The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lyddane, C.
Right arrow Articles by Sadelain, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lyddane, C.
Right arrow Articles by Sadelain, M.
The Journal of Immunology, 2006, 176: 3306-3310.
Copyright © 2006 by The American Association of Immunologists


CUTTING EDGE

Cutting Edge: CD28 Controls Dominant Regulatory T Cell Activity during Active Immunization1

Clay Lyddane*, Beata U. Gajewska*, Elmer Santos{dagger}, Philip D. King§, Glaucia C. Furtado and Michel Sadelain*,{ddagger}

* Immunology Program, {dagger} Department of Radiology, and {ddagger} Gene Transfer and Somatic Cell Engineering Laboratory, Memorial Sloan-Kettering Cancer Center, New York, NY 10021; § Immunology Program, University of Michigan, Ann Arbor, MI 48109; and Immunobiology Center, Mount Sinai School of Medicine, New York, NY 10029


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
Ligation of CD28 during Ag recognition plays an important role in the generation of effective T cell responses. However, its peripheral control of regulatory T cell function remains obscure. In this study, we show that naive wild-type or CD28–/– CD4+CD25 T cells exposed to peptide in vivo develop regulatory activity that suppresses the response of adoptively transferred naive T cells to a subsequent immunogenic challenge. We find that although CD28 is engaged during the initial peptide-priming event and is essential to sustain T cell survival, it is not sufficient to prevent the dominance of regulatory T cell function. Immunization with adjuvant abrogates regulatory dominance, reducing overall Foxp3 expression in a CD28-dependent manner. We conclude that CD28 licenses active immunization by regulating Ag-induced immunoregulation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
A growing body of evidence suggests that regulatory T cells (Tregs)3 are critical for maintenance of self-tolerance through inhibition of other T lymphocytes. Central CD4+CD25+ Tregs (cTregs) derived from the thymus have been found to display critical regulatory activity for the maintenance of immune tolerance, as revealed by the florid organ-specific autoimmunity upon their depletion (1, 2). A distinct subset of Tregs, collectively referred to as adaptive or induced Tregs (iTregs), has been described in a number of immunological settings; however, the in vivo requirements for iTreg function are less well established than for cTregs. Recent studies indicate that naive CD4+CD25 T cells anergized in vivo develop suppressive functions and are capable of inhibiting in vitro T cell activation as well as in vivo autoimmune and delayed type hypersensitivity responses (3, 4, 5). This suggests that Ag-induced suppression may contribute to tolerance, developing under conditions prone to promote CD4+ T cell anergy. Because T cell anergy is induced in CD4+ T cells by recognition of Ag in the absence of strong CD28 costimulation (6, 7), Treg development and function may also be dependent on CD28-B7 signaling (8, 9, 10). Indeed, CD28-mediated costimulation is critical for cTreg thymic development (11) and peripheral homeostasis (8, 12). The role of CD28 in iTreg development and function, however, is presently unknown (13). We show in this study that CD28 is a critical regulator of Treg function within the naive CD4+ T cell pool, which is enhanced in T cells lacking CD28 and averted by immunization with Ag and adjuvant in a CD28-dependent manner.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
Mice

BALB/c mice, 6–12 wk old, were purchased from Taconic Laboratory and used as transplant recipients. C.Cg-Tg(DO11.10)10Loh/J (OVA-specific I-Ad-restricted TCR-tg BALB/c mice (DO11.10; Ref.14) and C.129S2(B6)-Cd28tm1Mak (BALB/c Cd28–/–; Ref.15) mice were purchased from The Jackson Laboratory. All mice were cared for in accordance with the institutional guidelines of Memorial Sloan-Kettering Cancer Center (MSKCC; New York, NY).

Flow cytometry

Cells were stained with CD4-APC, CD25-PE, CD62L-PE, CD122-PE, CD45RB-PE or control rat IgG2a (Caltag Laboratories) and analyzed on a BD Biosciences FACSCalibur machine and CellQuest software.

Cell purification

CD4+CD62Lhigh± CD25 T cells were purified from pooled spleens and lymph nodes of 6- to 12-wk-old mice. CD4+ T cells were purified by negative selection using CD4+ T cell isolation kit (Miltenyi Biotec). CD25+ T cells were removed by negative selection (Miltenyi Biotec), and the remaining cells were purified for CD62Lhigh expression via positive selection on MACS beads and columns (Miltenyi Biotec). CFSE+KJ1-26+ cells were purified by a FACSVantage cell sorter (BD Biosciences).

Adoptive transfers and immunizations

A total of 5 x 106 purified CD4+KJ126+CD62Lhigh T cells, ±CD25 depletion, was adoptively transferred into nonirradiated, syngeneic BALB/c recipients. T cells were labeled with 0.3 µM CFSE (Molecular Probes) by incubation for 10 min at room temperature with agitation, subsequently mixed with equal volume of FCS for 1 min, and washed three times with RPMI 1640 (Invitrogen Life Technologies). One day after cell transfer, mice were inoculated with 25 µg of OVA peptide323–339 (OVA; Cell Essentials) or influenza matrix protein-derived peptide58–66 (FLU; Peptide Synthesis Facility at MSKCC, New York, NY) in PBS, or inoculated with OVA peptide and LPS (Calbiochem) (25 µg each in PBS).

Construction of artificial APCs (AAPCs)

The coding region of I-Ad chains (a gift from R. Germain, National Institute of Allergy and Infectious Disease/NIH, Bethesda, MD) and murine B7.1 were subcloned into the SFG retroviral vector (16). Subsequent infections with polybrene (Sigma-Aldrich) produced the stable xenogenic AAPCs (17), HeLaI-Ad and HeLaI-Ad/B7.1. For protein expression and in vivo functional analysis, AAPCs were pulsed with 1 µM OVA peptide, and cells were stained intracellularly for Foxp3 (eBioscience) or adoptively transferred and tested for function as described above.

mRNA isolation and quantitative RT-PCR

Total cellular RNA was extracted from sorted or purified cultured cells with TRIzol (Invitrogen Life Technologies) and reverse transcribed using Superscript II reverse-transcriptase and oligo(dT)12–18 primer (Invitrogen Life Technologies). The RT-PCR was conducted in 30-µl reaction volumes of 1x SYBR Green PCR Master Mix (Applied Biosystems), 0.4 µM of each primer, using the ABI PRISM 7700 instrument. Relative expression levels were calculated) using ubiquitin as endogenous control. Foxp3 primer sequences were the following: forward, ACTGGGGTCTTCTCCCTCAA; reverse, CGTGGGAAGGTGCAGAGTAG.

Western blot

Abs to Bcl-2, and Bcl-xL (polyclonal) were obtained from eBioscience, and Abs to Akt and phospho-Akt (Ser473) were obtained from Cell Signaling.


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
To investigate whether Ag-activated CD4+ T cells could abrogate the response of unprimed naive T cells to potent immunization, we first established an in vivo peptide-induced CD4+ T cell anergy protocol modified from previously established models (18, 19). Highly purified, naive Ag-specific, CD4+ T cells (±CD25 T cell population) from transgenic mice expressing the DO11.10 (DO11) TCR, specific for chicken OVA peptide presented by the MHC class II molecule I-Ad, were adoptively transferred into normal BALB/c recipients and were immunized with OVA peptide 24 h later. The purification of the naive CD4+CD25 T cell population was typically >96% CD4+, >97% CD62Lhigh, >95% CD45RBhigh, <0.25% CD25+, and <0.5% GITR+ (data not shown). This population displayed profound T cell anergy, as determined by the absence of proliferation and IL-2 secretion upon ex vivo restimulation (data not shown), as reported previously (18, 19). To analyze the ability of peptide-anergized mice to respond anew to Ag, we next established a double adoptive transfer model to assess the response of secondarily transferred, naive DO11+CD4+ T cells to a subsequent immunogenic challenge with OVA peptide and LPS. Seven days after the first DO11.10 and OVA inoculation, highly purified naive DO11+CD4+CD25 T cells were labeled with CFSE and adoptively transferred into Ag-primed or control mice, which were then immunized with OVA and LPS on the following day. In mice harboring peptide-anergized DO11+CD4+ T cells, the number of responder T cells was dramatically reduced relative to mice originally inoculated with control peptide or mice given OVA peptide without the initial transfer of naive DO11+ T cells (p < 0.001; Fig. 1A, left). The decreased number of CFSE-labeled responder cells was due to deficient accumulation of dividing cells rather than inhibition of cell division (Fig. 1A, right). In mice inoculated with OVA peptide and LPS after the first adoptive transfer, proliferation and accumulation of the secondarily transferred T cells was undiminished. CD25+ cTregs, accounting for 5–10% of naive CD4+ T cells (10), were not required for the development of regulatory activity (Fig. 1A). Finally, purified CD4+ T cells isolated from adoptively transferred, peptide-inoculated mice conferred similar regulatory activity when transferred into naive mice, demonstrating that the regulatory activity induced by peptide immunization is DO11+CD4+ T cell-mediated (Fig. 1B). T cells from OVA-inoculated mice also strongly up-regulated CD25 expression and moderately down-regulated CD62L expression, a phenotype evoking that of Tregs (Fig. 1C), with similar findings obtained from DO11+CD4+Rag1–/– T cells (data not shown). Altogether, these data established that in vivo exposure to Ag under conditions causing anergy iTreg function from naive CD4+ T cells, without the need for cotransferred Ag-specific cTregs. Our subsequent studies focused on the activation requirements for the establishment of dominant Ag-induced regulatory function in CD25-depleted, DO11+CD4+ T cells.


Figure 1
View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 1. Exposure of naive CD25CD4+ T cells to peptide under noninflammatory conditions leads to the peripheral development of regulatory function. A, BALB/c mice adoptively transferred with naive DO11CD4+± CD25 T cells and inoculated as described. After 7 days, all mice were again adoptively transferred with 1 x 106 of CFSE-labeled naive KJ1-26+CD4+CD25 responder T cells (Resp) and inoculated with OVA peptide (25 µg) and LPS (5 µg, i.v.). Splenocytes were harvested on day 11 and analyzed by flow cytometry. On the right are representative histograms gated on CFSE+KJ1-26+CD4+ responder T cells 3 days after responder inoculation. The numbers were calculated based on the fraction of CFSE+ from CD4+ splenic T cells. A total of 6 x 105 CD4+ were subjected to analyses (n = 3/group). B, Naive DO11CD4+CD25 T cells were adoptively transferred into mice and inoculated as described above. At day 7, spleens were harvested and CD4+ T cells purified by negative selection. A total of 10 x 106 CD4+ T cells was adoptively transferred into BALB/c mice and tested for regulatory activity as described above. C, Percentage CD62L+, CD45RB+, CD25+, and CD122+ of KJ1-26+CD4+ T cells at day 7 postinoculation (n = 4/group). Data are expressed as mean ± SD (*, p < 0.05) and are representative of at least two independent experiments.

 
We first explored CD28 engagement in the in vivo induction of Treg activity. Naive CFSE+DO11+CD4+CD25 T cells divided and accumulated in response to peptide inoculation, in the presence or absence of LPS administration (Fig. 2A), which was accompanied by Akt phosphorylation and Bcl-xL up-regulation (Fig. 2B), as reported in vitro (20). In contrast, Ag-stimulated Cd28–/– T cells demonstrated a proliferative and accumulative deficit, unaltered by LPS administration, despite undergoing multiple cell divisions (Fig. 2A), and failed to up-regulate Bcl-xL or induce Akt phosphorylation (Fig. 2B). These findings demonstrate the involvement of CD28 signaling in naive T cells primed under either inflammatory or noninflammatory conditions, and its substantial effect on T cell survival and accumulation in peptide-stimulated CD4+ T cells in vivo.


Figure 2
View larger version (51K):
[in this window]
[in a new window]
 
FIGURE 2. CD28 is engaged during acquisition of regulatory phenotype and extends T cell survival. BALB/c mice adoptively transferred with CFSE+CD4+CD25 T cells as above isolated from either CD28+/+ or CD28–/– mice and inoculated with PBS, 25 µg of OVA, or 25 µg of OVA and LPS. A, Representative histograms gated on CD4+ T cells. B, BALB/c mice adoptively transferred and inoculated as before. CD4+ T cells were retrieved 3 days after OVA or LPS/OVA inoculation (PRE represents naive DO11.10 CD25CD4+ T cells from Cd28+/+ or Cd28–/– mice) and sort purified (>98% purity; data not shown). Lysates were prepared from 2 x 106 T cells and analyzed for AKT, AKTSer432, Bcl-xL, and Bcl-2 by Western blot. Results are representative of two independent experiments.

 
Having established active engagement of CD28 in peptide-stimulated T cells, we further investigated the CD28 costimulatory requirements for in vivo iTreg dominance and function using Cd28–/– DO11+CD4+CD25 T cells. Like Cd28+/+ CD4+ T cells, peptide-stimulated Cd28–/– T cells markedly inhibited the accumulation of CFSE-labeled responder T cells (Fig. 3A). However, prior peptide stimulation was not required for iTreg function in CD28–/– T cells, as their activation at the time of challenge with peptide and LPS resulted in concomitant suppression of the CFSE-labeled responder cells (Fig. 3A).


Figure 3
View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 3. CD28 controls the acquisition of iTreg function and Foxp3 expression. Naive CD4+CD25 T cells from Cd28–/–DO11 mice were adoptively transferred and inoculated as before. A, Mice tested for regulatory function as described above. B and C, BALB/c mice adoptively transferred and inoculated as in Fig. 2 from either Cd28+/+ (B) or Cd28–/– mice (C). CD4+ T cells were retrieved 3 days after OVA or OVA/LPS inoculation (PRE represents pretransferred naive DO11.10 CD4+ T cells from CD28+/+ or CD28–/– mice) and sort purified. KJ1-26+CD4+CFSE+ cell purity was routinely 97–98% (data not shown). Real-time PCR was performed on the cDNA acquired from sorted T cells, and mRNA transcription levels were normalized to murine ubiquitin levels.

 
To further define whether peptide stimulation of CD25-depleted CD4+ T cells increased bona fide Tregs, we investigated the expression of Treg markers other than CD25, including CTLA-4, TGF-beta1, and Foxp3, a critical marker and cell fate determinant for suppressive function (13). Peptide immunization resulted in higher levels of all three transcripts in highly purified, primed DO11+CD4+ T cells (Fig. 3B). In contrast, the levels of Foxp3 mRNA sharply decreased in sorted DO11+CD4+ T cells stimulated with OVA peptide and LPS (p < 0.001; Fig. 3B). In Cd28–/– T cells, Foxp3 mRNA levels were dramatically higher than found in similarly peptide-activated Cd28+/+ T cells (Fig. 3C). LPS administration reduced the accumulation of Foxp3 mRNA, but, significantly, these levels did not decrease below baseline levels and still remained 3- to 4-fold higher than in Cd28+/+ T cells. Thus, in vivo immunization with peptide alone favored the accumulation of CD25+Foxp3+ CD4+ T cells with regulatory function from naive CD25 T cells. Additionally, Foxp3 mRNA levels were not fully diminished without CD28 engagement, whether in the presence or absence of LPS administration.

To further pinpoint whether CD28 engagement is by itself sufficient to modulate Foxp3 expression levels in Ag-activated T cells, we exposed DO11+ T cells to AAPCs engineered to express I-Ad and murine B7.1 as their sole costimulatory ligand. The rationale for this approach was to reduce the complexity inherent to Ag presentation by natural APCs and investigate whether CD28 signaling is sufficient to reduce Foxp3 expression. At the highest peptide concentration, Foxp3 mRNA transcript levels were 25-fold lower in Cd28+/+ T cells activated on I-Ad+B7.1+ AAPCs than on I-Ad+B7.1 AAPCs (Fig. 4A). In the absence of B7.1, Cd28+/+ T cell Foxp3 mRNA levels steadily rose with increasing TCR stimulation. Foxp3 mRNA levels were likewise up-regulated in Cd28–/– T cells stimulated on peptide-pulsed AAPCs, irrespective of B7.1 expression. These experiments thus established that CD28 engagement is a critical regulator of Foxp3 expression within the primed T cell pool, and further suggested that Foxp3 mRNA accumulation depends on integrated strength of TCR and costimulatory signaling. Additionally, I-Ad/OVA-stimulated wild-type DO11.10 T cells demonstrated a 5-fold increase in the percentage of cells expressing Foxp3 over those cultured on I-Ad/B7.1 AAPCs (Fig. 4B), consistent with mRNA findings and establishing that Foxp3 expression is confined to a subset of the primed CD4+ T cells.


Figure 4
View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 4. Integrated TCR and CD28 signals control Foxp3 and regulatory activity. A, A total of 1 x 106 purified naive KJ1.26+CD4+CD25 Cd28+/+ or Cd28–/– T cells was plated on 1 x 105-irradiated xenogenic HeLa AAPCs expressing I-Ad alone or coexpressing mB7.1 and pulsed with increasing concentrations of OVA peptide. At 72 h, T cells were harvested and analyzed for Foxp3 mRNA expression by real-time PCR. The gene expression for Foxp3 was normalized to murine ubiquitin (n = 3). All data are expressed as mean ± SD. B, Intracellular Foxp3 staining of naive (day 0) or in vitro-stimulated cells (1 µM OVA, day 7). C, On day 7 of AAPC stimulation, 1 x 106 in vitro-stimulated DO11CD4+ T cells were adoptively transferred into BALB/c mice, and all mice were inoculated with OVA peptide the following day (25 µg). Mice were then tested for in vivo regulatory activity as described above.

 
To test the in vivo regulatory function of DO11+CD4+ T cells activated on AAPCs, we adoptively transferred them into naive BALB/c mice as described above. CD4+ T cells stimulated on B7.1 AAPCs strongly inhibited CFSE-labeled responder CD4+ T cell responses, thus displaying regulatory function akin to that induced by in vivo peptide administration without adjuvant (Fig. 4C). In contrast, CD4+ T cells stimulated on AAPCs expressing B7.1 did not inhibit responder T cell accumulation (Fig. 4C).

We demonstrate in this study the critical role of CD28 in controlling the response to active immunization by regulating the in vivo dominance of Ag-induced regulatory function from naive CD4+CD25 T cells. We found that animals harboring naive, Ag-specific CD4+ T cells generated suppressive activity in response to a single dose of Ag without adjuvant. Upon priming, these CD4+ T cells comprised a larger fraction of cells demonstrating a regulatory phenotype characterized by elevated CD25 and Foxp3 expression. This phenotype is consistent with data demonstrating that Foxp3 overexpression is sufficient to impart a regulatory phenotype on CD4+CD25 T cells, independent of their thymic development (21), and that long-term exposure to Ag in the periphery induces CD4+CD25+-suppressive T cells with elevated Foxp3 mRNA levels (5). We also demonstrated that in vivo peripheral Treg function does not require CD28, because CD4+CD25 T cells isolated from CD28–/– mice and exposed to Ag alone express Foxp3 and suppress subsequent naive CD4+ T cell accumulation. It was previously demonstrated that CD28 is required for thymic cTreg development (11), and that low B7 expression on immature DCs is responsible for maintaining a stable pool of cTregs by promoting homeostatic self-renewal (8, 11). Consistent with the latter, our data show that Cd28–/– DO11+CD4+ T cells, which include Tregs, are short-lived compared with their Cd28+/+ counterparts, suggesting a survival function for CD28 in Ag-iTreg activity. Thus, Ag presentation without adjuvant leads to dominant iTreg function, which is less pronounced than found with CD28–/– cells, but is functionally extended through enhanced iTreg survival. These findings underscore the subtle yet profound regulatory function of CD28, and are consistent with the induction of tolerance by immature DCs presenting Ag under conditions of basal B7 expression (4, 22, 23).

Our most striking observation is that although CD28 is not necessary for the acquisition of iTreg suppressor function, it is essential to inhibit regulatory function in vivo, as described for cTreg activity in vitro (24). We found that CD28 ligation regulates the level of cells expressing Foxp3 and is thus a critical determinant of the emergence of dominant T cell suppressive activity. Although CD28 is engaged under noninflammatory conditions, as determined by Akt phosphorylation upon exposure to Ag alone, it is not sufficient to inhibit Ag-iTreg dominant function. LPS coadministration, which also represses overall Foxp3 mRNA levels in vivo, does so in a CD28-dependent manner; a process that likely depends on LPS-mediated dendritic cell maturation and signaling through the B7-CD28 axis. These data imply that induction of peripheral tolerance is not CD28-independent, and that CD28 may regulate the Treg:non-Treg ratio under both homeostatic and inflammatory conditions. Our findings further suggest that CD28 blockade diminishes Ag-induced autoimmunity (25, 26, 27, 28) not only by impairing activation of effector cells, but also by facilitating the dominance of peripheral Treg activity. Conversely, our model argues that augmented CD28 signaling in conjunction with TCR-mediated inflammatory activation in responder T cells abrogates tolerance by decreasing the relative expansion of Foxp3+ CD4+ T cells (29). Our findings support the critical importance of devising therapeutic strategies in which all immunizing APCs are suitably activated to deliver a strong signal through CD28 and thus avert the danger of inducing or sustaining concomitant, potentially immunodominant-iTreg activity.


    Acknowledgments
 
We thank Dr. Isabelle Riviere and John Markley for critical review of this manuscript.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health (NIH) Grant CA59350. C.L. is supported by the NIH Medical Scientist Training Program Grant GM07739 and the Cancer Research Institute fellowship for predoctoral studies. Back

2 Address correspondence and reprint requests to Dr. Michel Sadelain, Gene Transfer and Somatic Cell Engineering Laboratory, Memorial Sloan-Kettering Cancer Center, New York, NY 10021. E-mail address: m-sadelain{at}ski.mskcc.org Back

3 Abbreviations used in this paper: Treg, regulatory T cell; cTreg, central CD4+CD25+ Treg; iTreg, induced Treg; AAPC, artificial APC. Back

Received for publication July 15, 2005. Accepted for publication January 11, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 

  1. Sakaguchi, S., N. Sakaguchi, M. Asano, M. Itoh, M. Toda. 1995. Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor {alpha}-chains (CD25): breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J. Immunol. 155: 1151-1164. [Abstract]
  2. Asano, M., M. Toda, N. Sakaguchi, S. Sakaguchi. 1996. Autoimmune disease as a consequence of developmental abnormality of a T cell subpopulation. J. Exp. Med. 184: 387-396. [Abstract/Free Full Text]
  3. Thorstenson, K. M., A. Khoruts. 2001. Generation of anergic and potentially immunoregulatory CD25+CD4 T cells in vivo after induction of peripheral tolerance with intravenous or oral antigen. J. Immunol. 167: 188-195. [Abstract/Free Full Text]
  4. Mahnke, K., Y. Qian, J. Knop, A. H. Enk. 2003. Induction of CD4+CD25+ regulatory T cells by targeting of antigens to immature dendritic cells. Blood 101: 4862-4869. [Abstract/Free Full Text]
  5. Apostolou, I., H. von Boehmer. 2004. In vivo instruction of suppressor commitment in naive T cells. J. Exp. Med. 199: 1401-1408. [Abstract/Free Full Text]
  6. Khoruts, A., A. Mondino, K. A. Pape, S. L. Reiner, M. K. Jenkins. 1998. A natural immunological adjuvant enhances T cell clonal expansion through a CD28-dependent, interleukin (IL)-2-independent mechanism. J. Exp. Med. 187: 225-236. [Abstract/Free Full Text]
  7. Harding, F. A., J. G. McArthur, J. A. Gross, D. H. Raulet, J. P. Allison. 1992. CD28-mediated signalling co-stimulates murine T cells and prevents induction of anergy in T-cell clones. Nature 356: 607-609. [Medline]
  8. Tang, Q., K. J. Henriksen, E. K. Boden, A. J. Tooley, J. Ye, S. K. Subudhi, X. X. Zheng, T. B. Strom, J. A. Bluestone. 2003. Cutting edge: CD28 controls peripheral homeostasis of CD4+CD25+ regulatory T cells. J. Immunol. 171: 3348-3352. [Abstract/Free Full Text]
  9. Thornton, A. M., E. E. Donovan, C. A. Piccirillo, E. M. Shevach. 2004. Cutting edge: IL-2 is critically required for the in vitro activation of CD4+CD25+ T cell suppressor function. J. Immunol. 172: 6519-6523. [Abstract/Free Full Text]
  10. Sakaguchi, S.. 2004. Naturally arising CD4+ regulatory t cells for immunologic self-tolerance and negative control of immune responses. Annu. Rev. Immunol. 22: 531-562. [Medline]
  11. Salomon, B., D. J. Lenschow, L. Rhee, N. Ashourian, B. Singh, A. Sharpe, J. A. Bluestone. 2000. B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells that control autoimmune diabetes. Immunity 12: 431-440. [Medline]
  12. Lohr, J., B. Knoechel, S. Jiang, A. H. Sharpe, A. K. Abbas. 2003. The inhibitory function of B7 costimulators in T cell responses to foreign and self-antigens. Nat. Immunol. 4: 664-669. [Medline]
  13. Bluestone, J. A., A. K. Abbas. 2003. Natural versus adaptive regulatory T cells. Nat. Rev. Immunol. 3: 253-257. [Medline]
  14. Murphy, K. M., A. B. Heimberger, D. Y. Loh. 1990. Induction by antigen of intrathymic apoptosis of CD4+CD8+TCRlo thymocytes in vivo. Science 250: 1720-1723. [Abstract/Free Full Text]
  15. Shahinian, A., K. Pfeffer, K. P. Lee, T. M. Kundig, K. Kishihara, A. Wakeham, K. Kawai, P. S. Ohashi, C. B. Thompson, T. W. Mak. 1993. Differential T cell costimulatory requirements in CD28-deficient mice. Science 261: 609-612. [Abstract/Free Full Text]
  16. Riviere, I., K. Brose, R. C. Mulligan. 1995. Effects of retroviral vector design on expression of human adenosine deaminase in murine bone marrow transplant recipients engrafted with genetically modified cells. Proc. Natl. Acad. Sci. USA 92: 6733-6737. [Abstract/Free Full Text]
  17. Latouche, J. B., M. Sadelain. 2000. Induction of human cytotoxic T lymphocytes by artificial antigen-presenting cells. Nat. Biotechnol. 18: 405-409. [Medline]
  18. Kearney, E. R., K. A. Pape, D. Y. Loh, M. K. Jenkins. 1994. Visualization of peptide-specific T cell immunity and peripheral tolerance induction in vivo. Immunity 1: 327-339. [Medline]
  19. Staveley-O’Carroll, K., E. Sotomayor, J. Montgomery, I. Borrello, L. Hwang, S. Fein, D. Pardoll, H. Levitsky. 1998. Induction of antigen-specific T cell anergy: an early event in the course of tumor progression. Proc. Natl. Acad. Sci. USA 95: 1178-1183. [Abstract/Free Full Text]
  20. Chambers, C. A., J. P. Allison. 1999. Costimulatory regulation of T cell function. Curr. Opin. Cell Biol. 11: 203-210. [Medline]
  21. Hori, S., T. Nomura, S. Sakaguchi. 2003. Control of regulatory T cell development by the transcription factor Foxp3. Science 299: 1057-1061. [Abstract/Free Full Text]
  22. Javia, L. R., S. A. Rosenberg. 2003. CD4+CD25+ suppressor lymphocytes in the circulation of patients immunized against melanoma antigens. J. Immunother. 26: 85-93. [Medline]
  23. Dhodapkar, M. V., R. M. Steinman. 2002. Antigen-bearing immature dendritic cells induce peptide-specific CD8+ regulatory T cells in vivo in humans. Blood 100: 174-177. [Abstract/Free Full Text]
  24. Thornton, A. M., C. A. Piccirillo, E. M. Shevach. 2004. Activation requirements for the induction of CD4+CD25+ T cell suppressor function. Eur. J. Immunol. 34: 366-376. [Medline]
  25. Tada, Y., K. Nagasawa, A. Ho, F. Morito, O. Ushiyama, N. Suzuki, H. Ohta, T. W. Mak. 1999. CD28-deficient mice are highly resistant to collagen-induced arthritis. J. Immunol. 162: 203-208. [Abstract/Free Full Text]
  26. Perrin, P. J., D. Scott, L. Quigley, P. S. Albert, O. Feder, G. S. Gray, R. Abe, C. H. June, M. K. Racke. 1995. Role of B7:CD28/CTLA-4 in the induction of chronic relapsing experimental allergic encephalomyelitis. J. Immunol. 154: 1481-1490. [Abstract]
  27. Bachmaier, K., C. Pummerer, A. Shahinian, J. Ionescu, N. Neu, T. W. Mak, J. M. Penninger. 1996. Induction of autoimmunity in the absence of CD28 costimulation. J. Immunol. 157: 1752-1757. [Abstract]
  28. Peterson, K. E., G. C. Sharp, H. Tang, H. Braley-Mullen. 1999. B7.2 has opposing roles during the activation versus effector stages of experimental autoimmune thyroiditis. J. Immunol. 162: 1859-1867. [Abstract/Free Full Text]
  29. Leach, D. R., M. F. Krummel, J. P. Allison. 1996. Enhancement of antitumor immunity by CTLA-4 blockade. Science 271: 1734-1736. [Abstract]



This article has been cited by other articles:


Home page
J. Immunol.Home page
T. N. Golovina, T. Mikheeva, M. M. Suhoski, N. A. Aqui, V. C. Tai, X. Shan, R. Liu, R. R. Balcarcel, N. Fisher, B. L. Levine, et al.
CD28 Costimulation Is Essential for Human T Regulatory Expansion and Function
J. Immunol., August 15, 2008; 181(4): 2855 - 2868.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. Kang, S. J. Huddleston, J. M. Fraser, and A. Khoruts
De novo induction of antigen-specific CD4+CD25+Foxp3+ regulatory T cells in vivo following systemic antigen administration accompanied by blockade of mTOR
J. Leukoc. Biol., May 1, 2008; 83(5): 1230 - 1239.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Guillonneau, C. Seveno, A.-S. Dugast, X.-L. Li, K. Renaudin, F. Haspot, C. Usal, J. Veziers, I. Anegon, and B. Vanhove
Anti-CD28 Antibodies Modify Regulatory Mechanisms and Reinforce Tolerance in CD40Ig-Treated Heart Allograft Recipients
J. Immunol., December 15, 2007; 179(12): 8164 - 8171.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lyddane, C.
Right arrow Articles by Sadelain, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lyddane, C.
Right arrow Articles by Sadelain, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS