|
|
||||||||



* Department of Molecular Pathology, University of Texas Southwestern Medical Center, Dallas, TX 75390;
National Human Genome Research Institute, National Institutes of Health, Bethesda, MD 20892;
Lovelace Respiratory Research Institute, Albuquerque, NM 87108; and
Department of Pediatrics, Division of Blood and Marrow Transplantation, and Cancer Center, University of Minnesota Hospital and Cancer Center, Minneapolis, MN 55455
| Abstract |
|---|
|
|
|---|
. In this study, we show that B cells, and, particularly, marginal zone B cells, can, in addition, induce NK cells via direct cell-cell interactions to express mRNA encoding the Th2 cytokine IL-13. The induction of NK cell IL-13 mRNA expression requires the ligation of the CD244 receptor by the CD48 ligand on B cells via signaling pathways that depend upon expression of the X-linked lymphoproliferative disease gene product, SH2D1A/DSHP/SAP (SLAM-associated protein, or SAP) in NK cells. Thus, the positive signals attributed to the B cell activation of CD244 on murine NK cells appears to be more similar to the activity of CD244 on human cells. The induction of IL-13 mRNA by B cells may account for the effect of NK cells on the generation of Th2-type responses in the presence of some adjuvants. | Introduction |
|---|
|
|
|---|
production by NK cells (1) via direct cell-cell interactions. Whereas it is clear that secretion of IFN-
by NK cells plays an important role in Th1 responses, we have found that under some conditions of immunization, NK cells can also increase the IgG1 response (2) that is usually associated with Th2 cytokines. Although murine NK cells have not been shown to secrete IL-4 (3, 4), a closely related Th2 cytokine, IL-13, can be produced by NK cells (5, 6). IL-13 shares many properties with IL-4, but also has many distinct functions. For example, IL-13 is more important than IL-4 in the development of airway hyperreactivity and mucus secretion as well as control of some parasites (7, 8, 9). The production of a Th2 cytokine by NK cells provides another source of cytokines for the alternative pathway of macrophage activation (10). The induction of T cell production of IL-13 may be mediated by other cytokines as well as cell surface ligands such as CD30L (11). NK cells can be also induced to produce IL-13 by cytokines such as IL-2 and IL-18 (5, 12, 13), but whether they can be stimulated by surface ligands expressed by other cell types is not known. Since we have shown that B cells can up-regulate NK cell IFN-
production, we tested whether they can induce NK cells to express IL-13 as well and might therefore explain why NK cells can sometimes exert Th2-like effects. Parameters of induction of IL-13 mRNA expression by NK cells can be measured quite precisely because even after in vitro IL-2 propagation NK cells do not produce measurable amounts of IL-13 mRNA. We found that, whereas highly purified resting B cells can induce NK cells to synthesize IL-13 mRNA, marginal zone (MZ) B cells are much more effective than follicular B cells. By the use of Abs specific for possible ligand/receptors as well as mice with targeted disruptions of genes encoding cell surface molecules, we found that activation of NK cells by B cells requires the interaction of CD48 and its counterreceptor, CD244 (2B4), expressed on NK cells. CD244 is a member of the Ig superfamily (14), which includes other membrane-associated proteins, such as CD150 (signaling lymphocyte activation molecule (SLAM)2), CD2, and CD48. These proteins are expressed to varying degrees in subsets of immune cells and may function as ligands or receptors. Murine CD244 has been shown to mediate both activating and inhibitory signals. The results reported herein show, for the first time, that ligation of the CD244 receptor on NK cells by CD48 expressed on B cells results only in activation. As for human NK cells (15, 16) this activation pathway can be shown to be mediated via the SLAM-associated protein (SAP). The induction by B cells of the production of Th2 as well as Th1 cytokines by NK cells provides further evidence for a B cell regulatory role for NK cells in vivo.
| Materials and Methods |
|---|
|
|
|---|
For B cell preparations, T lymphocytes were depleted from splenocytes of BALB/c-Ifg<tm1 (IFN-
/) (17), or C57BL/6 (both from The Jackson Laboratory), or D0.11 mice (Ref.18 ; provided by Dr. M. Siegelman, University of Texas Southwestern Medical Center, Dallas, TX) mice, and fractionated by Percoll gradient centrifugation as previously described (19). The high-density fraction (20) was further purified by binding to CD43 MicroBeads (Miltenyi Biotec) to deplete remaining non-B cells. B cells were found routinely to be >95% positive for the CD19 marker. For in vivo modulation of CD48, IFN-
/ mice were injected two times with 300 µg/animal of an ammonium sulfate cut of anti-CD48 (HM48-1) 2 days apart (21). B cells were isolated 1 day after the last injection. NK cells were purified from BALB/c IFN-
/, C57BL/6, or D0.11 mice or from CD2/ (22), CD244/ (23), and C.B-17 SCID mice (all bred and provided by Dr. M. Bennett, University of Texas Southwestern Medical Center). The generation of SAP/ mice has been described (24). Spleen cells from the mice were first passed over a nylon wool column to remove adherent cells, then depleted of T cells by complement-mediated lysis. NK cells were then isolated by positive selection using anti-DX5 Abs and magnetic beads (Miltenyi Biotec). Purified cells were cultured in 1000 U/ml IL-2 as described previously (25). NK cells from D0.11 mice did not exhibit properties different from BALB/c mice. When necessary, residual T cells if detected by FACS in the propagated NK cells were depleted with biotinylated anti-CD3
and streptavidin-conjugated magnetic beads (Miltenyi Biotec). Quasi-monoclonal (QM) mice originally generated by Cascalco et al. (26) were provided by Dr. R. Noelle (Dartmouth Medical Center, Hanover, NH). Each cell type was either cultured alone or together (1 x 106/ml total cell concentration) in the presence of 100 U/ml IL-2 with or without other additives in 24- or 48-well Falcon tissue culture plates (BD Biosciences) or in tissue culture plates containing Transwell inserts. For some experiments, B cells were irradiated at 2 x 106/ml at 1200 cGy 137Cs gamma-irradiation (Gamma Cell 40; Atomic Energy).
Abs and reagents
Hamster anti-CD40L (CD154; Ref.27) Abs were provided by Dr. R. Noelle (Dartmouth Medical School). Ammonium sulfate cut preparations of hamster anti-CD48 (HM48-1) were prepared as described previously (21). Rat anti-CD28 (28), anti-Fc
R, (2.4G2 (29)), anti-IFN-
, R4-6A2, (30), anti-IgM, and anti-CD48 (1G10) Abs (originally obtained from Dr. J. Bromberg, Mount Sinai School of Medicine, New York, NY), hamster anti-TCR
(31), mouse anti-NK1.1 (PK136; Ref.32), and anti-2B4 (CD244; Ref.33) were purified from hybridoma culture supernatants using Gamma Bind (Pharmacia Fine Chemicals). Conjugated hamster anti-CD48 (HM48-1), mouse anti-DX5, rat anti-CD3
, allotype-specific mouse anti-µ, and rat anti-CD19 were purchased from BD Biosciences. Conjugated rat anti-CD23 and anti-CD21 were provided by Dr. T. Waldschmidt (University of Iowa, Iowa City, IA). rIFN-
was purchased from BioSource International. rIL-12 was a generous gift from Dr. N. Street, (University of Texas Southwestern Medical Center). rIL-18 was purchased from R&D Systems.
Semiquantitative RT-PCR analysis
RNA was prepared using the TRIzol reagent (Invitrogen Life Technologies), and RT-PCR was performed as previously described (34). Primers for assessment of µM mRNA abundance have been described elsewhere (25). Sequences of primers for IL-13 mRNA were: forward, 5'-AGTTCTACAGCTCCCTGGTTCTC; reverse, 5'-GGATGGTCTCTCCTCATTAGAAGG, which yields a 452-bp product. Sequences of primers for IFN-
mRNA were: forward, 5'-GTGGCATAGATGTGGAAGA; reverse, 5'-AGCTGGTGGACCACTCGGAT, which yields a 303-bp product. Ly49 primers were consensus sequences (forward, 5'-TCCCAAGATGAGTGAGC; reverse, 5'TTAGATGGGCCATTGTCAATC) which yields a 650- to 657-bp product from most Ly49 family members including both BALB/c and C57BL/6 strains. All primers were ascertained to span intronic regions. Amplified products for each set of primers were authenticated by size and restriction enzyme analysis. To quantify RT-PCR products, at least one of each primer pair was 3' end-labeled with [
-32P]ATP and used to spike reaction mixtures. Amplified products were quantified using the ImageQuant software package (Molecular Dynamics). For all primer pairs, titration curves were performed to ascertain that the cycle number used fell within the linear range as cDNA concentrations were increased.
ELISA analysis of IL-13 protein expression
ELISA plates (Greiner BioOne) were coated with anti-IL-13 (mAb 413, 2 µg/ml; R&D Systems) in 0.1 ml of PBS and incubated overnight at room temperature. Plates were then washed with PBS containing 0.1% Tween 20 (pH 7.4) and blocked with 1% BSA/5% sucrose in PBS for 2 h at room temperature. After thorough washing, samples and standards (IL-13, 413 ML; R&D Systems) were added and the plates were incubated overnight at 4°C. Detection proceeded the following day by adding biotinylated anti-IL-13 (BAF413, 0.2 mg/ml; R&D Systems) in 0.1% BSA/PBS and incubating for 2 h at room temperature. Following thorough washing, streptavidin-HRP was added (0.625 mg/ml diluted in 0.1% BSA/PBS) and plates were incubated for 30 min longer at room temperature. After washing, tetramethylbenzidine substrate (Sigma-Aldrich) was added to the plates until the maximum standard on the plate developed to an OD450 of at least 1.0. Plates were read on Bio-Rad ELISA Microplate Reader model 550 OD450 after 2 N H2SO4 was added to the wells to stop the reaction. IL-13 levels in the samples were quantified by comparison to the standard curve generated using rIL-13 (DeltaSoft). Detection limits were routinely between 0.016 and 0.062 ng/ml IL-13.
FACS analysis and cell sorting
B cells isolated from QM mice were labeled with fluorescein-conjugated -anti-IgM, PE-conjugated CD23, and biotinylated CD21 followed by allophycocyanin-conjugated streptavidin. The cells were sorted on a FACS DIVA (BD Biosciences). For FACS analysis, the FACScan flow cytometer (BD Biosciences) was used.
| Results |
|---|
|
|
|---|
We found that IL-13 mRNA is synthesized at levels below the sensitivity of detection by RT-PCR in numerous preparations of propagated NK cells from different strains. Upon coculture with resting B cells, however, significant amounts of IL-13 mRNA can be detected. In the experiments depicted in Fig. 1, highly purified, resting B cells were cultured with IL-2 propagated NK cells for 2 days at varying ratios of B:NK cells. Subsequently, the cocultured cells were assessed by RT-PCR analysis. The use of labeled primers allowed us to determine, semiquantitatively, the level of IL-13 mRNA induced in the cultures. To adjust for possible differences in cell as well as RNA recovery from the cocultures, relative expression of IL-13 mRNA was determined as a function of the level of Ly49 mRNA in each culture for all experiments. Note that although Ly49 can be expressed by B1 B cells (35) we have never detected the mRNA in our B cell preparations (see Fig. 1C). Fig. 1B shows that the number of B cells required for induction is relatively high. Reproducible induction was only observed with greater than 1:1 ratios of B:NK cells. FACS analysis confirmed that the NK cell cultures used in these experiments do not contain detectable numbers of T or NKT cells, whereas >97% of the cells express DX5 (data not shown). To further ascertain that the induction does not require NKT cells, we propagated NK cells from SCID mice and found that they can be also induced to produce IL-13 mRNA (Fig. 1). Similar results were obtained from NK cells propagated from IFN-
/ NK cells (Fig. 1B). Therefore, the induction does not require IFN-
. Moreover, the absence of IFN-
in the cultures indicates that the induction is unlikely to be mediated by small numbers of contaminating adherent cells that can be stimulated by NK-derived IFN-
to produce cytokines that can stimulate IL-13 mRNA synthesis.
|
Since B cells have not been reported to produce IL-13 mRNA, it is unlikely that the IL-13 mRNA is derived from B cells in the cocultures. Furthermore, we have not been able to induce IL-13 mRNA expression in B cells stimulated with various B cell mitogens including LPS, anti-IgM, or anti-CD40. However, to confirm that B cells are not responsible for the IL-13 mRNA expression in cocultures, we irradiated them before culturing the cells with NK cells. The dramatic decrease in the expression of mRNA for membrane IgM (micromolar) confirmed that the transcriptional activity of the B cells was severely compromised by the irradiation. Despite this disruption, the IL-13 mRNA can be induced in the cocultures of these cells with NK cells (Fig. 1C), indicating that expression of this mRNA is not dependent on the ability of B cells to synthesize mRNA.
Surface receptors involved in the induction of IL-13 mRNA production
Since irradiated B cells are effective inducers of IL-13 mRNA synthesis by NK cells, the induction is unlikely to be mediated by cytokines produced by B cells. To determine whether cell contact is necessary for the induction, B cells were separated from NK cells by a semipermeable membrane. Fig. 2A shows that upon separation the induction of IL-13 mRNA was completely abrogated. Therefore, contact between the two cell types is a necessary condition for induction but we cannot eliminate the possibility that the induction requires, in addition, another cytokine(s) produced by NK cells.
|

mAb included as a control for nonspecific effects since these propagated NK cells contain few T cells or for anti-IgM or anti-Fc
R mAbs. However, induction was inhibited by as much as 70% by two different anti-CD48 mAbs. This inhibition is independent of possible effects of ligation of the Fc
RIII receptor on NK cells, since the addition of anti-Fc
R Abs along with the anti-CD48 Abs had no effect. Since the CD48 receptor is expressed by both B and NK cells, it is not clear which cell type is affected. To test whether expression of CD48 on B cells is necessary for the induction, we modulated the CD48 receptor in vivo by the injection of anti-CD48 mAbs (21). We have shown in previous experiments that virtually all CD48 can be removed from B cells by this treatment without detectable effects on other B cell surface determinants (38). As shown in Fig. 3A, incubation of modulated B cells with IL-2-propagated NK cells reduced the induction of IL-13 to a significant extent. Therefore, the expression of CD48 on B cells is critical. Some residual CD48 remaining after in vivo modulation could be responsible for the low level of induction obtained from the CD48-modulated cells when the cells were cocultured at higher B:NK ratios. However, it is also possible that less effective ligands other than CD48 is responsible for the induction.
|
R Abs (Fig. 3C). As expected NK cells from CD244/ mice did not respond to anti-CD244. Surprisingly, however, in three of three experiments, they also did not express IL-13 mRNA in response to anti-CD28 but can, however, express IFN-
mRNA (Fig. 3D). In contrast, in the absence of CD2, the response to CD28, while variable, was not compromised. Thus, despite the ability of both CD2 and CD244 to bind to CD48, in terms of IL-13 mRNA induction, it appears that CD244 on NK cells is the major receptor. MZ B cells preferentially induce NK-cell IL-13 mRNA production
The relatively large number of B cells required for the induction of IL-13 mRNA production by NK cells suggests that only a subpopulation of B cells are efficient inducers. Since activated NK cells have been shown to be recruited to the MZ of splenic follicles (39), we tested whether MZ B cells preferentially induce NK cells. MZ B cells constitute <10% of the splenic B cells in most species of mice. However, they are enriched in some transgenic mice (40). We used splenocytes from the QM mouse (26) which contains an unusually high proportion of MZ B cells. These cells were separated from follicular B cells by FACS, based on high CD21 and low CD23 expression (Fig. 4B). The isolated cells were cultured with IL-2-propagated NK cells at two different B:NK ratios. Clearly, the MZ B cells were much more effective inducers although the level of expression of CD48 on these cells does not differ from that of follicular B cells (data not shown). MZ B cells do express, however, higher levels of µM RNA corresponding to the higher expression of surface IgM in this population. However, this increased expression is not likely to be the critical factor because inhibition with anti-IgM did not reduce the ability of B cells to induce IL-13 (see Fig. 2). In contrast to the induction of IL-13 mRNA expression, we failed to note any difference in the ability of the two B cell subpopulations to up-regulate IFN-
mRNA expression (data not shown).
|
The XLP gene product, SH2D1A/DSHP/SAP (SAP), is a 128-residue protein that consists almost entirely of a single Src homology 2 (SH2) protein interaction domain. Because the SH2 domain of SAP binds a conserved tyrosine-containing motif found in the intracellular domains of CD2 family members, including CD244, resulting in the recruitment of tyrosine kinases, it is possible that the CD244-CD48 interaction with B cells is mediated via SAP. In two independent experiments, we found that NK cells propagated from SAP-deficient mice (24) were severely compromised in their response to B cells (Fig. 5A). The cells were not impaired in their ability to express IL-13 or IFN-
in response to other stimuli provided in the form of immobilized Abs (Fig. 5B). The absence of a response to immobilized anti-CD244 confirms that induction of IL-13 mRNA expression via this receptor requires SAP but induction of IFN-
mRNA appears to be also compromised. The decreased response is not due to differential expression of CD244 on SAP/ NK cells (41). In contrast to CD244/ NK cells, they can also respond to anti-CD28. This response is unlikely to be mediated via activation of the Fc
RIIIR because it was not affected by the addition of soluble anti-Fc
R which should block this interaction.
|
expression in response to cytokines
To further ascertain that the inability of CD244/ or SAP/ mice to respond to B cells was not attributed to defective cytokine responses, NK cells from the various strains used in this study were stimulated with IL-12, IL-18, or a combination of the two cytokines. Fig. 6 shows that NK cells from all of the strains could express both IL-13 as well as IFN-
mRNA in response to a combination of IL-12 and IL-18. Therefore, stimulation by B lymphocytes is unlikely to require cytokines. These results also confirm previous reports that IL-12 is a much better stimulator of IFN-
than IL-13 mRNA expression and that the combination of IL-12 and IL-18 may exert more of a synergistic effect on IL-13 than for IFN-
mRNA expression.
|
| Discussion |
|---|
|
|
|---|
. Although human NK cells can secrete IL-5 (42, 43), a Th2 cytokine, there is conflicting data regarding whether murine NK cells can synthesize this cytokine (5, 12, 44). In contrast, both human and murine NK cells can produce IL-13 (5, 13). IL-13 was initially described as a protein preferentially produced by activated mouse Th2 cells (reviewed in Ref.45) and shares many biological functions with IL-4.
Our studies show that highly purified B cells can induce IL-2-propagated NK cells to produce IL-13 mRNA. This induction is independent of IFN-
production by NK cells (Fig. 1) or cytokine production by B cells and requires contact between the two cell types (Fig. 2). Although NKT cells can produce Th2 cytokines,we have shown that the IL-13 mRNA in this case is not produced by these cells (Fig. 1). The expression of CD244 on NK cells is absolutely required for this positive interaction (Fig. 3). Furthermore, the SLAM-associated protein, SAP, is required for the transmission of the signal from CD244 (Fig. 5). The expression of CD48, the ligand for CD244 on B cells is also important for the activation of IL-13 mRNA expression. However, since MZ B cells are more effective stimulators than follicular B cells (Fig. 4), both of which express CD48, other costimulatory molecules may be involved.
In contrast to earlier reports indicating up-regulation of the transcripts after only 4 h of in vitro stimulation of NK cells with 100 U of IL-2 (5), we do not detect IL-13 mRNA in otherwise nonstimulated IL-2-propagated cultures. Others have also reported the absence of expression in similar cultures (13). One possible difference is that Hoshino et al. (5) isolated NK cells after repeated injection of animals with IL-2 in vivo. This type of priming may result in NK cells that differ from those that have been propagated in vitro. Similarly, although IL-13 mRNA was detected in 24-h cultures of purified NK cells after addition of only IL-2, these cells were previously cultured with IL-12 and IL-18 for 3 days before sorting (12) and may therefore be more activated than those cultured with only IL-2.
We have shown that the stimulation of NK cell IL-13 mRNA expression by B cells requires the expression of CD244 on NK cells because NK cells from mice deficient in expression of this receptor cannot synthesize IL-13 mRNA in response to B cells. A number of studies have shown that human CD244 is an activating receptor in that stimulation by its ligand, CD48, results in activation of cytotoxicity as well as IFN-
secretion (16, 46). Whether CD244 exerts inhibitory or activating signals in murine NK cells is, however, not clear. Earlier data indicated an activating role (14) but more recent studies have indicated inhibitory (23) as well as activating functions (47, 48, 49). Insofar as induction of cytokine expression, we have not detected any inhibitory activity of CD244. We have not observed, for example, increased expression of IFN-
mRNA in NK cells from CD244/ mice in response to activation by B cells (data not shown). Expression of CD48, the ligand for CD244, on tumor cells has been shown to down-regulate the production of this cytokine (23), suggesting that CD244 can impart an inhibitory signal for cytokine secretion. However, inasmuch as we have not been able to examine the production of IL-13 by individual NK cells, we cannot rule out altered expression in subpopulations of cells. In contrast, the finding that the inhibitory activity of CD244 is not mediated via SAP (23, 41) is consistent with our finding that induction by B cells as an indicator of positive signaling does require the participation of SAP (Fig. 5C). Although both CD2 and CD244 can recognize CD48, disruption of CD2 on NK cells had no effect on their ability to respond to B cells, possibly because CD2 has a lower affinity for CD48 than CD244. More importantly, CD2 receptors do not contain the conserved immunoreceptor tyrosine-based switch motifs (TxYxxV/I) (50) in their cytoplasmic tails that enable them to bind to SAP. In this regard, the mouse B-NK cell interaction is more similar to human cells in that the signal transduced by CD244 requires the mediation of SAP, and patients with defects in SAP cannot respond via their CD244 receptor (16, 51, 52). In contrast, their response to CD2 ligation is not affected (16).
Interestingly, in two different SAP-deficient mouse strains, Th2 responses are more affected than Th1 responses (24, 53, 54). Thus, the effect of CD244 on T cells in response to TCR stimulation (47, 54) may be more similar to B cell stimulation of NK cytokine expression in that CD244 performs a costimulatory role. In this regard, it is worthy to note that despite a significant decrease in the level of stimulation by CD48-deficient B cells, residual induction remained. Furthermore, although immobilized anti-CD28 can induce both wild-type and CD2/ NK cells to express IL-13 mRNA, NK cells from CD244/ were not responsive. Thus, it is possible that induction of IL-13 mRNA expression by B cells requires, in addition, the simultaneous ligation of another receptor such as CD28, and CD244 could function in NK cells in a similar manner as in T cells (54), by augmenting the activity of other receptors. Therefore, when CD48 is blocked on B cells, the other molecules, such as CD80 or CD86, can still stimulate NK expression of IL-13 mRNA, albeit at a much reduced level. The role of alternative ligands that can stimulate NK cells in conjunction with CD48 may also explain our finding that MZ B cells are better stimulators than follicular B cells despite the fact that they express similar levels of CD48. MZ B cells express higher levels of CD80 and CD86 (56) as well as other ligands such as LFA-1 (57). These coreceptors all have counterreceptors on NK cells that could signal via collaboration with CD244. The differential induction by MZ vs follicular B cells also suggest that not all cells that express CD48 are effective inducers of IL-13 mRNA expression by NK cells. In contrast, another possibility that has not been addressed is that follicular B cells may express costimulators that result in the generation of an inhibitory signal via CD244.
It is important to clarify that we have documented two types of NK-B cell interactions. Other than the stimulatory effect of B cells on NK cells documented herein, NK cells can also activate partial B cell differentiation as evidenced by the induction of germline transcripts (25). This effect, which also requires direct cell contact, is principally mediated by the CD48 receptor on B cells responding to CD2 expressed by NK cells (38). This interaction does not, however, differentiate between MZ or follicular B cells, both of which can readily respond to NK induction. Therefore, it is unlikely to be mediated by IL-13 production by NK cells.
Examination of the expression of IL-13 and IFN-
mRNA for two of the major cytokines produced by murine NK cells confirms previous findings that IL-12 preferentially induces IFN-
but is a poor inducer of IL-13 mRNA. But the combination of the two cytokines can induce high levels of both cytokines (13). Previous reports have indicated that polarization of T cell responses by cytokines is not affected in SAP-deficient mice (24). Although we found that NK cells from these mice respond poorly to either IL-12 or IL-18, significant levels of both IL-13 and IFN-
expression can be induced by the combination of the two cytokines (Fig. 6). Therefore, the response of NK cells to these cytokines is independent of the SAP-mediated phosphorylation.
We have not been able to induce freshly isolated NK cells to produce IL-13 mRNA. Upon activation by poly(I:C) in vivo, however, NK cells can be rapidly recruited to the MZ of splenic follicles (39) where they may encounter B cells residing in this region. Whereas we have shown that these MZ B cells can induce NK-cell IL-13 secretion, how the cytokine affects B cell responses is unclear. The IL-13 receptors on B cells may need to be up-regulated before they can respond to IL-13 (58). IL-13 can enhance germinal center B cell differentiation in the presence of anti-CD40 (59, 60) but the effect on MZ B cells has not been examined. We have previously documented a partial dependence on NK cells of the IgG1 response to TI-2 Ags given in the presence of the adjuvant RIBI (2). It is possible, therefore, that the induction of NK secretion of this cytokine under some conditions of immunization is responsible for the participation of NK cells in a TI-2 response. IL-13 can activate macrophages via the alternate pathway, resulting in down-regulation of the proinflammatory cytokines usually produced by macrophages (reviewed in Ref.10) and possibly altering the nature of the cytokine circuit. It should be noted that although NKT cells have been frequently associated with Th2 responses (61, 62), depletion of only NK cells can affect IgE (63) as well as IgG1 responses under specific conditions of immunization (2). In addition, although IL-13 has generally been associated with allergic inflammation (45), the cytokine may also play a role in other diseases as well (64). It remains to be shown whether the B cell induction of IL-13 expression by NK cells plays a significant role in these responses. For example, the cytokine produced under these conditions can amplify a cytokine burst involving mast cells and eosinophils in the same manner that NK production of IFN-
amplifies the cytokine loop initiated by macrophages. Thus, with the involvement of B cells, the interplay between these cytokine circuits mediated by the innate system can significantly affect the outcome of the adaptive immune response.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 Address correspondence and reprint requests to Dr. Dorothy Yuan, Department of Molecular Pathology, University of Texas Southwestern Medical Center, Dallas, TX 75390. E-mail address: dorothy.yuan{at}utsouthwestern.edu ![]()
2 Abbreviations used in this paper: SLAM, signaling lymphocyte activation molecule; SAP, SLAM-associated protein; QM, quasi-monoclonal; MZ, marginal zone; SH2, Src homology 2. ![]()
Received for publication July 28, 2005. Accepted for publication December 28, 2005.
| References |
|---|
|
|
|---|
. J. Immunol. 142: 1095-1101. [Abstract]
. J. Immunol. 162: 51-59.
-deficient and IL-4-deficient mice reveal a role for IL-13 in the regulation of Th2 responses. Curr. Biol. 8: 669-672. [Medline]
, and Stat6 are required for the expulsion of the gastrointestinal nematode parasite Nippostrongylus brasiliensis. Immunity 8: 255-264. [Medline]
genes. Science 259: 1739-1742.
-dependent and -independent initiation of switch recombination by NK cells. J. Immunol. 167: 2011-2018.
interferon inhibits lymphokine-induced antiviral and macrophage tumoricidal activities. J. Exp. Med. 159: 1560-1565. 
T cell receptors. J. Immunol. 142: 2736-2742. [Abstract]
) and type 2 (interleukin-13, interleukin-5) cytokines at distinct stages of natural killer cell differentiation from progenitor cells. Blood 99: 1273-1281.
production, and liver-specific homing of NK cells. Immunity 19: 701-711. [Medline]
production following 2B4 activation in human NK cells. In Vivo 14: 625-629. [Medline]
-mediated activation of NF-
B1. Immunity 21: 693-706. [Medline]
1 promotes IgG2a and IgG2b production by murine germinal center B cells. J. Immunol. 163: 1153-1161.
1 expression by murine germinal center B cells and follicular dendritic cells. Eur. J. Immunol. 30: 3157-3164. [Medline]
from an altered peptide ligand-specific Th2 cell clone down-regulate adoptive transfer of experimental autoimmune encephalomyelitis. J. Immunol. 164: 3563-3572. This article has been cited by other articles:
![]() |
D. Yuan Comment on "Molecular Basis of the Dual Functions of 2B4 (CD244)" J. Immunol., October 15, 2008; 181(8): 5181 - 5181. [Full Text] [PDF] |
||||
![]() |
N. Gao, P. Jennings, and D. Yuan Requirements for the natural killer cell-mediated induction of IgG1 and IgG2a expression in B lymphocytes Int. Immunol., May 1, 2008; 20(5): 645 - 657. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |