The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, X.
Right arrow Articles by Jensen, P. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, X.
Right arrow Articles by Jensen, P. E.
The Journal of Immunology, 2006, 176: 3548-3556.
Copyright © 2006 by The American Association of Immunologists

H2-O Expression in Primary Dendritic Cells1

Xinjian Chen*, Lisa M. Reed-Loisel*, Lars Karlsson{dagger} and Peter E. Jensen2,*

* Department of Pathology, School of Medicine, University of Utah, Salt Lake City, UT 84132; and {dagger} Johnson & Johnson Pharmaceutical Research and Development, San Diego, CA 92121


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
H2-O is a nonpolymorphic class II molecule whose biological role remains to be determined. H2-O modulates H2-M function, and it has been generally believed to be expressed only in B lymphocytes and thymic medullary epithelial cells, but not in dendritic cells (DCs). In this study, we report identification of H2-O expression in primary murine DCs. Similar to B cells, H2-O is associated with H2-M in DCs, and its expression is differentially regulated in DC subsets as well as during cell maturation and activation. Primary bone marrow DCs and plasmacytoid DCs in the spleen and lymph nodes express MHC class II and H2-M, but not the inhibitor H2-O. In contrast, myeloid DCs in secondary lymphoid organs express both H2-M and H2-O. In CD8{alpha}{alpha}+ DCs, the ratio of H2-O to H2-M is higher than in CD8{alpha}{alpha}– DCs. In DCs generated from GM-CSF- and IL-4-conditioned bone marrow cultures, H2-O expression is not detected regardless of the maturation status of the cells. Administration of LPS induces in vivo activation of myeloid DCs, and this activation is associated with down-regulation of H2-O expression. Primary splenic DCs from H2-O–/– and H2-O+/+ mice present exogenous protein Ags to T cell hybridomas similarly well, but H2-O–/– DCs induce stronger allogeneic CD4 T cell response than the H2-O+/+ DCs in mixed leukocyte reactions. Our results suggest that H2-O has a broader role than previously appreciated in regulating Ag presentation.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Peptide Ags recognized by CD4+ T cells are presented in the context of the MHC class II molecules (1, 2). When synthesized in the endoplasmic reticulum, the nascent class II {alpha}- and beta-chains form complexes with the invariant chain (Ii).3 The complexes are transported to late endosomes, in which Ii is degraded and released, leaving a short fragment of Ii known as the CLIP occupying the peptide-binding groove of the class II molecules. Peptide exchange then occurs, to replace CLIP with other peptides during a brief transit time of 0.5–1.5 h before the class II molecules are transported to the cell surface. Efficient removal of CLIP and subsequent peptide loading require participation of the specialized catalyst/chaperone-like molecule H2-M (HLA-DM in humans) (3, 4, 5, 6, 7). In the absence of H2-M, APCs can completely lose their Ag presentation abilities (8, 9, 10, 11).

In primary B cells and B cell lines, an additional nonclassical class II molecule, H2-O (HLA-DO in humans), has been reported to be closely associated with H2-M (12, 13, 14). DO is unstable and dependent on DM to exit the endoplasmic reticulum. In the absence of DM, DO is degraded. The biochemical function of DO was unclear until the first reports that DO inhibited DM function (15, 16). Over the past few years, all independent studies (17, 18, 19, 20, 21), except for one (22), further confirmed that DO is a negative regulator of DM function. The inhibitory function of DO is pH dependent. At pH > 6.0, DO almost completely abrogates DM function. At pH <6.0, the inhibition begins to decline; but even at the optimal pH 5.5–4.5 for DM function, DO still inhibits DM activity (17, 18). The findings on DO/H2-O raise a question: why do B cells express DM to facilitate Ag presentation, but at the same time express DO to inhibit DM function? Attempts to answer this question have been focused on DO function in relation to the primary function of B cells, i.e., Ab production. Production of Ag-specific high-affinity IgG Abs requires cognate T cell help. It has been postulated that DO may function to inhibit presentation of Ags acquired through non-BCR-mediated mechanisms such as pinocytosis, and as a result, B cells can preferentially present Ags captured through the BCR to specific T cells to avoid noncognate T cell help. Although appealing, this idea does not seem to be supported by recent studies. Using B cells from H2-O-deficient mice, it has been shown that H2-O may have very little impact on presentation of the exogenous Ags delivered through the fluid-phase uptake (23, 24). In this study, we report that, in addition to B cells, H2-O is also expressed in primary dendritic cells (DCs), and that its expression is differentially regulated in different DC subpopulations.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Mice

C57BL/6J, BALB/c, CBA/j, and 129/svj mice were purchased from The Jackson Laboratory. The H2-M–/– and H2-O–/– mice have been described previously (17). All mice were maintained following institutional guidelines.

Isolation of DCs

To make single-cell suspensions for flow cytometric analysis or DC isolation, spleens or lymph nodes were cut into small fragments and digested at 25°C for 30 min in an enzyme mixture containing 1.6 mg/ml collagenase, 0.2 mg/ml dispase, and 0.1% DNase. The separated cells were then washed and resuspended in Ca2+- and Mg2+-free PBS containing 2 mM EDTA and 0.5% BSA. DC isolation was performed either by positive or negative selection using the MACS separation system (Miltenyi Biotec), according to the manufacturer’s guidelines. Briefly, for positive sorting, the single-cell suspension was incubated with the appropriate amount of anti-CD11c Ab-conjugated magnetic microbeads on ice for 30 min. After washing, CD11c+ cells were isolated from the cell suspensions using an LS+ column (Miltenyi Biotec). For negative sorting, the cells were suspended in cold iso-osmotic Optiprep solution (Sigma-Aldrich) (25) (pH 7.2), d 1.061 g/cm3, containing 5 mM EDTA, and centrifuged at 1700 x g for 10 min. The low-density fraction was collected and further depleted of lineage+ cells with anti-CD19, CD3, and NK-1.1 beads using depletion columns (Miltenyi Biotec).

To generate bone marrow culture-derived DCs, RBC-lysed bone marrow cells were cultured in RPMI 1640 medium (with 10% FCS, 100 U/ml penicillin, and 100 U/ml streptomycin; Invitrogen Life Technologies) containing 10 ng/ml IL-4 and 10 ng/ml GM-CSF (PeproTech). At days 2 and 4, the nonadherent granulocytes were removed. To induce DC maturation, 100 ng/ml LPS was added to the culture 12 h before harvesting. The total culture time was 6 days. The phenotype of in vitro derived DCs was confirmed by flow cytometry before the cells were used for experiments.

Abs and flow cytometry

The anti-H2-O antiserum was generated by immunizing rabbit with the cytoplasmic tail peptide of the H2-O beta-chain, as was described previously (12). The staining of H2-O was revealed by anti-rabbit IgG PE (Southern Biotechnology Associates). The anti-CLIP Ab 30-2 was a gift from Dr. A. Y. Rudensky, the anti-H2-M mAb 2E5A (2C3A) was purchased from BD Pharmingen, and both Abs were biotinylated in this laboratory. Biotinylated Abs were revealed with either streptavidin-PE or streptavidin-allophycocyanin (BD Pharmingen). Fluorochrome-conjugated mAb were purchased from BD Pharmingen, including anti-CD11c FITC or PE or biotin, anti-B220 PerCP or allophycocyanin, anti-Gr-1 FITC, anti-CD40 PE, anti-CD80 PE, anti-CD8{alpha} PE or PerCP, anti-class II (M5/114) PE, as well as isotype-matched negative control mAbs. Cell surface staining was performed with a combination of each of the FITC-, PE-, PerCP-, biotin-, or allophycocyanin-labeled mAbs, according to the standard procedures. Intracellular staining was performed using CytoFix/CytoPerm (BD Pharmingen), according to the manufacturer’s instructions. In brief, cells were washed with 1% PBS-BSA after surface staining and fixed with CytoFix for 15 min at room temperature. Cells were then thoroughly washed with 1% PBS-BSA and incubated CytoPerm containing anti-H2-O/anti-H2-M Abs for 30 min at room temperature, followed by washing with 0.5% PBS-BSA. The specimens were analyzed on a FACSCalibur (BD Biosciences) using CellQuest software (BD Biosciences), as previously described (19). Dead cells were excluded by live gating of forward and side light scatter; typically, 50,000–100,000 events were collected of each sample.

Confocal microscopy

Purified CD11c+ cells were stained in suspension with anti-CD11c FITC, followed by intracellular staining with rabbit anti-H2-O serum, followed by anti-rabbit PE and anti-H2-M biotin, followed by streptavidin-allophycocyanin. After washing with 0.5% PBS-BSA, the cells were cytospun onto glass slides. Coverslips were mounted on glass slides on a film of antifade medium. The specimens were examined using x40 to x60 oil-immersion objective lens on a Zeiss 510 META laser-scanning confocal microscope.

Immunoprecipitation and Western blot analysis

Spleen cells, purified primary DCs, or bone marrow culture-derived DCs (5–10 x 106) were lysed in 0.25 ml of lysis buffer (PBS, 1% CHAPS) containing a complete protease inhibitor mixture (Roche) for 30–40 min. After clarification by centrifugation for 10 min at 14,000 rpm, lysates were incubated with anti-H2-O antiserum (3 µl/sample) for 90 min on a rotating platform at 4°C, followed by incubation with 60 µl of protein A-Sepharose (Amersham Biosciences) for 1 h. Protein A-Sepharose pellets were then washed six times at 4°C with washing buffer (PBS, 0.5% CHAPS) and boiled in 30 µl of Laemmli buffer, followed by SDS-PAGE. Blotting was performed using a nitrocellulose membrane and was stained with anti-H2-O serum, followed by HRP anti-rabbit IgG (Amersham Biosciences). The membrane was developed with a chemofluorescence kit (Amersham Biosciences).

Northern blot experiments

Northern blot analysis was performed on total RNA isolated from either total spleen cells, or purified primary or culture-derived DCs using TRIzol (Invitrogen Life Technologies), according to the manufacturer’s instruction. Electrophoresis of 5 µg of RNA per lane of each specimen was followed by capillary transfer of RNA onto nylon membranes that were subsequently treated with a UV cross-linker. The H2-Ob cDNA probe was generated through RT-PCR using total B6 spleen RNA as a template with the following primer pair, each of which anneals to the 5' or the 3' end of the coding region of the H2-Ob gene, respectively: ATGGGCGCTGGGAGGGCCCCTGGGTGGTG and CTAGGGTTGAGAATGGAGACTCTCTCTTGA. The probe was labeled using digoxigenin-PCR labeling kits (Roche), following the manufacturer’s manual. Hybridization was performed at 60°C overnight. High stringency washing was followed by blocking and subsequent incubation of the membrane with HRP anti-digoxigenin Ab (Roche). The membrane was developed using the chemofluorescence kits (Roche).

Ag presentation assay

T cell hybridoma cells (2 x 105) were incubated with 2 x 105 purified DCs in the presence of serially diluted concentrations of protein Ags, hen egg lysozyme (HEL), or beef insulin. The culture was maintained overnight. IL-2 in the supernatant was measured by a europium-based fluorescence immunoassay (26) using JES6-1A12 and biotinylated JES6-5H4 anti-IL-2 mAb (BD Pharmingen), and results are reported as fluorescence counts per second. Data shown represent one of the two to three similar experiments.

Mixed lymphocyte reaction

T cells from B6, BALB/c, CBA/j, and 129/vj mice were enriched by passing the spleen cells through nylon wool, or purified by negative sorting using magnetic beads and the MACS separation system (Miltenyi Biotec). For CFSE labeling, T cells were incubated with 10 µM CFSE (Molecular Probes) for 10 min at room temperature, followed by multiple washes with 10% FCS in complete RPMI 1640 medium. The T cells were cultured at 5 x 105 cells/well with purified, 2000-rad irradiated DCs at decreasing number, starting at 2 x 105 in the first well. The cultures were maintained for 72 h, and 25 µCi of [3H]thymidine/well was added 18 h before harvesting. The 96-well culture plates were read on a Matrix 96 Direct beta counter (Packard Instrument). Data shown represent one of two to three similar experiments. The proliferation of the CFSE-labeled T cells was analyzed by flow cytometry after staining with anti-CD4 and anti-CD8 Abs.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Primary DCs express H2-O

In previous studies, examination of H2-O expression in primary DCs was performed using immunofluorescence microscopy as the primary tool (12). Histological structures, such as the lymphoid follicles, marginal zones, and periarteriolar sheaths, were used as a means to identify B cells, macrophages, and DCs, according to their location. Because the frequency of primary DCs present in spleens and lymph nodes is very low relative to the number of B cells, immunofluorescence microscopy might not be optimal to detect H2-O expression in primary DCs. In the current study, as an alternate technical approach, we used multicolor flow cytometry combined with multistepped surface and intracellular staining and cell sorting in our initial analysis. Total spleen cells were first stained for surface markers, followed by intracellular staining for H2-O and H2-M, and analyzed by flow cytometry. As shown in Fig. 1, analysis of B6 spleens (as well as lymph nodes and thymus) of different mouse strains revealed the expression of H2-O not only in B cells, but also in CD11c+ DCs (Fig. 1A). In contrast, H2-O was not detected in either DCs or B cells from the H2-O–/– or H2-M–/– mice that served as negative controls (Fig. 1, C and E). The lack of H2-O staining in the H2-O–/– DCs indicates that the H2-O staining detected in the wild-type (WT) DCs is specific. The failure to detect H2-O in the DCs of the H2-M–/– mice suggests that the expression of H2-O in DCs, as in B lymphocytes, depends on expression of H2-M.


Figure 1
View larger version (69K):
[in this window]
[in a new window]
  		FIGURE 1. Identification of H2-O expression in splenic DCs by flow cytometry analysis. Spleen cells from C57BL/6 (A and B), H2-O knockout (C and D), and H2-M knockout (E and F) mice were analyzed for H2-O and H2-M expression in DCs (CD11c+) and B cells (CD11c–) after surface and intracellular staining. Positive H2-O staining was detected only in the DCs and B cells of B6 mice.

 
Because our finding of H2-O expression in primary DCs contradicted the current paradigm that DCs do not express H2-O, we further validated our observations using other experimental approaches. To this end, CD11c+ cells sorted from the spleens of the B6 mice as well as H2-O- and H2-M-deficient mice were examined by confocal microscopy for the expression of H2-O and H2-M. As shown in Fig. 2, positive H2-O staining was observed only in the WT B6 CD11c+ DCs, but not in the DCs isolated from either the H2-O- or H2-M-deficient mice. The H2-O staining was visualized as intracellular granules that colocalized with the staining of H2-M, further confirming the close association of the two proteins in DCs. For Western blot experiments, DCs were purified by density-gradient centrifugation, followed by depletion of lineage+ cells, particularly B cells, yielding the DC preparations with minimum B cell contamination (Fig. 3A). Blotting with the anti-H2-Obeta antiserum in Western blots demonstrated a protein band of the expected molecular mass of 32 kDa in the protein extract of the WT B6 DCs, but not of the H2-O–/– DCs (Fig. 3B).


Figure 2
View larger version (53K):
[in this window]
[in a new window]
  		FIGURE 2. Identification of H2-O expression in splenic DCs by confocal microscopy. Splenic CD11c+ DCs purified from C57BL/6 (A–D), H2-O knockout (E–H), and H2-M knockout (I–L) mice were costained with anti-CD11c (green), H2-O (red), and H2-M (blue). Positive H2-O staining was identified only in the CD11c+ cells of B6 mice (B), but not that of H2-O–/– or H2-M–/– mice (G and K). The H2-O staining in the B6 DC colocalized with that of H2-M (C and D).

 

Figure 3
View larger version (61K):
[in this window]
[in a new window]
  		FIGURE 3. Identification of H2-O expression in splenic DCs by Western blots. A, CD11c+ cells were isolated from spleens of B6 or H2-O–/– mice. The purity of sorted splenic DCs was confirmed by flow cytometry. B, Western blot experiments with anti-H2-O serum identified a protein band of ~32 kDa in the lysate of the B6, but not H2-O–/– DCs. Total B6 spleen lysate was included as a positive control.

 
To examine H2-O expression at the transcription level, we performed Northern blots instead of RT-PCR to detect H2-O transcripts to eliminate the possibility of obtaining false positive results that might be derived from trace contamination with B cells in the specimens. H2-Ob rather than H2-Oa cDNA was used as probe in Northern blots because expression of the H2-Oa gene was found to be regulated through CIITA in a manner similar to the H2-M genes (27). The purity of isolated splenic DCs was analyzed by flow cytometry (Fig. 4A); hybridization was performed at high stringency. As shown in Fig. 4B, multiple H2-Ob transcripts were detected in the RNA prepared from purified DCs in addition to the positive control total spleen cells, but not in the RNA of a negative control T cell hybridoma. Interestingly, the number and size of the H2-Ob transcripts identified in the DCs were similar to that of the total spleen cells that mostly reflect the dominant B cell component. The presence of multi-H2-Ob RNA transcripts with different molecular weights was reported in B cells in previous studies (28), and those transcripts represented different RNA-splicing intermediates of the primary H2-Ob transcript. The similarity in H2-Ob transcripts between DCs and B cells suggests that processing of H2-O RNA in the two cell types might be similar.


Figure 4
View larger version (82K):
[in this window]
[in a new window]
  		FIGURE 4. Identification of H2-O expression in splenic DC by Northern blot analysis. A, CD11c+ cells were isolated from B6 spleens. The purity of DC preparation was evaluated by flow cytometry. B, Hybridization under high stringency using the H2-Ob cDNA as probe revealed H2-Ob transcripts in DCs, but not in T hybridomas DO11.10. The same blot was rehybridized with beta-actin cDNA for loading controls.

 
Taken together, our findings indicate that H2-O expression is active in primary DCs and its expression is associated with the expression of H2-M. These results suggest the possibility that H2-O regulates the function of H2-M in DCs as well as in B cells.

Primary bone marrow DCs express H2-M, but not H2-O

We and others recently reported that HLA-DO expression in B cells is not static, but regulated throughout B cell development/maturation and activation (19, 29). To determine whether H2-O expression in DCs is dynamic, we studied H2-O expression in bone marrow DCs. As revealed by flow cytometry, CD11c+ DCs in the bone marrow constitute ~5% of the cells in lymphocyte gate (Fig. 5). Distinct from the DCs of the other lymphoid organs in which the DC population is heterogeneous, containing different DC subsets (30, 31), primary bone marrow DCs were relatively homogeneous, almost uniformly expressing B220+ (Figs. 5A and 6, top panel), the phenotypic marker characteristic of plasmacytoid DCs (pDCs) (32, 33, 34, 35). Compared with the CD11chigh/B220– splenic myeloid DCs (mDCs), bone marrow DCs expressed almost no or minimum level of CD40, CD80 (B7-1), and CD86 (B7-2) (Fig. 5, D–F), despite the fact that they expressed a moderate to low level of MHC class II (Fig. 5B). To determine the level of H2-O and H2-M expression in bone marrow DCs, B cells present in the same bone marrow specimens were used as a positive control, and bone marrow DCs from H2-O- and H2-M-deficient mice as negative controls. As shown in Fig. 6, no or near background level of expression of H2-O was detected by flow cytometry in WT bone marrow DCs as compared with DCs of H2-O knockout mice. Despite lack of H2-O expression, an intermediate level of H2-M expression was identified in the WT bone marrow DCs as compared with that of the DCs from H2-M–/– mice and the B cells present in the WT bone marrow specimens (Fig. 6). The presence of H2-M activity was functionally indicated by lack of CLIP on the surface of the WT bone marrow DCs or on DCs of H2-O–/– mice when compared with a high level of CLIP detected on bone marrow DCs from H2-M–/– mice. These results indicate that bone marrow DCs selectively express MHC class II and H2-M, but not H2-O. Although expressed at a moderate level, the H2-M activity present in bone marrow DCs in the absence of H2-O was sufficient to catalyze the removal of CLIP and loading of non-CLIP self-peptides onto class II molecules before the MHC class II were expressed on the cell surface. Therefore, despite the immature phenotype, as manifested by lack of expression of CD40 and costimulatory molecules, bone marrow DCs appear to be capable of processing and presenting Ags. The selective expression of H2-M and MHC class II without H2-O may facilitate presentation of self-Ags.


Figure 5
View larger version (59K):
[in this window]
[in a new window]
  		FIGURE 5. Flow cytometry analysis of B6 bone marrow DCs. A–C, Dot plot display of the B6 bone marrow DCs to illustrate expression of B220, MHC class II, and CD40. D–F, Comparison of expression of CD40, CD80, and CD86 between primary bone marrow DCs (blue shaded histograms) and splenic mDCs (green line histograms).

 

Figure 6
View larger version (60K):
[in this window]
[in a new window]
  		FIGURE 6. Flow cytometry analysis of H2-M and H2-O expression in bone marrow DCs. Bone marrow DCs of the H2-M–/–, B6, and H2-O–/– mice were gated in (top panel) and displayed on overlay histograms (lower panel) to compare the expression of H2-M, H2-O, and CLIP. Note that in Fig. 2, A and C, the green histograms represent bone marrow B cells. In Fig. 2B, the green histogram represents the H2-M–/– DCs.

 
Differential expression of H2-O in different DC subsets

DCs in the peripheral lymphoid organs are known to be heterogeneous, consisting of distinct subsets. Although the origin and classification of the DC subsets remain controversial, some DCs clearly exhibit different functional properties from the others. Although pDCs have a marked ability to produce high levels of type I IFN in response to stimulation, mDCs do not (32, 33, 36); likewise, CD8{alpha}+ DCs are more capable of cross presenting exogenous protein Ags to CD8+ T cells than DC8{alpha}– DCs (37, 38). To compare H2-O expression between these DC subsets, CD11c+ DCs were gated based on their expression of B220 or CD8{alpha} and analyzed for H2-O and H2-M expression. As shown in Fig. 7, while CD11chigh/B220– mDCs express both H2-M and H2-O, pDCs (CD11cintermediate/B220+) express only H2-M, but almost no H2-O. In CD8{alpha}+ DCs, the level of H2-O expression was slightly higher than in the DC8{alpha}– DCs, despite a level of H2-M expression being slightly lower in the former compared with the latter (lower panel). Although small, these differences were consistently observed in all of the experiments.


Figure 7
View larger version (54K):
[in this window]
[in a new window]
  		FIGURE 7. Flow cytometry analysis of H2-O expression in different splenic DC subsets. Top panel, CD11c+/B220+ pDCs (blue), CD11c+/B220– mDCs (green), and CD11c–/B220+ B cells (pink) were gated and displayed on overlay histograms to compare the level of H2-O and H2-M expression. Lower panel, CD11c+/CD8{alpha}+ DC (blue) and CD11c+/CD8{alpha}– DCs (green) were gated in and displayed on overlay histograms to compare the level of H2-O and H2-M expression. The negative controls were H2-O–/– and H2-M–/– DCs.

 
To follow H2-O expression during DC activation in vivo, mice were injected i.v. with LPS or saline. Twelve hours postinjection, splenic DCs were examined for evidence of activation. Compared with the saline-injected controls, the mDCs, but not the pDCs, in the LPS-injected group showed phenotypic changes consistent with cell activation, as indicated by the up-regulation of CD86, MHC class II, and CD40 expression (Fig. 8). Associated with activation, the level of H2-O was down-regulated, while the level of H2-M remained unchanged or slightly decreased. The selective activation of the mDC, but not the pDC, by LPS administration is consistent with previous observations that pDCs do not express TLR4 and thus are insensitive to in vitro LPS stimulation (36).


Figure 8
View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 8. Flow cytometry analysis of the phenotypic changes of the splenic mDCs vs pDCs in response to in vivo administration of LPS. The in vivo administration of LPS activated the mDCs, but not pDCs, as judged by the elevation in the level of CD86, I-Ab, and CD40 in the former, but not the latter. The activation of mDCs is associated with down-regulation of H2-O expression with a minimum reduction in H2-M expression.

 
Bone marrow culture-derived DCs have been the major source of DCs for laboratory studies, although their origin and relationship to primary DCs remain unclear. We generated bone marrow culture-derived DCs by following a standard protocol using GM-CFS plus IL-4 (39). Flow cytometric analysis of day 6 cultures revealed that the bone marrow culture-derived DCs expressed CD11c, MHC class II, and H2-M. However, no H2-O expression was detected by flow cytometry, except occasionally a minimal/marginal staining against H2-O–/– DCs was observed (Fig. 9A). By Western and Northern blots, no H2-O beta-chain or the H2-Ob transcripts were detected (Fig. 9, B and C). To determine whether the lack of H2-O expression was due to immaturity of the cells, DCs were induced to mature by adding LPS to the cultures. Maturation was confirmed using flow cytometry by identification of an increase in the level of class II (I-Ab) and CD86 expression. The LPS-induced maturation, however, did not induce H2-O expression in the bone marrow culture-derived DCs, as revealed by flow cytometry and Western blot analyses (Fig. 9, A and B). Because activation of splenic mDCs was associated with down-regulation of H2-O expression (Fig. 8), it was possible that lack of H2-O expression in bone marrow culture-derived DCs was due to cellular activation. To rule out this possibility, we examined H2-O transcription in bone marrow culture-derived DCs, because loss of DO expression during B cell activation in germinal center reactions is not associated with down-regulation of H2-O transcription (29) (our unpublished data). No H2-Ob transcripts were detected by Northern blot experiments in either the immature or the mature culture-derived DCs (Fig. 9C). These results indicate that lack of H2-O expression in bone marrow culture-derived DCs was not due to activation-induced down-regulation of the H2-O expression at the protein level, but most likely due to lack of transcriptional activity of the H2-O gene. Lack of H2-O expression in bone marrow culture-derived DCs is reminiscent of the monocyte-derived DCs that were found to lack DO expression (19), suggesting that bone marrow culture-derived DCs are more related to monocyte-derived DCs than to primary mDCs.


Figure 9
View larger version (42K):
[in this window]
[in a new window]
  		FIGURE 9. Flow cytometry analysis of H2-M and H2-O expression in the GM-CSF plus IL-4-conditioned bone marrow culture-derived DCs. A, Top panel, Histogram comparison of bone marrow culture-derived immature (solid line) and mature (shaded histogram) DCs for the level of expression of CD11c, I-Ab, and B7.2. Lower panel, Histogram comparison of H2-M and H2-O expression in the immature (solid line) and mature (shaded) bone morrow culture-derived DCs. The negative controls were the H2-M- or H2-O-deficient DCs, respectively. B, Western blot analysis of H2-O expression in the immature (BMDC (I)) and mature (BMDC (M)) bone marrow culture-derived DC. C, Northern blot analysis of H2-Ob gene expression in the immature and mature bone marrow culture-derived DC.

 
The impact of H2-O expression on DCs’ ability to present Ags

The biological function of H2-O in B lymphocytes remains unclear. To determine whether H2-O expression has impact on Ag presentation function of DCs, we compared H2-O–/– and WT (B6) DCs for their ability to present exogenous protein Ags to T cell hybridomas. Hybridoma Hb46.13 and HJ044 are specific for HEL-derived peptide epitopes, and 40i and B1A4 have specificity for A and B chain epitopes in beef insulin, respectively. As shown in Fig. 10A, the WT and H2-O-deficient DCs present these Ags to T cell hybridomas with similar efficiency. By comparison, Ag presentation function was almost completely absent in H2-M–/– DCs. These results indicate that although H2-M is required for efficient Ag presentation to occur, expression of H2-O does not appear to alter the ability of the DCs to present exogenous Ags. These observations are similar to findings made in previous studies indicating that H2-O-deficient and WT B cells present equally well exogenous Ags that are internalized through fluid-phase uptake (23, 24).


Figure 10
View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 10. A, Ag presentation assay. IL-2 production by the T cell hybridomas in response to HEL or beef insulin (BINS) presented by the H2-O–/– and B6 DCs. Hybridomas Hb46.13 and HJ044 are specific for the HEL-derived peptides, and 40i and B1A4 are specific for beef insulin {alpha}- or beta-chain-derived peptides, respectively. Each plotted value represents the average of triplicate values. B, MLR. Allogeneic T cells (5 x 105 cells/well) from four different mouse strains were cultured with the indicated number of splenic DCs from the B6, H2-O–/–, and H2-M–/– mice. T cell proliferation was measured by [3H]thymidine incorporation. C, Flow cytometry analysis of MLR. BALB/c T cells labeled with CFSE were cultured with B6 or H2-O–/– DCs, as in B. T cell proliferation was analyzed on culture day 3.

 
To evaluate their ability to induce MLR, H2-O–/– and WT DCs were used as APCs to stimulate various responder T populations. T cell proliferation was initially measured by thymidine incorporation. As shown in Fig. 10B, H2-O-deficient DCs induced stronger proliferation of allogeneic T cells as compared with WT DCs, for the three different allogeneic responder genotypes tested. This includes 129/svj T cells, which express the H-2b MHC haplotype. By contrast, no response was observed in cultures with B6 responder T cells. Little or no T cell proliferation was induced by H2-M–/– DCs, reflecting the very limited diversity of class II MHC-bound peptides presented in the absence of H2-M. In H2-M-deficient H-2b mice, surface I-Ab molecules are almost exclusively loaded with CLIP (8, 9, 10, 11).

To determine whether it was CD4+ or CD8+ T cells that contributed to the overall enhanced T cell proliferation induced by H2-O–/– DCs, allogeneic BALB/c responder T cells were labeled with the fluorescent dye CFSE before MLR. The division of CD4 or CD8 T cells was determined by dilution of CFSE as measured by flow cytometry. As shown in Fig. 10C, the proliferation of the CD8+ T cells induced by either source of DCs was similar, with ~16% of CD8+ T cells having undergone division by the time the assay was performed. By contrast, a great fraction of CD4+ T cells proliferated in response to H2-O–/– DCs (35%) as compared with WT DCs (22%) (Fig. 10C). These results indicate that the enhanced level of thymidine incorporation induced by H2-O–/– DCs was contributed primarily by increased CD4+ rather than CD8+ T cell proliferation, suggesting H2-O expression alters presentation of allo-Ags by MHC class II, but not the class I pathway.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
The results presented in this study demonstrate unequivocally that H2-O is expressed in primary DCs as well as B cells. Protein expression was demonstrated by intracellular flow cytometry, Western blotting, and confocal microscopy; H2-Ob mRNA expression was demonstrated by Northern blotting with highly purified DCs. Our findings conflict with previous reports suggesting that H2-O is expressed only in B lymphocytes and thymic medullary epithelial cells, but not in DCs (12, 13, 14, 21, 40, 41, 42). We believe that this discrepancy results from differences in technical approaches. Techniques such as multistepped surface and intracellular staining in conjunction with multicolor flow cytometry and refined cell sorting provide very specific, yet sensitive methods for evaluating H2-O expression in primary DCs, despite their low frequency in lymphoid tissues. In addition, it is clear that, by the same experimental approach, murine bone marrow culture-derived DCs are found negative for H2-O. Because Northern blotting is more specific, but can be less sensitive compared with RT-PCR, it is possible this technique may fail to pick up very weak H2-Ob signals. Nevertheless, using the same techniques, we found that bone marrow culture-derived DCs were similar to human monocyte culture-derived DCs (19). Culture-derived DCs have been used extensively to study the cell biology and function of DCs. It is clear that these cells differ significantly from primary DCs, at least with respect to expression of H2-O.

Our results demonstrate that H2-O is differentially expressed in DC subpopulations and provide evidence that expression is modulated during DC development/activation. The highest expression levels of both H2-O and H2-M are observed in mDCs from spleen and lymph node. Indeed, greater expression is observed in mDCs than in B cells. In vivo exposure to LPS induces activation of mDCs that is accompanied by a selective reduction in H2-O expression with only a slight reduction in H2-M at the time points examined. This parallels previous findings demonstrating that B cells selectively down-modulate H2-O (HLA-DO) during in vivo activation and differentiation into germinal center cells (19). The H2-O to H2-M ratio is higher in CD8{alpha}+ DCs as compared with CD8{alpha}– DCs by intracellular flow cytometry. Primary bone marrow DCs, which have a phenotype similar to pDCs (CD11cintermediate and B220+ (32, 33, 34)) and peripheral pDCs, express low to moderate levels of H2-M, but no H2-O, within the sensitivity of our assay.

The origin of distinct DC subsets has been the subject of considerable debate; a definitive mode of mouse DC development remains to be established (43, 44). Our current finding of differential H2-O expression in different DC subsets is consistent with a recent report that MHC class II expression is differentially regulated in pDCs and conventional DCs (45). Both primary bone marrow DCs and peripheral pDCs express MHC class II molecules and H2-M, but they do not express the negative regulator H2-O. In addition, these cells lack expression of CD40 and the costimulatory molecules CD80 and CD86. The importance of MHC class II and H2-M expression in bone marrow DCs, as well as in immature B-lineage cells (19), is not understood, but expression of these molecules is not required for the development of either DCs or B cells. In the absence of MHC class II or H2-M expression, both DCs and B cells developed normally (8, 9, 10, 46, 47, 48). CD40 expression is required for APCs to provide sustained positive stimulation to T cells (49, 50). CD40-deficient DCs not only prevent priming of immunity, but also suppress previously primed immune responses by inducing regulatory T cells (51). Similarly, the expression of B7 molecules on DCs is required to initiate T cell priming, despite the fact that costimulatory molecules have also been shown to play a role in T cell suppression (52, 53). Given the absence of expression of CD40 and costimulatory molecules, we postulate that bone marrow and splenic/lymph node pDCs are tolerogenic. In preliminary experiments using primary bone marrow DCs to present Ags in vitro to TCR-transgenic T cells (OT-II or DO11.10), we were able to generate T cells with regulatory properties (data not shown), as has been reported for pDCs in other locations (54, 55).

Why is H2-O expressed in mDCs, but not in putatively tolerogenic bone marrow DCs and pDCs? H2-O has been demonstrated to be a negative regulator of H2-M catalytic activity. Thus, it is likely to modulate H2-M peptide-editing function and the repertoire of self-peptides that are presented by cell surface MHC class II molecules. The idea that H2-O influences the repertoire of class II-bound peptides is supported by our results with MLR assays. Purified spleen DCs from H2-O-deficient mice consistently stimulated stronger MLR responses as compared with WT DCs from B6 mice. This was seen with fully allogeneic responder T cells and with H-2b-matched 129/vj T cells. This is not a consequence of a general increase in the potency of H2-O–/– DCs in stimulating T cells because increased proliferation was only observed in the CD4+ T cell subpopulation and not in CD8+ T cells. The simplest interpretation is that H2-O modifies the repertoire of endogenous peptides presented by MHC class II, but not class I molecules, consistent with the known function of H2-O as an inhibitor of H2-M-mediated peptide exchange in class II molecules. We note, however, that H2-O–/– DCs did not stimulate primary MLR responses with syngeneic WT B6 T cells. Thus, T cells from H2-O-expressing B6 mice appear to be tolerant to any endogenous peptides that are selectively expressed on H2-O-deficient DCs. This makes sense if we assume that H2-O-negative APC subpopulations, including pDCs and bone marrow DCs, are involved in tolerance induction in WT B6 mice.

It is somewhat surprising that H2-O–/– DCs should stimulate stronger MLRs than their H2-O+/+ counterparts. This might reflect a greater diversity of endogenous peptides presented by H2-O-deficient DCs as compared with WT. If one assumes that H2-M-editing function reduces the diversity of peptide complexes that reach the cell surface by editing unstable complexes, one might expect that enhanced H2-M activity in the absence of the H2-O inhibitor would lead to a reduced diversity of presented peptides, and a reduced potency in stimulating alloreactive T cells. It is possible that H2-O actually reduces the diversity of self-peptides that are presented by class II molecules, by attenuating H2-M peptide-loading activity. Further investigation of these possibilities will require direct biochemical analysis of the impact of H2-O on class II-associated peptides in DCs.

The function of H2-O expressed in primary DC subpopulations resident in secondary lymphoid organs remains an open question. We observed no consistent difference in the capacity of H2-O–/– and WT splenic DCs to present soluble protein Ags to T cell hybridomas. Thus, H2-O does not appear to have a general effect in attenuating Ag presentation activity. It remains possible that it modifies a specific Ag-processing pathway, for example presentation mediated through receptor-mediated Ag internalization. However, even in B cells, in which H2-O function has been studied extensively, no consistent impact on the presentation of exogenous Ags has been demonstrated (23, 24). Perhaps the major role of H2-O is to modulate the repertoire of self-peptides that are presented by tolerogenic or immunogenic APCs. Primary mDCs and CD8+ DCs resident in secondary lymphoid organs appear to be reasonably potent T cell stimulators. H2-O-mediated attenuation of the repertoire of self-peptides displayed on these cells may help to reduce the chance of activating autoreactive T cells, which have been shown to be present in the normal repertoire (56, 57, 58, 59). Under conditions in which DCs are further activated by LPS or other stimuli, the attenuating function of H2-O may no longer be needed because activated DCs are short-lived and rapidly eliminated (60).

Although it is evident that the biological role of H2-O remains very much in question, the current results must be considered as we evaluate new hypotheses regarding the function of this enigmatic MHC molecule. The assumption that H2-O is expressed exclusively in B cells in secondary lymphoid organs has led to models for H2-O functioning as a selective modulator of humoral immunity through its impact on Ag presentation by B cells. The present findings indicate that H2-O has a broader role in immunity, modulating the function of DCs as well as B cells and epithelial cell populations in the thymus.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants AI52269 (to X.C.) and AI30554 and AI33614 (to P.E.J.). Back

2 Address correspondence and reprint requests to Drs. Peter E. Jensen or Xinjian Chen, University of Utah, Department of Pathology, School of Medicine, 5C124, 30 North 1900 East, Salt Lake City, UT 84132. E-mail address: peter.jensen{at}path.utah.edu or xinjian.chen{at}path.utah.edu Back

3 Abbreviations used in this paper: Ii, invariant chain; DC, dendritic cell; HEL, hen egg lysozyme; mDC, myeloid DC; pDC, plasmacytoid DC; WT, wild type. Back

Received for publication September 2, 2005. Accepted for publication January 5, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Cresswell, P.. 1996. Invariant chain structure and MHC class II function. Cell 84: 505-507. [Medline]
  2. Jensen, P. E., D. A. Weber, W. P. Thayer, X. Chen, C. T. Dao. 1999. HLA-DM and the MHC class II antigen presentation pathway. Immunol. Res. 20: 195-205. [Medline]
  3. Morris, P., J. Shaman, M. Attaya, M. Amaya, S. Goodman, C. Bergman, J. J. Monaco, E. Mellins. 1994. An essential role for HLA-DM in antigen presentation by class II major histocompatibility molecules. Nature 368: 551-554. [Medline]
  4. Sloan, V. S., P. Cameron, G. Porter, M. Gammon, M. Amaya, E. Mellins, D. M. Zaller. 1995. Mediation by HLA-DM of dissociation of peptides from HLA-DR. Nature 375: 802-806. [Medline]
  5. Sherman, M. A., D. A. Weber, P. E. Jensen. 1995. DM enhances peptide binding to class II MHC by release of invariant chain-derived peptide. Immunity 3: 197-205. [Medline]
  6. Denzin, L. K., P. Cresswell. 1995. HLA-DM induces CLIP dissociation from MHC class II {alpha}beta dimers and facilitates peptide loading. Cell 82: 155-165. [Medline]
  7. Weber, D. A., B. D. Evavold, P. E. Jensen. 1996. Enhanced dissociation of HLA-DR-bound peptides in the presence of HLA-DM. Science 274: 618-620. [Abstract/Free Full Text]
  8. Martin, W. D., G. G. Hicks, S. K. Mendiratta, H. I. Leva, H. E. Ruley, L. Van Kaer. 1996. H2-M mutant mice are defective in the peptide loading of class II molecules, antigen presentation, and T cell repertoire selection. Cell 84: 543-550. [Medline]
  9. Miyazaki, T., P. Wolf, S. Tourne, C. Waltzinger, A. Dierich, N. Barois, H. Ploegh, C. Benoist, D. Mathis. 1996. Mice lacking H2-M complexes, enigmatic elements of the MHC class II peptide-loading pathway. Cell 84: 531-541. [Medline]
  10. Fung-Leung, W. P., C. D. Surh, M. Liljedahl, J. Pang, D. Leturcq, P. A. Peterson, S. R. Webb, L. Karlsson. 1996. Antigen presentation and T cell development in H2-M-deficient mice. Science 271: 1278-1281. [Abstract]
  11. Van Ham, S. M., U. Gruneberg, G. Malcherek, I. Broker, A. Melms, J. Trowsdale. 1996. Human histocompatibility leukocyte antigen (HLA)-DM edits peptides presented by HLA-DR according to their ligand binding motifs. J. Exp. Med. 184: 2019-2024. [Abstract/Free Full Text]
  12. Karlsson, L., C. D. Surh, J. Sprent, P. A. Peterson. 1991. A novel class II MHC molecule with unusual tissue distribution. Nature 351: 485-488. [Medline]
  13. Liljedahl, M., T. Kuwana, W. P. Fung-Leung, M. R. Jackson, P. A. Peterson, L. Karlsson. 1996. HLA-DO is a lysosomal resident which requires association with HLA-DM for efficient intracellular transport. EMBO J. 15: 4817-4824. [Medline]
  14. Douek, D. C., D. M. Altmann. 1997. HLA-DO is an intracellular class II molecule with distinctive thymic expression. Int. Immunol. 9: 355-364. [Abstract/Free Full Text]
  15. Denzin, L. K., D. B. Sant’Angelo, C. Hammond, M. J. Surman, P. Cresswell. 1997. Negative regulation by HLA-DO of MHC class II-restricted antigen processing. Science 278: 106-109. [Abstract/Free Full Text]
  16. Van Ham, S. M., E. P. Tjin, B. F. Lillemeier, U. Gruneberg, K. E. van Meijgaarden, L. Pastoors, D. Verwoerd, A. Tulp, B. Canas, D. Rahman, et al 1997. HLA-DO is a negative modulator of HLA-DM-mediated MHC class II peptide loading. Curr. Biol. 7: 950-957. [Medline]
  17. Liljedahl, M., O. Winqvist, C. D. Surh, P. Wong, K. Ngo, L. Teyton, P. A. Peterson, A. Brunmark, A. Y. Rudensky, W. P. Fung-Leung, L. Karlsson. 1998. Altered antigen presentation in mice lacking H2-O. Immunity 8: 233-243. [Medline]
  18. Van Ham, M., M. van Lith, B. Lillemeier, E. Tjin, U. Gruneberg, D. Rahman, L. Pastoors, K. van Meijgaarden, C. Roucard, J. Trowsdale, et al 2000. Modulation of the major histocompatibility complex class II-associated peptide repertoire by human histocompatibility leukocyte antigen (HLA)-DO. J. Exp. Med. 191: 1127-1136. [Abstract/Free Full Text]
  19. Chen, X., O. Laur, T. Kambayashi, S. Li, R. A. Bray, D. A. Weber, L. Karlsson, P. E. Jensen. 2002. Regulated expression of human histocompatibility leukocyte antigen (HLA)-DO during antigen-dependent and antigen-independent phases of B cell development. J. Exp. Med. 195: 1053-1062. [Abstract/Free Full Text]
  20. Brocke, P., E. Armandola, N. Garbi, G. J. Hammerling. 2003. Down-modulation of antigen presentation by H2-O in B cell lines and primary B lymphocytes. Eur. J. Immunol. 33: 411-421. [Medline]
  21. Fallas, L. J., H. M. Tobin, O. Lou, D. Guo, D. B. Sant’Angelo, L. K. Denzin. 2004. Ectopic expression of HLA-DO in mouse dendritic cells diminishes MHC class II antigen presentation. J. Immunol. 173: 1549-1560. [Abstract/Free Full Text]
  22. Kropshofer, H., A. B. Vogt, C. Thery, E. A. Armandola, B. C. Li, G. Moldenhauer, S. Amigorena, G. J. Hammerling. 1998. A role for HLA-DO as a co-chaperone of HLA-DM in peptide loading of MHC class II molecules. EMBO J. 17: 2971-2981. [Medline]
  23. Perraudeau, M., P. R. Taylor, H. J. Stauss, R. Lindstedt, A. E. Bygrave, D. J. Pappin, S. Ellmerich, A. Whitten, D. Rahman, B. Canas, et al 2000. Altered major histocompatibility complex class II peptide loading in H2-O-deficient mice. Eur. J. Immunol. 30: 2871-2880. [Medline]
  24. Alfonso, C., G. S. Williams, J. O. Han, J. A. Westberg, O. Winqvist, L. Karlsson. 2003. Analysis of H2-O influence on antigen presentation by B cells. J. Immunol. 171: 2331-2337. [Abstract/Free Full Text]
  25. Radtke, F., I. Ferrero, A. Wilson, R. Lees, M. Aguet, H. R. MacDonald. 2000. Notch1 deficiency dissociates the intrathymic development of dendritic cells and T cells. J. Exp. Med. 191: 1085-1094. [Abstract/Free Full Text]
  26. Tompkins, S. M., P. A. Rota, J. C. Moore, P. E. Jensen. 1993. A europium fluoroimmunoassay for measuring binding of antigen to class II MHC glycoproteins. J. Immunol. Methods 163: 209-216. [Medline]
  27. Taxman, D. J., D. E. Cressman, J. P. Ting. 2000. Identification of class II transcriptional activator-induced genes by representational difference analysis: discoordinate regulation of the DN {alpha}/DO beta heterodimer. J. Immunol. 165: 1410-1416. [Abstract/Free Full Text]
  28. Larhammar, D., U. Hammerling, L. Rask, P. A. Peterson. 1985. Sequence of gene and cDNA encoding murine major histocompatibility complex class II gene A beta2. J. Biol. Chem. 260: 14111-14119. [Abstract/Free Full Text]
  29. Glazier, K. S., S. B. Hake, H. M. Tobin, A. Chadburn, E. J. Schattner, L. K. Denzin. 2002. Germinal center B cells regulate their capability to present antigen by modulation of HLA-DO. J. Exp. Med. 195: 1063-1069. [Abstract/Free Full Text]
  30. Vremec, D., K. Shortman. 1997. Dendritic cell subtypes in mouse lymphoid organs: cross-correlation of surface markers, changes with incubation, and differences among thymus, spleen, and lymph nodes. J. Immunol. 159: 565-573. [Abstract]
  31. Shortman, K., Y. J. Liu. 2002. Mouse and human dendritic cell subtypes. Nat. Rev. Immunol. 2: 151-161. [Medline]
  32. Asselin-Paturel, C., A. Boonstra, M. Dalod, I. Durand, N. Yessaad, C. Dezutter-Dambuyant, A. Vicari, A. O’Garra, C. Biron, F. Briere, G. Trinchieri. 2001. Mouse type I IFN-producing cells are immature APCs with plasmacytoid morphology. Nat. Immunol. 2: 1144-1150. [Medline]
  33. Nakano, H., M. Yanagita, M. D. Gunn. 2001. CD11c+B220+Gr-1+ cells in mouse lymph nodes and spleen display characteristics of plasmacytoid dendritic cells. J. Exp. Med. 194: 1171-1178. [Abstract/Free Full Text]
  34. Boonstra, A., M. Dalod, I. Durand, N. Yessaad, C. Dezutter-Dambuyant, A. Vicari, A. O’Garra, C. Biron, F. Briere, G. Trinchieri, C. Asselin-Paturel. 2001. Mouse type I IFN-producing cells are immature APCs with plasmacytoid morphology. Nat. Immunol. 2: 1144-1150. [Medline]
  35. Ferrero, I., W. Held, A. Wilson, F. Tacchini-Cottier, F. Radtke, H. R. MacDonald. 2002. Mouse CD11c+B220+Gr1+ plasmacytoid dendritic cells develop independently of the T-cell lineage. Blood 100: 2852-2857. [Abstract/Free Full Text]
  36. Boonstra, A., C. Asselin-Paturel, M. Gilliet, C. Crain, G. Trinchieri, Y. J. Liu, A. O’Garra. 2003. Flexibility of mouse classical and plasmacytoid-derived dendritic cells in directing T helper type 1 and 2 cell development: dependency on antigen dose and differential Toll-like receptor ligation. J. Exp. Med. 197: 101-109. [Abstract/Free Full Text]
  37. Den Haan, J. M., S. M. Lehar, M. J. Bevan. 2000. CD8+ but not CD8– dendritic cells cross-prime cytotoxic T cells in vivo. J. Exp. Med. 192: 1685-1696. [Abstract/Free Full Text]
  38. Den Haan, J. M., M. J. Bevan. 2002. Constitutive versus activation-dependent cross-presentation of immune complexes by CD8+ and CD8– dendritic cells in vivo. J. Exp. Med. 196: 817-827. [Abstract/Free Full Text]
  39. Inaba, K., M. Inaba, N. Romani, H. Aya, M. Deguchi, S. Ikehara, S. Muramatsu, R. M. Steinman. 1992. Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor. J. Exp. Med. 176: 1693-1702. [Abstract/Free Full Text]
  40. Wake, C. T., R. A. Flavell. 1985. Multiple mechanisms regulate the expression of murine immune response genes. Cell 42: 623-628. [Medline]
  41. Tonnelle, C., R. DeMars, E. O. Long. 1985. DO beta: a new beta chain gene in HLA-D with a distinct regulation of expression. EMBO J. 4: 2839-2847. [Medline]
  42. Surh, C. D., E. K. Gao, H. Kosaka, D. Lo, C. Ahn, D. B. Murphy, L. Karlsson, P. Peterson, J. Sprent. 1992. Two subsets of epithelial cells in the thymic medulla. J. Exp. Med. 176: 495-505. [Abstract/Free Full Text]
  43. Colonna, M., G. Trinchieri, Y. J. Liu. 2004. Plasmacytoid dendritic cells in immunity. Nat. Immunol. 5: 1219-1226. [Medline]
  44. Liu, Y. J.. 2005. Professional type 1 interferon-producing cells and plasmacytoid dendritic cell precursors. Annu. Rev. Immunol. 23: 275-306. [Medline]
  45. LeibundGut-Landmann, S., J. M. Waldburger, C. Reis e Sousa, H. Acha-Orbea, W. Reith. 2004. MHC class II expression is differentially regulated in plasmacytoid and conventional dendritic cells. Nat. Immunol. 5: 899-908. [Medline]
  46. Grusby, M. J., R. S. Johnson, V. E. Papaioannou, L. H. Glimcher. 1991. Depletion of CD4+ T cells in major histocompatibility complex class II-deficient mice. Science 253: 1417-1420. [Abstract/Free Full Text]
  47. Grusby, M. J., H. Auchincloss, Jr, R. Lee, R. S. Johnson, J. P. Spencer, M. Zijlstra, R. Jaenisch, V. E. Papaioannou, L. H. Glimcher. 1993. Mice lacking major histocompatibility complex class I and class II molecules. Proc. Natl. Acad. Sci. USA 90: 3913-3917. [Abstract/Free Full Text]
  48. Chang, C. H., S. Guerder, S. C. Hong, W. van Ewijk, R. A. Flavell. 1996. Mice lacking the MHC class II transactivator (CIITA) show tissue-specific impairment of MHC class II expression. Immunity 4: 167-178. [Medline]
  49. Lamb, J. R., B. J. Skidmore, N. Green, J. M. Chiller, M. Feldmann. 1983. Induction of tolerance in influenza virus-immune T lymphocyte clones with synthetic peptides of influenza hemagglutinin. J. Exp. Med. 157: 1434-1447. [Abstract/Free Full Text]
  50. Quill, H., R. H. Schwartz. 1987. Stimulation of normal inducer T cell clones with antigen presented by purified Ia molecules in planar lipid membranes: specific induction of a long-lived state of proliferative nonresponsiveness. J. Immunol. 138: 3704-3712. [Abstract]
  51. Martin, E., B. O’Sullivan, P. Low, R. Thomas. 2003. Antigen-specific suppression of a primed immune response by dendritic cells mediated by regulatory T cells secreting interleukin-10. Immunity 18: 155-167. [Medline]
  52. Lohr, J., B. Knoechel, S. Jiang, A. H. Sharpe, A. K. Abbas. 2003. The inhibitory function of B7 costimulators in T cell responses to foreign and self-antigens. Nat. Immunol. 4: 664-669. [Medline]
  53. Chen, L.. 2004. Co-inhibitory molecules of the B7-CD28 family in the control of T-cell immunity. Nat. Rev. Immunol. 4: 336-347. [Medline]
  54. De Heer, H. J., H. Hammad, T. Soullie, D. Hijdra, N. Vos, M. A. Willart, H. C. Hoogsteden, B. N. Lambrecht. 2004. Essential role of lung plasmacytoid dendritic cells in preventing asthmatic reactions to harmless inhaled antigen. J. Exp. Med. 200: 89-98. [Abstract/Free Full Text]
  55. Moseman, E. A., X. Liang, A. J. Dawson, A. Panoskaltsis-Mortari, K. A. M., Y. J. Liu, B. R. Blazar, and W. Chen. 2004. Human plasmacytoid dendritic cells activated by CpG oligodeoxynucleotides induce the generation of CD4+CD25+ regulatory T cells. J. Immunol. 173: 4433–4442.
  56. Fukuma, K., K. Kuribayashi, T. Masuda, S. Sakaguchi. 1985. Organ-specific autoimmune diseases induced in mice by elimination of T cell subset. I. Evidence for the active participation of T cells in natural self-tolerance; deficit of a T cell subset as a possible cause of autoimmune disease. J. Exp. Med. 161: 72-87. [Abstract/Free Full Text]
  57. Miller, J. F., G. Morahan. 1992. Peripheral T cell tolerance. Annu. Rev. Immunol. 10: 51-69. [Medline]
  58. Decker, P., A. Le Moal, J. P. Briand, S. Muller. 2000. Identification of a minimal T cell epitope recognized by antinucleosome Th cells in the C-terminal region of histone H4. J. Immunol. 165: 654-662. [Abstract/Free Full Text]
  59. Bouneaud, C., P. Kourilsky, P. Bousso. 2000. Impact of negative selection on the T cell repertoire reactive to a self-peptide: a large fraction of T cell clones escapes clonal deletion. Immunity 13: 829-840. [Medline]
  60. De Smedt, T., B. Pajak, G. G. Klaus, R. J. Noelle, J. Urbain, O. Leo, M. Moser. 1998. Antigen-specific T lymphocytes regulate lipopolysaccharide-induced apoptosis of dendritic cells in vivo. J. Immunol. 161: 4476-4479. [Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
C. H. Rinderknecht, M. P. Belmares, T. L. W. Catanzarite, A. J. Bankovich, T. H. Holmes, K. C. Garcia, N. K. Nanda, R. Busch, S. Kovats, and E. D. Mellins
Posttranslational Regulation of I-Ed by Affinity for CLIP
J. Immunol., November 1, 2007; 179(9): 5907 - 5915.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
T. Burster, T. Giffon, M. E. Dahl, P. Bjorck, M. Bogyo, E. Weber, K. Mahmood, D. B. Lewis, and E. D. Mellins
Influenza A virus elevates active cathepsin B in primary murine DC
Int. Immunol., May 1, 2007; 19(5): 645 - 655.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. L. Fallas, W. Yi, N. A. Draghi, H. M. O'Rourke, and L. K. Denzin
Expression Patterns of H2-O in Mouse B Cells and Dendritic Cells Correlate with Cell Function
J. Immunol., February 1, 2007; 178(3): 1488 - 1497.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, X.
Right arrow Articles by Jensen, P. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, X.
Right arrow Articles by Jensen, P. E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS