of the siRNA duplex. After 4 h, the transfection mixture was aspirated from the cells and replaced with fresh DMEM plus 10% FCS and incubated at 37°C, 5% CO2, until harvest.

Analysis of RNA

Total RNA was harvested at the indicated times following the initiation of transfection using an RNeasy mini prep kit (Qiagen) according to the manufacturer’s protocol. For Northern blots, RNA was separated on a 1.2% agarose gel containing 1.1% formaldehyde, then transferred to Hybond membranes (Amersham Biosciences). Blots were hybridized with [32P]dCTP random prime-labeled cDNA probes specific for MyD88 exon II (bases 360–494 of U70451), MyD88 exon V (bases 1138–1377 of U70451), or G3PDH (no. 636830; BD Biosciences) for 2 h in Rapid-hyb solution (Amersham Biosciences). Blots were washed with 2x SSC containing 0.1% SDS at room temperature, followed by 0.1x SSC containing 0.1% SDS at 60°C. Polysomes were isolated from cells as detailed elsewhere (30). Poly(A) RNA was purified using a Dynabeads mRNA DIRECT kit according to the manufacturer’s protocol (no. 610-11; Dynal Biotech).

Quantitative RT-PCR was performed essentially as described elsewhere (31). Briefly, 200 ng of total RNA was analyzed in a final volume of 50 µl containing 200 nM gene-specific PCR primers, 0.2 mM of each dNTP, 75 nM fluorescently labeled oligonucleotide probe, 1x RT-PCR buffer, 5 mM MgCl2, 2 U of Platinum TaqDNA Polymerase (Invitrogen Life Technologies), and 8 U of RNase inhibitor. Reverse transcription was performed for 30 min at 48°C followed by PCR: 40 thermal cycles of 30 s at 94°C and 1 min at 60°C using an ABI Prism 7700 Sequence Detector (Applied Biosystems). The following primer/probe sets were used: MyD88 (GenBank accession no. U70451)—MyD88 exon II, forward primer, CAGAGGAGGATTGCCAAAAG, reverse primer, GGGGTCATCAAGTGTGGTG, and probe, GCAGTGTCCCCACGGACAGCAX; MyD88 exon V—forward primer, TGCCCTGAAGACTGTTCTGA, reverse primer, ACTGGTTCCATGCAGGACAT, and probe, TGTCTGCCTGTCCATGTACTTCX; mouse MyD88 exon II (accession no. NM_010851)—forward primer, CACTCGAGTTTGTTGGATG, reverse primer, CCACCTGTAAAGGCTTCTCG, and probe, GCTCGTAGAGCTGCTGGCCTTGX; mouse MyD88 exon V—forward primer, CATGGTGGTGGTTGTTTCTG, reverse primer, CTTGGTGCAAGGGTTGGTAT, and probe, TCAGCCTGTCTCCAGGTGTCCAX; ICAM-1 (accession no. J03132)—forward primer, CATAGAGACCCCGTTGCCTAAA, reverse primer, TGGCTATCTTCTTGCACATTGC, and probe, CTCCTGCCTGGGAACAACCGGAAX; IL-8 (accession no. M28130)—forward primer, GAAGGAACCATCTCACTGTGTGTAA, reverse primer, AAATCAGGAAGGCTGCCAAGA, and probe, CATGACTTCCAAGCTGGCCGTGGX; mouse TNF-{alpha} (accession no. M13049)—forward primer, TCTCTTCAAGGGACAAGGCTG, reverse primer, GATAGCAAATCGGCTGACGG, and probe, CCCGACTACGTGCTCCTCACCCACX; and mouse SAA-1 (accession no. NM_009117)—forward primer, GCTGACCAGGAAGCCAACAG, reverse primer, CAGGCAGTCCAGGAGGTCTG, and probe, CATGGCCGCAGTGGCAAAGACCX. All quantitative RT/PCR data was normalized to the expression nontarget gene C-raf kinase (accession no. X03484)—forward primer, AGCTTGGAAGACGATCAGCAA, reverse primer, AAACTGCTGAACTATTGTAGGAGAGATG, and probe, AGATGCCGTGTTTGATGGCTCCAGCX; or mouse C-raf kinase (accession no. AB057663)—forward primer, TTGTTCAGCAGTTTGGCTATCAG, reverse primer, AAACCCGGATAGTATTGCTTGTCT, and probe, CAGATGATGGCAAGCTCACGGATTCTTCTX.

For standard RT-PCR, 5 µg of total RNA was reverse transcribed in the presence of oligo(dT) using SuperScript II reverse transcriptase according to the manufacturer’s protocol (Invitrogen Life Technologies). Following a 1-h incubation at 42°C, the cDNA was diluted by the addition of 80 µl of water. Three microliters of the diluted cDNA was combined with 15 µl of HotStarTaq mix (Qiagen) and 2.5 µl each of 10 µM forward and reverse PCR primer in a final volume of 30 µl. The PCR was the cycled 30 s at 94°C, 30 s at 72°C, and 2 min at 60°C with 35 repetitions. The following primers were used: human MyD88 forward, CGGCAACTGGAGACACAAG, mouse MyD88 forward, CACTCGCAGTTTGTTGGATG, and human/mouse reverse, TCTGGAAGTCACATTCCTTGC. The expected PCR product for MyD88L is 525 bp. MyD88 exon II is 135 bp in length, so the expected length for the MyD88S PCR fragment is 390 bp. Products were visualized by electrophoresis on 2% agarose gels stained with ethidium bromide.

Western blotting

Whole cell extracts were prepared by lysing cells in radioimmunoprecipitation assay buffer (1x PBS, 1% Nonidet P-40, 0.1% deoxycholate, and 0.1% SDS containing complete protease inhibitor mix (Boehringer Mannheim)). Protein concentration of the cell extracts was measured by Bradford assay (no. 500-0201; Bio-Rad). Equal amounts of protein (10–20 µg) were resolved on a NuPAGE Novex 10% Bis-Tris gel in 2-(N-morpholino)ethanesulfonic acid running buffer (Invitrogen Life Technologies) and transferred to polyvinylidene difluoride membranes (Invitrogen Life Technologies). The membranes were blocked for 1 h in TBS containing 0.05% Tween 20 (TBST) and 5% milk powder. After overnight incubation at 4°C with a 1/500 dilution of a rabbit polyclonal MyD88 Ab (ab2064, Abcam; or 14-6223, eBioscience), the membranes were washed in PBS containing 0.05% Tween 20 and incubated with a 1/5000 dilution of goat anti-rabbit HRP-conjugated Ab in blocking buffer. Membranes were washed and developed using ECL detection system (Amersham Biosciences). Subsequently, membranes were blocked for 2 h at room temperature in TBST plus 5% milk powder. After incubation at room temperature with a 1/5000 dilution of a mouse monoclonal tubulin Ab (no. T-5168; Sigma-Aldrich), the membranes were washed in PBS containing 0.1% Tween 20 and incubated with a 1/5000 dilution of goat anti-mouse HRP-conjugated Ab in blocking buffer and developed as detailed above. Blots were quantitated by laser scanning densitometry.

NF-{kappa}B/luciferase assays

293FT cells were seeded in 24-well tissue culture plates at 40,000 cells/well. The following day cells were transfected with oligonucleotide in the presence of Lipofectin reagent as detailed above. Following an overnight incubation, pNF{kappa}B-Luc (BD Biosciences) and pRL-CMV (Promega) plasmids were introduced into the cells using SuperFect Reagent (Qiagen) according to the manufacturer’s protocol. The following morning cells were stimulated with 30 ng/ml IL-1beta or 15 ng/ml TNF-{alpha} for 4 h, then harvested in 120 µl of Passive Lysis Buffer (Promega). Thirty microliters of lysate was added to each well of a black 96-well plate, then Photinus and Renilla luciferase activity measured using a Dual Luciferase Reporter Assay System (Promega) according to the manufacturer’s protocol. Luminescence was measured using a Packard TopCount. pNF{kappa}B-Luc activity was normalized to pRL-CMV activity. Error bars represent the SD from the mean of at least three independent oligonucleotide treatments.

RAW 264.7 activation assays

RAW 264.7 cells were suspended at 107 cells/ml in DMEM + 10% FCS. 90 µl of the cell suspension was transferred to a 90 µl electroporation cuvette to which ASOs were added at indicated concentrations. Cells were pulsed at 90 V for 6 mS using a BTX electroporator, then transferred to 1 ml medium and incubated 48 h. Cells were then stimulated for 6 h with 10 µg/ml LPS or 5 µM CpG oligonucleotide ISIS 12449 (ACCGATAACGTTGCCGGTGACG) for 4 h. NF-{kappa}B activity was determined by accessing TNF-{alpha} mRNA levels in treated cells by quantitative RT-PCR (qRT-PCR) as detailed above. All values were normalized to expression of C-raf kinase, a nontarget gene.

Animals and in vivo study

Twelve-week-old male C57 BL/6 mice were purchased from The Jackson Laboratory and maintained in compliance with Isis Institutional Animal Care and Use Committee Guidelines in an Association for Assessment and Accreditation of Laboratory Animal Care International-accredited facility. Mice were injected i.p. with 10–50 mg/kg oligonucleotide in 200 µl of saline solution every 2–3 days for total of four to nine doses. Where indicated, mice were challenged with 0.1 µg of recombinant mouse IL-1beta (R&D Systems) in 200 µl of saline by i.v. injection 24 h after last dose of oligonucleotide. Liver and spleen were collected from mice under anesthesia at 2 h after IL-1beta challenge or 24 h after the final oligonucleotide dose, and samples were prepared for RNA and Western blot analyses.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Identification of splicing ASOs

ASOs containing the 2'-MOE modification throughout have been shown previously to provide significant stability against exonuclease activities and enhanced affinity for hybridization to RNA (32, 33). These ASOs do not support RNase H-mediated cleavage of target mRNA in cells (20); however, this class of compound has been demonstrated to be highly effective at modifying gene expression by binding to RNA and modifying pre-mRNA splicing patterns (18, 34)

A series of 20-base 2'-MOE phosphorothioate ASOs complementary to the intron/exon boundaries of human MyD88 exon II were designed as detailed in Table I. A549 cells were treated with ASOs as detailed in Materials and Methods. After an overnight incubation, cells were harvested, and total RNA was isolated. RNA was then subject to RT-PCR. The PCR primers used were designed with complementarity to sequence flanking exon II so that a 525-bp fragment would be produced from the MyD88L message while the MyD88S RNA, lacking exon II, would yield a PCR fragment 135 bp shorter (Fig. 1A). As shown in Fig. 1B, untreated A549 cells primarily expressed the long form of MyD88. ASOs targeting the exon II acceptor site (337840–337844) had only a slight effect on splice site selection, with the long form predominant. However, treatment of cells with ASOs targeted to the exon II donor site (337845–337849) resulted in a noticeable shift from the long to the short form of MyD88. ASOs were also evaluated in a number of other cell lines (T24, 293FT, T47D, and MCF-7) with similar results observed (data not shown), demonstrating that the effectiveness of splice-inducing ASOs is not cell line dependent.


Figure 1
View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 1. Effect of 2'-MOE ASOs on MyD88 RNA splicing. A, Schematic representation of the MyD88L and MyD88S transcripts. Numbering of amino acids and nucleotides is given for MyD88L. Positions of the starting nucleotide for the forward and reverse PCR primers (in parentheses) refers to GenBank accession no. U70451. B, A549 were cells treated with 2'-MOE ASOs targeted exon II splice sites (see Table I) at a single concentration of 200 nM for 24 h. Following treatment, standard RT-PCR analysis of MyD88 RNA was performed. Expected PCR fragment for MyD88L is 525 bp and for MyD88S is 390 bp. C, 293FT cells were treated at 50, 100, 150, and 200 nM with active splice modulating oligonucleotides for 24 h followed by standard RT-PCR analysis. D, qRT-PCR analysis of MyD88-splicing modulation. RNA from A549 cells treated with ISIS 337846 at multiple concentrations for 24 h was evaluated by qRT-PCR using exon specific primers. {blacksquare}, exon II-specific probe; {cjs2113}, exon V-specific probe. Normalized to C-raf mRNA (control gene) expression. E, Northern analysis was performed on polysomal or poly(A) RNA isolated from A549 cells. Cells treated 24 h with splicing ASO. Blots were probed with radiolabeled exon II or exon V-specific DNA fragments. F, Western blot analysis of MCF7 cell lysates treated with the indicated ASO for 48 h. The positions of MyD88L and MyD88S are indicated.

 
To further characterize ASO efficacy, 293FT cells were treated with the most active ASOs at concentrations ranging from 50 to 200 nM. Total RNA was analyzed for expression of MyD88 by RT-PCR (Fig. 1C). The most potent ASO, 337846, caused an ~50% shift to the short form of MyD88 at a dose of 100 nM and >80% shift at 200 nM. The potency of 337846 was also confirmed by quantitative RT-PCR. For qRT-PCR, two probes were used. The sequence of one probe was designed to be complementary to exon II sequence only. Therefore, this qRT-PCR probe can recognize only the long form of MyD88 because exon II is not present in MyD88S. A second probe was designed with complementarity to exon V sequence. This probe can recognize both long and short form of MyD88. When MyD88 message was measured using the exon V probe, the amount of MyD88 message measured was not significantly reduced by treatment with 337846 (Fig. 1D,

{cjs2113}

). Conversely, when the MyD88 message was measured using the exon II probe, a dose-dependent reduction in mRNA levels was observed (Fig. 1D, {blacksquare}), with an IC50 of ~100 nM, in close agreement with the potency estimated by standard RT-PCR. Because the reduction in target mRNA was observed with the probe that recognizes only the long form of the message, but not the probe that recognizes both the short and long form, it can be concluded that overall MyD88 message is not being reduced by oligonucleotide treatment. Rather, the ratios of the long and short forms of the message are being altered.

To further characterize the MyD88 message, Northern blots were performed using polysome-associated RNA or poly(A)+ RNA isolated from 337846-transfected or mock-transfected A549 cells as detailed in Materials and Methods. The blots were probed with a radiolabeled exon II or exon V-specific DNA fragment. As shown in Fig. 1E, treatment with 337846 had no effect on RNA levels when the exon V probe, which can recognize both long and short forms of MyD88, was used. In contrast, the signal detected by the exon II probe, which can only detect the long form of Myd88, was reduced significantly by 337846, as compared with the untreated control. These data support the conclusion that 337846 alters splicing of the Myd88 message, reducing the abundance of the long form, and increasing the abundance of the short form. Because these blots were prepared with polysomal or poly(A)+ RNA rather than total RNA, it can also be implied that the short isoform is exported from the nucleus and is polysome associated and is therefore being actively translated.

To confirm that the short isoform of the protein is expressed in oligonucleotide-treated cells, Western blot analysis was performed. MCF-7 cells were treated at a concentration of 100 nM with 337846 or 337840, an ASO that promotes very little alternative splicing of the target RNA (Fig. 1B). RNA was isolated for RT-PCR, and cell extracts were prepared for analysis of MyD88 protein expression by Western blot 48 h postoligonucleotide treatment. Full-length MyD88 was found to migrate at 35 kDa in accordance with the predicted size of the full-length protein (Fig. 1F, middle panel). Although the control ASO had no effect on MyD88 protein expression, a truncated version of the protein migrating at the expected size of the MyD88S product (~25 kDa) was observed in cells treated with 337846. The relative ratios of the short to the long form of the MyD88 protein are approximately equal to those observed for the RNA isoforms as determined by RT-PCR of RNA isolated from the same cells (Fig. 1F, top panel).

Effect of 337846 on IL-1beta signaling

The effect of 337846 treatment on the expression of IL-1beta-inducible genes was explored. ICAM-1 is an adhesion molecule expressed at low levels in resting endothelial cells that is markedly up-regulated in response to IL-1beta and other cytokines (35). IL-8 is a member of the chemokine gene superfamily, members of which promote the proinflammatory phenotype of macrophages, vascular smooth muscle cells, and endothelial cells (36). Up-regulation of IL-8 in response to IL-1beta stimulation has also been documented (37). T24 cells were treated at a concentration of 200 nM with 337846, 337840, and 337867 (negative control ASO). Cells were then stimulated for 4 h with IL-1beta at 0.1 ng/ml 44 h posttransfection. Total RNA was harvested and qRT-PCR performed using primer/probe sets for either ICAM-1 or IL-8. Both ICAM-1 and IL-8 messages were strongly up-regulated by IL-1beta (Fig. 2A). Treatment of the cells with either the nontarget control ASO or with 337840, which induces little MYD88S expression, did not effect IL-1beta signaling. However, treatment of cells with 337846 reduced IL-1beta-dependent up-regulation of both genes.


Figure 2
View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 2. Inhibition of IL-1beta signaling with 2'-MOE ASOs targeted to MyD88. A, 293FT cells were treated 24 h with the indicated ASOs then were stimulated for 4 h with IL-1beta. Cytokine mRNA expression was then monitored by qRT-PCR. {blacksquare}, ICAM-1 mRNA; {cjs2113}, IL-8 mRNA. B, Treatment with 337846 inhibits IL-1beta but not TNF signaling via NF-{kappa}B. 293FT cells harboring a transient NF-{kappa}B luciferase reporter were treated with oligonucleotide for 48 h, then luciferase activity assayed following a 4-h IL-1beta or TNF-{alpha} induction. {blacksquare}, TNF-{alpha} (15 ng/ml); {cjs2113}, IL-1beta (30 ng/ml). Results are presented as percent luciferase activity compared with IL-1beta/TNF-{alpha}-stimulated cells.

 
The ability of 337846 to inhibit activation of a NF-{kappa}B luciferase reporter plasmid, pNF{kappa}B-Luc, was also examined. 293FT cells were transfected with ASO at a concentration of 200 nM. The following day, pNF{kappa}B-Luc was introduced into the cells. After an overnight incubation, the cells were stimulated with IL-1beta or TNF-{alpha} for 4 h. Cells were harvested and assayed for luciferase activity. The results, normalized to a cotransfected Renilla luciferase reporter, are shown in Fig. 2B. Stimulation of cells with both TNF-{alpha} and IL-1beta resulted in a marked increase in luciferase activity. Treatment of cells with control and 337840 had little effect on either IL-1beta or TNF-{alpha} signaling. TNF-{alpha} signaling was also not affected in cells treated with 337846 in agreement with previous reports that TNF-{alpha}-mediated induction of NF-{kappa}B is independent of MyD88 (1). However, luciferase expression was reduced significantly in IL-1beta stimulated cells treated with 337846.

Comparison of activity of splicing, RNase H, and siRNA ASOs

The fully modified splicing ASO, 337846 (splicing), was compared with a published MyD88 siRNA (27) and a highly active RNase H-dependent ASO targeting MyD88, 191015 (RNase H), to determine whether one antisense mechanism was substantially more effective than others. T47D cells were treated at 200 nM in the presence of Lipofectin reagent as detailed in Materials and Methods. After 48 h, cells were harvested, and RNA was isolated. MyD88 mRNA levels were then measured by qRT-PCR using the exon II and exon V-specific probes as described previously. With RNase H or siRNA ASO treatment, reduction of MyD88 message was observed with either the exon II or exon V probe (Fig. 3A). In contrast, treatment with the splicing ASO, 337846, resulted in reduction of MyD88 mRNA when the exon II probe was used but showed no significant reduction of MyD88 message when the exon V probe was used.


Figure 3
View larger version (56K):
[in this window]
[in a new window]
  		FIGURE 3. Comparison of 2'-MOE splicing, RNase H, and siRNA oligonucleotides targeted to MyD88. A, T47D cells were treated for 48 h with the indicated ASOs at 200 nM. RNA was then extracted, and MyD88 expression were determined by qRT-PCR. Results are presented as percent of untreated control expression normalized to a nontarget gene. Exon specific TaqMan probes: {blacksquare}, exon II; {cjs2113}, exon V. B, Northern analysis. A549 cells were treated for 24 h with the indicated ASOs at 200 nM. RNA was then extracted and analyzed by Northern blotting as described in Materials and Methods. Probes used were MyD88 exon II- or exon V-specific DNA fragments. Blots were also probed with a G3PDH fragment to verify loading. C, Western blot analysis of T47D cell lysates treated with the indicated ASO for 48 h. D, T24 cells were treated with the indicated concentration of ASO for 24 h, and MyD88 expression was determined by qRT-PCR. E, 293FT cells were treated with the indicated concentration of ASO for 48 h. At this point, cells were stimulated with 30 ng/ml IL-1beta, and NF-{kappa}B luciferase expression was determined. Results given are relative to untreated control cells and normalized to pRL-luc expression.

 
These results were confirmed by Northern blot analysis. As shown in Fig. 3B, each type of ASO reduced the signal detected via the exon II probe to the same extent. In contrast, the signal detected by the exon V probe was reduced significantly by the RNase H and siRNA ASO but not by the splicing ASO, 337846. This confirms that 337846 works not by cleavage and degradation of the target message as RNase H and siRNA ASOs do but by forcing the use of a specific alternative splice site.

Western blots prepared with lysates from the same cells were also performed. Treatment with the RNase H or siRNA ASOs resulted in significant reduction in MyD88 protein as compared with the untreated control (Fig. 3C). The splicing ASO also resulted in a reduction in full-length MyD88L protein; however, in contrast to the splicing and RNase H-treated cells, MyD88S protein was also observed.

The overall potencies of the siRNA, RNase H, and full MOE splicing ASOs were next compared. T24 cells were treated with ASOs at 25, 50, 100, and 200 nM. The following day RNA was isolated, and mRNA levels were accessed by qRT-PCR using the MyD88 exon II-specific probe. The results, shown in Fig. 3D, indicate that all exhibit similar potencies with IC50s in the 50–100 nM range.

Splicing, RNase H, and siRNA ASOs were also evaluated for their ability to inhibit IL-1beta-dependent NF-{kappa}B activation. 293FT cells were treated as described above with splicing, RNase H, and siRNA ASOs at 50, 100, and 200 nM. The following day, the reporter plasmid pNF{kappa}B-luc was introduced into the cells. Activation of luciferase by IL-1beta and TNF-{alpha} was assayed after an overnight incubation. The results are shown in Fig. 3E. The ASOs exhibit similar abilities to reduce signaling and diminish luciferase levels by ~50% at the 50 nM dose. There was no effect of the ASO treatments on TNF-{alpha} signaling even at the highest dose (data not shown).

MyD88 ASOs inhibit TLR signaling in mouse cells

A series of 2'MOE-modified ASOs was designed to target exon II splicing of mouse MyD88 (Table II). RAW 264.7 cells were electroporated with ASO at a concentration of 10 µM, and total RNA was isolated 48 h later. One ASO, 337856, was shown to enhance short-form MyD88 splicing in the mouse macrophage cell line, RAW 264.7, as accessed by RT-PCR with primers bordering exon II of mouse MyD88 (Fig. 4).


Figure 4
View larger version (12K):
[in this window]
[in a new window]
  		FIGURE 4. Effect of 2'-MOE ASOs on mouse MyD88 RNA splicing. RAW 264.7 cells were treated 24 h with ASOs targeting exon II splice sites (see Table II) at a concentration of 200 nM. RNA was then extracted, and MyD88 expression was determined by RT-PCR using primers located in exon I and exon III.

 
The effect of MyD88 ASO administration on TLR9 signaling was next determined. TLR9 is involved in the recognition of specific unmethylated CpG-ODN sequences that distinguish bacterial DNA from mammalian DNA. The MyD88-dependent signaling pathway is common to many TLRs because MyD88-deficient mice are unable to produce inflammatory cytokines in response to most TLR ligands (9, 38). RAW 264.7 cells, which have been shown to express active TLR9 (39, 40), were electroporated at 10 µM with 337856 (splicing), 337853 (nonactive control), or 191015 (RNase H), which is complementary to mouse as well as human MyD88 mRNA. After 48 h, cells were treated with a previously identified CpG oligonucleotide TLR9 activator (41) at a concentration of 5 µM. Four hours later, RNA was harvested and analyzed for expression of TNF-{alpha} mRNA by qRT-PCR. TLR9 activation resulted in a 3-to 4-fold increase in TNF-{alpha} mRNA (Fig. 5). In cells treated with either the splicing or RNase H ASOs, CpG signaling, as measured by TNF-{alpha} induction, was reduced by >50%, whereas the control ASO had no effect.


Figure 5
View larger version (14K):
[in this window]
[in a new window]
  		FIGURE 5. Treatment with 337856 inhibits TLR9 signaling in RAW 264.7 cells. Raw 264.7 cells were electroporated with 10 µM splicing (337856) or RNase H (191015) or control (337853) ASO. After 48 h, cells were stimulated with 5 µM CpG oligonucleotide for 4 h. Induction of TNF-{alpha} mRNA was measured by qRT-PCR. Results are presented as fold TNF-{alpha} mRNA induction compared with untreated control cells.

 
Inhibition of IL-1beta signaling in mouse liver

The ability of 2'-MOE ASO to regulate MyD88 splicing in mice was next evaluated. Mice were treated twice weekly for 2 wk at doses of 10, 25, and 50 mg/kg. Twenty-four hours after the final ASO treatment, liver RNA was isolated and subject to PCR using primers bracketing exon 2 of MyD88. The results are shown in Fig. 6A. At the 25 mg/kg dose, there is an approximately equal distribution of MyD88L and MyD88S. At 50 mg/kg, the majority of the MyD88 RNA present is the short form. At both doses there is a general reduction in the total overall amount of MyD88 message. This observation was confirmed using qRT-PCR. Liver RNA from the same experiment was analyzed by TaqMan RT-PCR using a primer/probe set specific to exon V of mouse MyD88. A corresponding loss in the MyD88 message was observed as the ASO dose was increased (Fig. 6B). Because this primer/probe set recognizes both MyD88 isoforms, the reduction cannot be attributed solely to ASO directed switching of splicing to the short form.


Figure 6
View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 6. In vivo potency of 337856. A, Mice were treated twice weekly for 2 wk at doses of 10, 25, and 50 mg/kg. Twenty-four hours after the final oligonucleotide treatment, liver RNA was isolated and subject to PCR using primers bracketing exon 2 of MyD88. (n = 3). B, Liver RNA was analyzed by qRT-PCR using the MyD88 exon V primer/probe (n = 3–4). C, Cell lysates were prepared from livers of treated mice. Twenty micrograms of protein was loaded per well for Western blot analysis. Blots were probed with a MyD88-specific Ab and an {alpha}-tubulin Ab as a loading control. The numbers in parenthesis above each treatment group represent the average intensity of the MyD88 band (n = 2) normalized to the tubulin band as compared with the saline-treated control.

 
Lysates prepared from the livers of treated animals were also analyzed by Western blot. In agreement with the reduction observed at the RNA level, MyD88 protein levels were reduced significantly at all treatment doses as compared with the saline-treated control mice (Fig. 6C). Therefore, in vivo, the splicing ASO results in an overall reduction in MyD88 RNA and protein not observed in vitro. However, in contrast to cell culture experiments, no short form of the MyD88 protein was observed in vivo.

Activity of the splicing ASO was evaluated in other tissues as well. Treatment of mice with 337856 at a dose of 50 mg/kg twice weekly for 4 wk resulted in an ~60% reduction in the MyD88 message (Fig. 7,

{cjs2110}

) as accessed by qRT-PCR using the exon V primer/probe set 24 h after the final treatment. In intestine, the splicing ASO reduced MyD88 message levels to 70% of the saline-treated control mice (Fig. 7, {blacksquare}). In adipose tissue, the splicing ASO appeared to be even more active, reducing mRNA levels by ~90% (Fig. 7,

{cjs2113}

). Western blots performed using lysates from the same tissues showed that MyD88 protein was reduced in intestine and adipose tissue, as well as liver in the 337856-treated animals; however, as in the liver, no short form of the protein was observed in the Western blots from either tissue (data not shown).


Figure 7
View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 7. Effects of MyD88 splicing ASO on RNA expression in multiple tissues. Mice were dosed at 50 mg/kg with 337856 2 times weekly for 4 wk. Twenty-four hours after the final dose, liver, adipose tissue, and intestine were harvested from which RNA was isolated. Intestine ({blacksquare}), adipose tissue ({cjs2113}), and liver ({cjs2110}) RNA were analyzed by qRT-PCR using the MyD88 exon V primer/probe (n = 5–6).

 
To determine whether ASO-mediated modulation of MyD88 splicing could disrupt IL-1beta signaling in vivo, mice were dosed at 50 mg/kg with 337856 and 289607, a control ASO, three times weekly for 3 wk. Twenty-four hours after the final dose, animals were challenged with 0.1 µg of IL-1beta. After 2 h, livers were taken and expression of MyD88 and serum amyloid A (SAA-1) RNA analyzed. Although a shift to MyD88S RNA was observed, overall expression of both isoforms of MyD88 was again found to be reduced significantly by 337856 as determined by RT-PCR using primers flanking exon II (Fig. 8A). Liver SAA-1 levels were analyzed by qRT-PCR. In agreement with a previous study demonstrating up-regulation of the SAA-1 gene in the liver of IL-1beta-treated mice (9), SAA-1 mRNA was strongly up-regulated by IL-1beta administration in saline-treated mice (Fig. 8B). However, mice treated with 337856 showed no IL-1beta-mediated increase in SAA-1 expression. In contrast, the control ASO did not significantly effect IL-1beta induction of SAA-1 mRNA expression.


Figure 8
View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 8. Effect of ASOs on MyD88 splicing and SAA-1 expression in mouse liver. A, Mice were dosed at 50 mg/kg with 337856 and 289607 three times weekly for 3 wk. Twenty-four hours after the final dose, animals were challenged with 0.1 µg of IL-1beta. After 2 h, livers were taken, and total RNA was extracted. Expression of MyD88 RNA was analyzed by RT-PCR using primers spanning exon II. B, Liver SAA-1 mRNA levels were analyzed by qRT-PCR. The results are presented as percent control of IL-1-stimulated mice and normalized to c-raf mRNA expression. (n = 3–4/treatment group).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
An estimated 60% of all human genes undergo alternative splicing (42), and it is widely believed that RNA splicing allows the generation of functionally distinct proteins from a single transcript, resulting in increased molecular diversity. Consequently, splicing of pre-mRNA transcripts is a highly regulated event relying on the precise recognition of splice sites by the splicing machinery. Aberrant splicing can result in a number of human diseases, and therefore, the ability to selectively redirect or correct RNA splicing of a specific transcript could have enormous therapeutic potential (19, 43)

ASOs have proven to be effective as therapeutic agents (44), and interest in mRNA as a target for drug therapy has intensified recently with the discovery of RNA interference (45). To date, most in vivo applications using ASOs have been based on the ability of DNA-like oligonucleotides to support RNase H-dependent degradation of targeted mRNA transcripts. However, the regulation of mRNA splicing by ASOs represents a much less explored application of antisense technology. Both RNase H- and siRNA-based antisense approaches are limited to down-regulating expression of targeted genes; however, effective redirection of RNA splicing with ASOs can lead to the increased expression of a particular protein. In theory, this can lead to a more effective pharmacological outcome than simply reduced protein expression, for example, when two functionally antagonistic proteins are derived from alternative splicing of an individual RNA transcript. Studies in cell culture have demonstrated the use of ASOs for this approach (17, 18, 22, 34).

MyD88 represents an attractive target for the therapeutic modulation of splicing. The MyD88 gene is organized into five exons and four introns (12), and a splice variant of MyD88 lacking exon II, MyD88S, has been identified (11). MyD88S is defective in its ability to induce IRAK phosphorylation and NF-{kappa}B activation, and when expressed, MyD88S behaves as a dominant-negative inhibitor of IL-1beta- and LPS-, but not TNF-induced, NF-{kappa}B activation (1, 2, 3).

The activity of the splicing ASOs evaluated appears to be highly dependent on the RNA sequence targeted. For example, ASOs targeted to the exon II acceptor site had very little effect on MyD88 splicing, whereas ASOs targeted to the exon II donor splice site were in general more effective stimulators of exon skipping (Fig. 1B). Other investigators have observed that targeting of either the donor or acceptor splice site can effectively promote exon skipping (17). RNA structure prediction (46) of sequence surrounding the exon II splice junctions revealed that the 5'-splice site is more highly structured than the 3'-splice site. It is possible that the difference in oligonucleotide activity at the donor and acceptor sites has to do with accessibility of the sequence for hybridization (29). Targeting of ASOs to mouse exon II splice sites was, in general, less successful with only one of ten ASOs tested effectively altering splicing (Fig. 4). This again may be a result of poor accessibility of the mouse splice sites to ASO hybridization as compared with the human or may be the result of sequence specific differences in hybridization affinity.

The most potent splice-switching ASO identified, 337846, was found to effectively inhibit NF-{kappa}B activation by IL-1beta (Fig. 2). Because MyD88S has been demonstrated to function as a dominant-negative regulator of IL-1beta-induced NF-{kappa}B activation (11), it was anticipated that oligonucleotide-mediated transcript switching to MyD88S would offer a more potent method to inhibit IL-1beta signaling than simple reduction of the message by targeting with ASOs working through either an RNase H or siRNA mechanism. Comparison of the relative potencies of splicing ASOs with RNase H and siRNA ASOs in cell culture did not reveal differences in their respective abilities to modulate RNA expression (Fig. 3D). It should be kept in mind that both RNase H and siRNA ASOs work by a catalytic mechanism while the splicing ASO does not. Qualitatively, while a reduction of total MyD88 message was observed with the siRNA and RNase H ASOs (Fig. 3, A and B), the splicing ASO caused exon skipping and production of MyD88S as demonstrated by Northern blot and qRT-PCR experiments (Figs. 1, D and E, and 3B) and by Western blot (Figs. 1F and 3C).

The ability of systemically administered ASOs to down-regulate gene expression in mice by a RNase H-dependent mechanism is well documented (47, 48, 49). Relatively few studies have been conducted evaluating the ability of ASOs to redirect RNA splicing in animals. One study has been published in which systemically delivered splice-switching oligonucleotides were shown to up-regulate the expression of an enhanced green fluorescent protein transgene in mice in multiple tissues (50). Recently, Lu et al. (51) used i.m. injection of an ASO designed to specifically remove mutated exon 23 in the mdx mouse model of Duchenne muscular dystrophy to restore dystrophin expression levels to those comparable to those of normal muscle fibers. In this latter study, ASO activity was obtained only when the oligonucleotide was delivered with the help of the nonionic block copolymer F127. In the current study, systemically administered 2'-MOE ASOs formulated in saline were used to successfully alter splicing of MyD88 in mouse liver. This lead to a diminution of IL-1beta signaling, demonstrating the therapeutic potential of this antisense approach in vivo. The ASO developed appears to be active at doses between 10 and 50 mg/kg, which is quite similar to those reported for RNase H and siRNA ASOs. This is the first report of a systemically administered ASO being successfully used to alter RNA splicing of an endogenous gene target. The ASO-mediated effects on RNA splicing are, however, different to those seen in cell culture (Fig. 4). First, although a shift to the short form of MyD88 at the RNA level was demonstrable (Fig. 6, A and B, and 8A), an overall reduction in MyD88 RNA levels was also apparent. At the highest doses evaluated (50 mg/kg), there was an ~75–90% reduction in the total amount of MyD88 RNA. Second, MyD88S protein expression was not observed in tissues of treated mice (Fig. 6C). Instead, there was a strong reduction in MyD88L protein, which corresponded with the observed reduction in total MyD88 mRNA. The mechanism for this decreased RNA and protein expression and lack of MyD88S protein expression is unclear. It is known that during pre-mRNA splicing a number of proteins are recruited to the mRNA transcript, and these can regulate subsequent mRNA translation and nonsense-mediated mRNA decay (52). The interaction of the splicing ASO identified with the MyD88 transcript may also interfere with the accumulation of these proteins, which in turn would modify both MyD88 translation and the stability of the short mRNA transcript.

In conclusion, an ASO that potently and selectively modifies the splicing of MyD88 in cell culture and in animals has been identified, resulting in a decrease in IL-1beta-mediated signaling. This is believed to be the first example of systemically administered ASO-mediated splicing of an endogenous gene in animals reported and therefore represents an attractive and novel approach to the development of antisense-based therapeutics.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Address correspondence and reprint requests to Dr. Timothy A. Vickers, Isis Pharmaceuticals, Department of Functional Genomics, 1896 Rutherford Road, Carlsbad, CA 92008. E-mail address: tvickers{at}isisph.com Back

2 Abbreviations used in this paper: ID, intermediate domain; IRAK, IL-1R-associated kinase; ASO, antisense oligonucleotide; 2'-MOE, 2'-O-(2-methoxy)ethyl; siRNA, small-interfering RNA; qRT-PCR, quantitative RT-PCR. Back

Received for publication August 12, 2005. Accepted for publication January 6, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Burns, K. C., C. Esslinger, H. Pahl, P. Schneider, J.-L. Bodmer, F. Di Marco, L. French, J. Tschopp. 1998. MyD88, an adapter protein involved in interleukin-1 signaling. J. Biol. Chem. 273: 12203-12209. [Abstract/Free Full Text]
  2. Wesche, H., W. J. Henzel, W. Shillinglaw, S. Li, Z. Cao. 1977. MyD88: an adapter that recruits IRAK to the IL-1 receptor complex. Immunity 7: 837-847.
  3. Medzhitov, R., P. Preston-Hurlburt, E. Kopp, A. Stadlen, C. Chen, S. Ghosh, C. A. Janeway, Jr. 1998. MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways. Mol. Cell 2: 253-258. [Medline]
  4. Cao, Z., J. Xiong, M. Takeuchi, T. Kurama, D. V. Goedde. 1996. TRAF6 is a signal transducer for interleukin-1. Nature 383: 443-446. [Medline]
  5. Schnare, M., A. C. Holt, K. Takeda, S. Akira, R. Medzhitov. 2000. Recognition of CpG DNA is mediated by signaling pathways dependent on the adaptor protein MyD88. Curr. Biol. 10: 1139-1142. [Medline]
  6. Yamamoto, M., S. Sato, H. Hemmi, H. Sanjo, S. Uematsu, T. Kaisho, K. Hoshino, O. Takeuchi, M. Kobayashi, T. Fujita, et al 2002. Essential role for TIRAP in activation of the signaling cascade shared by TLR2 and TLR4. Nature 420: 324-329. [Medline]
  7. Kawai, T., O. Adachi, T. Ogawa, K. Takeda, S. Akira. 1999. Unresponsiveness of MyD88-deficient mice to endotoxin. Immunity 11: 115-122. [Medline]
  8. Bjorkbacka, H., V. V. Kunjathoor, K. J. Moore, S. Koehn, C. M. Ordija, M. A. Lee, T. Means, K. Halmen, A. D. Luster, D. T. Golenbock, M. W. Freeman. 2004. Reduced atherosclerosis in MyD88-null mice links elevated serum cholesterol levels to activation of innate immunity signaling pathways. Nat. Med. 10: 416-421. [Medline]
  9. Adachi, O., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, K. Nakanishi, S. Akira. 1998. Targeted disruption of the MyD88 gene results in loss of IL-1- and IL-18-mediated function. Immunity 9: 143-150. [Medline]
  10. Weighardt, H., S. Kaiser-Moore, R. M. Vabulas, C. J. Kirschning, H. Wagner, B. Holzmann. 2002. Cutting edge: myeloid differentiation factor 88 deficiency improves resistance against sepsis caused by polymicrobial infection. J. Immunol. 169: 2823-2827. [Abstract/Free Full Text]
  11. Janssens, S., K. Burns, J. Tschopp, R. Beyaert. 2002. Regulation of interleukin-1- and lipopolysaccharide-induced NF-{kappa}B activation by alternative splicing of MyD88. Curr. Biol. 12: 467-471. [Medline]
  12. Hardiman, G., N. A. Jenkins, N. G. Copeland, D. J. Gilbert, D. K. Garcia, S. L. Naylor, R. A. Kastelein, J. F. Bazan. 1997. Genetic structure and chromosomal mapping of MyD88. Genomics 45: 332-339. [Medline]
  13. Burns, K., S. Janssens, B. Brissoni, N. Olivos, R. Beyaert, J. Tschopp. 2003. Inhibition of interleukin 1 receptor/Toll-like receptor signaling through the alternatively spliced, short form of MyD88 is due to its failure to recruit IRAK-4. J. Exp. Med. 197: 263-268. [Abstract/Free Full Text]
  14. Maniatis, T., B. Tasic. 2002. Alternative pre-mRNA splicing and proteome expansion in metazoans. Nature 418: 236-243. [Medline]
  15. Johnson, J. M., J. Castle, P. Garrett-Engele, Z. Kan, P. M. Loerch, C. D. Armour, R. Santos, E. E. Schadt, R. Stoughton, D. D. Shoemaker. 2003. Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays. Science 302: 2141-2144. [Abstract/Free Full Text]
  16. Yeo, G., S. Hoon, B. Venkatesh, C. B. Burge. 2004. Variation in sequence and organization of splicing regulatory elements in vertebrate genes. Proc. Natl. Acad. Sci. USA 101: 15700-15705. [Abstract/Free Full Text]
  17. Sazani, P., R. Kole. 2003. Therapeutic potential of antisense oligonucleotides as modulators of alternative splicing. J. Clin. Invest. 112: 481-486. [Medline]
  18. Taylor, J. K., Q. Q. Zhang, J. R. Wyatt, N. M. Dean. 1999. Induction of endogenous Bcl-xS through the control of Bcl-x pre-mRNA splicing by antisense oligonucleotides. Nat. Biotech. 17: 1097-1100. [Medline]
  19. Garcia-Blanco, M. A., A. P. Baraniak, E. L. Lasda. 2004. Alternative splicing in disease and therapy. Nat. Biotech. 22: 535-546. [Medline]
  20. McKay, R. A., L. J. Miraglia, L. L. Cummins, S. R. Owens, H. Sasmor, N. M. Dean. 1999. Characterization of a potent and specific class of antisense oligonucleotide inhibitor of human protein kinase C-{alpha} expression. J. Biol. Chem. 274: 1715-1722. [Abstract/Free Full Text]
  21. Monia, B. P., E. A. Lesnik, C. Gonzalez, W. F. Lima, D. McGee, C. J. Guinosso, A. M. Kawasaki, P. D. Cook, S. M. Freier. 1993. Evaluation of 2'-modified oligonucleotides containing 2'-deoxy gaps as antisense inhibitors of gene expression. J. Biol. Chem. 268: 14514-14522. [Abstract/Free Full Text]
  22. Karras, J. G., R. A. McKay, N. M. Dean, B. P. Monia. 2000. Deletion of individual exons and induction of soluble murine interleukin-5 receptor {alpha} chain expression through antisense oligonucleotide-mediated redirection of pre-mRNA splicing. Mol. Pharm. 58: 380-387. [Abstract/Free Full Text]
  23. Crooke, S. T.. 1999. Molecular mechanisms of action of antisense drugs. Biochim. Biophys. Acta 1489: 30-42.
  24. Elbashir, S. M., J. Harborth, W. Lendeckel, A. Yalcin, K. Weber, T. Tuschl. 2001. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411: 494-498. [Medline]
  25. Caplen, N. J., S. Parrish, F. Imani, A. Fire, R. A. Morgan. 2001. Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate systems. Proc. Natl. Acad. Sci. USA 98: 9742-9747. [Abstract/Free Full Text]
  26. Baker, B. F., S. S. Lot, T. P. Condon, S. Cheng-Flournoy, E. A. Lesnik, H. M. Sasmor, C. F. Bennett. 1997. 2'-O-(2-Methoxy)ethyl-modified anti-intercellular adhesion molecule 1 (ICAM-1) oligonucleotides selectively increase the ICAM-1 mRNA level and inhibit formation of the ICAM-1 translation initiation complex in human umbilical vein endothelial cells. J. Biol. Chem. 272: 11994-12000. [Abstract/Free Full Text]
  27. Oshiumi, H., K. Funami, T. Akazawa, T. Seya. 2003. TICAM-1, an adaptor molecule that participates in Toll-like receptor 3-mediated interferon- induction. Nat. Immunol. 4: 161-167. [Medline]
  28. Chiang, M.-Y., H. Chan, M. A. Zounes, S. M. Freier, W. F. Lima, C. F. Bennett. 1991. Antisense oligonucleotides inhibit intercellular adhesion molecule 1 expression by two distinct mechanisms. J. Biol. Chem. 266: 18162-18171. [Abstract/Free Full Text]
  29. Vickers, T. A., J. R. Wyatt, S. M. Freier. 2000. Effects of RNA secondary structure on cellular antisense activity. Nucleic Acids Res. 28: 1340-1347. [Abstract/Free Full Text]
  30. Laroia, G., G. Brewer, R. J. Schneider. 1999. Control of mRNA decay by heat shock-ubiquitin-proteasome pathway. Science 284: 499-502. [Abstract/Free Full Text]
  31. Winer, J., C. Kwang, S. Jung, I. Shackel, P. M. Williams. 1999. Development and validation of real-time quantitative reverse transcriptase-polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro. Anal. Biochem. 270: 41-49. [Medline]
  32. Altmann, K.-H., N. M. Dean, D. Fabbro, S. M. Freier, T. Geiger, R. Häner, D. Hüsken, P. Martin, B. P. Monia, M. Müller, et al 1996. Second generation of antisense oligonucleotides: from nuclease resistance to biological efficacy in animals. Chimia 50: 168-176.
  33. Dean, N. M., R. H. Griffey. 1997. Identification and characterization of second-generation antisense oligonucleotides. Antisense Nucleic Acid Drug Dev. 7: 229-233. [Medline]
  34. Sazani, P., S. H. Kang, M. A. Maier, C. Wei, J. Dillman, J. Summerton, M. Manoharan, R. Kole. 2001. Nuclear antisense effects of neutral, anionic and cationic oligonucleotide analogs. Nucleic Acids Res. 29: 3965-3974. [Abstract/Free Full Text]
  35. Springer, T. A.. 1990. Adhesion receptors of the immune system. Nature 346: 425-434. [Medline]
  36. Koch, A. E., P. J. Polverini, S. L. Kunkel, L. A. Harlow, L. A. DiPietro, V. M. Elner, R. M. Strietier. 1992. Interleukin-8 as a macrophage-derived mediator of angiogenesis. Science 258: 1798-1801. [Abstract/Free Full Text]
  37. Fujishima, S., A. R. Hoffman, T. Vu, K. J. Kim, H. Zheng, D. Daniel, Y. Kim, E. F. Wallace, J. W. Larrick, T. A. Raffin. 1993. Regulation of neutrophil interleukin 8 gene expression and protein secretion by LPS, TNF-{alpha}, and IL-1beta. J. Cell. Physiol. 154: 478-485. [Medline]
  38. Medzhitov, R., P. Preston-Hurlburt, C. A. Janeway, Jr. 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388: 394-397. [Medline]
  39. An, H., H. Xu, Y. Yu, M. Zhan, R. Qi, X. Yan, S. Liu, W. Wang, Z. Guo, Z. Qin, X. Cao. 2002. Up-regulation of TLR9 gene expression by LPS in mouse macrophages via activation of NF-{kappa}B, ERK and p38 MAPK signal pathways. Immunol. Lett. 81: 165-169. [Medline]
  40. Rhee, S. H., D. Hwang. 2000. Murine Toll-like receptor 4 confers lipopolysaccharide responsiveness as determined by activation of NF-{kappa}B and expression of the inducible cyclooxygenase. J. Biol. Chem. 275: 34035-34040. [Abstract/Free Full Text]
  41. Henry, S. P., K. Stecker, D. Brooks, D. K. Monteith, B. Conklin, C. F. Bennett. 2000. Chemically modified oligonucleotides exhibit decreased immune stimulation in mice. J. Pharm. Exp. Ther. 292: 468-479. [Abstract/Free Full Text]
  42. Modrek, B., C. Lee. 2001. A genomic view of alternative splicing. Nat. Genet. 30: 13-19.
  43. Faustino, N. A., T. A. Cooper. 2003. Pre-mRNA splicing and human disease. Genes. Dev. 17: 419-437. [Free Full Text]
  44. Crooke, S. T., C. F. Bennett. 1996. Progress in antisense oligonucleotide therapeutics. Ann. Rev. Pharm. Tox. 36: 107-129. [Medline]
  45. Agami, R.. 2002. RNAi and related mechanisms and their potential use for therapy. Curr. Opin. Chem. Biol. 6: 829-834. [Medline]
  46. Mathews, D. H., M. E. Burkard, S. M. Freier, J. R. Wyatt, D. H. Turner. 1999. Predicting oligonucleotide affinity to nucleic acid targets. RNA 5: 1458-1469. [Abstract]
  47. Zhang, H., J. Cook, J. Nickel, R. Yu, K. Stecker, K. Myers, N. M. Dean. 2000. Reduction of liver Fas expression by an antisense oligonucleotide protects mice from fulminant hepatitis. Nat. Biotech. 18: 862-867. [Medline]
  48. Zinker, B. A., C. M. Rondinone, J. M. Trevillyan, R. J. Gum, J. E. Clampit, J. F. Waring, N. Xie, D. Wilcox, P. Jacobson, L. Frost, et al 2002. PTP1B antisense oligonucleotide lowers PTP1B protein, normalizes blood glucose, and improves insulin sensitivity in diabetic mice. Proc. Natl. Acad. Sci. USA 99: 11357-11362. [Abstract/Free Full Text]
  49. Dean, N. M., R. McKay. 1994. Inhibition of protein kinase C-{alpha} expression in mice after systemic administration of phosphorothioate antisense oligodeoxynucleotides. Proc. Natl. Acad. Sci. USA 91: 11762-11766. [Abstract/Free Full Text]
  50. Sazani, P., F. Gemignani, S. H. Kang, M. A. Maier, M. Manoharan, M. Persmark, D. Bortner, R. Kole. 2002. Systemically delivered antisense oligomers up-regulate gene expression in mouse tissues. Nat. Biotech. 20: 1228-1233. [Medline]
  51. Lu, Q. L., C. J. Mann, F. Lou, G. Bou-Gharios, G. E. Morris, S. A. Xue, S. Fletcher, T. A. Partridge, S. D. Wilton. 2003. Functional amounts of dystrophin produced by skipping the mutated exon in the mdx dystrophic mouse. Nat. Med. 9: 1009-1014. [Medline]
  52. Maquat, L. E.. 2004. Nonsense-mediated mRNA decay: splicing, translation and mRNP dynamics. Nat. Rev. Mol. Cell Biol. 5: 89-99. [Medline]

Related articles in The JI:

IN THIS ISSUE

The JI 2006 176: 3289-3290. [Full Text]  



This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
T. A. Vickers, W. F. Lima, H. Wu, J. G. Nichols, P. S. Linsley, and S. T. Crooke
Off-target and a portion of target-specific siRNA mediated mRNA degradation is Ago2 'Slicer' independent and can be mediated by Ago1
Nucleic Acids Res., November 1, 2009; 37(20): 6927 - 6941.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
L. G. Fong, T. A. Vickers, E. A. Farber, C. Choi, U. J. Yun, Y. Hu, S. H. Yang, C. Coffinier, R. Lee, L. Yin, et al.
Activating the synthesis of progerin, the mutant prelamin A in Hutchinson-Gilford progeria syndrome, with antisense oligonucleotides
Hum. Mol. Genet., July 1, 2009; 18(13): 2462 - 2471.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
T. A. Vickers, W. F. Lima, J. G. Nichols, and S. T. Crooke
Reduced levels of Ago2 expression result in increased siRNA competition in mammalian cells
Nucleic Acids Res., October 8, 2007; 35(19): 6598 - 6610.
[Abstract] [Full Text] [PDF]

Home page
 RNAHome page
A. Aartsma-Rus and G.-J. B. van Ommen
Antisense-mediated exon skipping: A versatile tool with therapeutic and research applications
RNA, October 1, 2007; 13(10): 1609 - 1624.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
L. Du, J. M. Pollard, and R. A. Gatti
Correction of prototypic ATM splicing mutations and aberrant ATM function with antisense morpholino oligonucleotides
PNAS, April 3, 2007; 104(14): 6007 - 6012.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vickers, T. A.
Right arrow Articles by Dean, N. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vickers, T. A.
Right arrow Articles by Dean, N. M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS