|
|
||||||||
Nuffield Department of Surgery, University of Oxford, John Radcliffe Hospital, Oxford, United Kingdom
| Abstract |
|---|
|
|
|---|
following restimulation with alloantigen in vitro. In vivo CD44+CD8+ T cells rejected donor-type skin allografts more rapidly than naive CD8+ T cells demonstrating the ability of these putative memory T cells to mount an effective recall response in vivo. These data form the first direct demonstration that CD8+ T cells are able to generate memory as well as effector cells in response to alloantigen during rejection in the complete absence of CD4+ T cells. These data have important implications for the design of therapies to combat rejection and serve to reinforce the view that CD8+ T cell responses to allografts require manipulation in addition to CD4+ T cell responses to completely prevent the rejection of foreign organ transplants. | Introduction |
|---|
|
|
|---|
The implication that following transplantation CD8+ T cells can mount an effective immune response independently of CD4+ T cell help has recently gained support from studies on CD8+ T cell responses to pathogens. For example, on infection with lymphocytic choriomeningitis virus, mice that were devoid of CD4+ T cells mounted as strong a CD8+ CTL response to the virus as that seen in CD4+ T cell replete mice (5). Similarly, effective primary CTL responses to both adenovirus-transformed embryonic stem cells (a model of cross-priming) and Listeria monocytogenes have been reported in the absence of CD4+ T cells (6, 7). However, CD4+ T cells are not dispensable for all primary CTL responses (8, 9, 10), which may reflect the differential activation of APC by exposure to different pathogen products or conditions of inflammation (11) that may serve to substitute for APC priming by CD4+ T cells (12, 13, 14).
Despite the evidence that under certain conditions productive primary CD8+ T cell responses can be generated in the absence of CD4+ T cell help, most studies have suggested that CD4+ T cells are absolutely required to either generate (5, 6, 15) or support the survival of CD8+ memory T cells (7, 16, 17). This connection may involve CD40 ligation on activated CD8+ T cells by CD154-expressing CD4+ T cells (18), although this remains controversial (19). However, CD4+ T cells are not always necessary for the generation and survival of memory CD8+ T cells as recently suggested by Marzo et al. (20). The group demonstrates that although CD4+ T cells may be required for optimal survival of CD8+ memory T cells, in their absence, memory CD8+ T cells can be generated, which are functionally indistinct from their helped counterparts.
Much of the difference between CD4+ T cell dependent and independent CD8+ T cell responses appears to lie in the way in which APC are activated. In this regard the activation of donor APC (responsible for initiating graft rejection by the direct pathway of alloantigen recognition) may represent a unique environment for APC activation due to the excessive inflammation, cell death, and hypoxia that occurs within tissue following transplantation. Therefore, determining the ability of naive CD8+ T cells to respond to an allograft in the absence of CD4+ T cell help will be critical to further the development of strategies to prevent the rejection of foreign organ grafts and determine whether CD8+ T cell responses must be targeted in addition to CD4+ T cell responses to achieve this goal.
To this end, we have used a previously described model involving the use of H2Kb-reactive TCR-transgenic mice (BM3) to dissect the response of CD8+ T cells to a skin allograft in the absence of CD4+ T cells (21). We specifically determined the location and timing of activation, the kinetics and result of infiltration of skin grafts by the CD8+ T cells, as well as the long-term outcome of the CD8+ T cell response to alloantigen in terms of memory T cell generation. We show that following the activation of donor-reactive CD8+ T cells in the draining lymph nodes, CD8+ T cells expand and home to the allograft, which results in the induction of a cytotoxic T cell type 1 response. Furthermore, despite the continued absence of CD4+ T cells, during rejection a population of CD44+CD8+ putative memory T cells is generated, which promptly produce effector cytokine following restimulation in vitro and rapidly reject skin allografts in vivo.
| Materials and Methods |
|---|
|
|
|---|
CBA.Ca RAG-1 knockout (CBA RAG/) mice were a generous gift of Dr. D. Kioussis (Mill Hill, London, U.K.). BM3 TCR-transgenic mice (BM3; H2k) were provided by Prof. A. L. Mellor (Institute of Molecular Medicine and Genetics, Augusta, GA) (22). BM3 mice were crossed to a CBA RAG/ background for use in these studies. CBA.Ca (CBA; H2k) and C57BL/10 (B10; H2b) mice were originally purchased from Harlan Olac. All mice were bred and housed in the Biomedical Services Unit, John Radcliffe Hospital, in accordance with the Animals (Scientific Procedure) Act 1986 of the U.K. All experiments were performed with mice between ages 6 and 12 wk at the time of first procedure.
Skin transplantation
Individual full-thickness tail skin grafts were prepared to fit the graft bed on the left lateral thorax of anesthetized recipients. The grafts were inspected regularly until they were completely destroyed, at which time the grafts were considered rejected.
Cell isolations
BM3 RAG/ CD8+ T cells. A single-cell leukocyte suspension was made from spleens and mesenteric lymph nodes (MLN)5 harvested from BM3 RAG/ TCR-transgenic mice. CD8+ T cells were purified by positive selection using anti-CD8 MACS beads (Miltenyi Biotec). Typically CD8+ T cells were isolated to >95% purity. All CD8+ T cells expressed the transgenic TCR. As BM3 mice were on a RAG/ background, no CD4+ T cells contaminated the cell preparations.
CBA CD8+ and CD4+ T cells. Leukocytes were prepared and the CD8+ and CD4+ T cells purified by positive selection using anti-CD8 or anti-CD4 MACS beads (Miltenyi Biotec). Typically CD8+ and CD4+ T cells were isolated to >95% purity.
Putative memory BM3 T cells. Leukocytes were prepared from CBA RAG/ mice that had received both BM3 T cells and a B10 skin graft 100 days before harvest. Cells were stained with anti-CD8-allophycocyanin and anti-CD44-PE mAbs (both BD Biosciences). Typically, such cell preparations contained 23% BM3 T cells, of which >90% were found to be CD44+. The CD44+ BM3 T cells were purified using a FACSAria flow cytometer (BD Biosciences). Typically, sorting resulted in a purified population of >95% CD8+CD44+ T cells with 12% contamination with CD8+CD44 T cells.
CD44 BM3 T cells. Leukocytes were prepared from naive BM3 RAG/ mice. Cells were stained with anti-CD8-allophycocyanin and anti-CD44-PE mAbs (BD Biosciences). Typically, such cell preparations contained 60% BM3 T cells of which 98% were found to be CD44. The CD44 BM3 T cells were purified using a FACSAria flow cytometer (BD Biosciences). Typically, such purification resulted in a purified population of >99% CD8+CD44 T cells with no contamination with CD8+CD44+ T cells.
CFSE labeling
Single-cell suspensions were incubated for 10 min at 37°C with 10 µM CFSE (Molecular Probes), washed twice in ice-cold RPMI 1640 (Invitrogen Life Technologies), and resuspended in PBS (Oxoid) ready for i.v. injection.
Flow cytometric analysis
A single-cell suspension was prepared from spleen, MLN, or axillary lymph nodes. Potential binding of mAbs to Fc receptors was prevented by incubation of the cells with Fc block (BD Biosciences) for 15 min at room temperature. Cells were then stained with anti-CD8-allophycocyanin (BD Biosciences) and anti-transgenic TCR (Ti98)-biotin mAbs. The Ti98 hybridoma was a generous gift from Prof. A. L. Mellor (Institute of Molecular Medicine and Genetics) (23). Ti98 was grown and biotinylated in the laboratory. The Ti98-biotin mAb was developed using streptavidin-CyChrome (BD Biosciences). All samples were then acquired immediately on a four-color FACSort (BD Biosciences) and analyzed using the CellQuest software package (BD Biosciences). Analysis of the forward vs side light scatter dot plot of a given sample enabled live cells (and beads; see below) to be distinguished clearly from dead cells and cell debris.
Enumeration of cell numbers by flow cytometry
We used a technique that allowed determination of cell numbers by flow cytometry. Before acquisition of cells on a flow cytometer a fixed number of 6 mM synthetic fluorescent beads (CaliBRITE beads; BD Biosciences) were added to each sample. The ratio of the cell population of interest to fluorescent beads was then determined, from which the number of such cells per sample could be calculated. The number of cells per tube was then multiplied by the proportion of the sample placed into the FACS tube to result in the total number of cells per sample/tissue. The absolute number of BM3 T cells in the spleen, MLN, draining axillary lymph nodes (dLN), and contralateral axillary lymph nodes (cLN) was calculated using this method.
Real-time PCR
Skin grafts were harvested at different time points after transplantation, snap frozen, and DNase I-treated total RNA was later isolated using the Absolutely RNA Miniprep kit (Stratagene) and reversed transcribed by the Moloney murine leukemia virus reverse transcriptase (Invitrogen Life Technologies) as previously described (24). An additional DNase I (Ambion) digestion step was included during reverse transcription to make sure samples were free of genomic contamination. Real-time quantification was performed using the ABI PRISM 7700 Sequence Detection System (PE Applied Biosystems) using either the fluorogeneic probe (hypoxanthine phosphoribosyltransferase (HPRT), IFN-
, and perforin) or the SYBR Green technology (HPRT, CCL5, XCL1, CXCL9, and CXCL10). All samples were run in duplicate using the qPCR Master Mix Plus (Eurogentec) or the Brilliant SYBR Green qPCR Master Mix (Stratagene) in a total of 25 µl (probe and SYBR Green technology, respectively). The following primers and probes (all FAM-5' and 3'-TAMRA labeled) were designed using the Primer Express version 1.0 (PE Applied Biosystems): HPRT forward ATCATTATGCCGAGGATTTGGAA, reverse TTGAGCACACAGAGGGCCA, and probe TGGACAGGACTGAAAGACTTGCTCGAGATG; IFN-
forward AGCAACAGCAAGGCGAAA AA, reverse AGCTCATTGAATGCTTGGCG, and probe ATTGCCAAGTTTGAGGTCAACAACCCACA; and perforin forward CAAGGTGGAGTGGAGGTTTTTGT, reverse TTTTGCAGCTGAGAAGACCTATCA, and probe CCAGGCGAAAACTGTACATGCGAC ACT. CCL5, XCL1, CXCL9, and CXCL10 specific primers for SYBR Green real-time PCR have been previously described (24). Samples were standardized for HPRT, and quantification of the gene of interest is given by 2
Ct, where
Ct is obtained by calculating the difference between Ct of the gene of interest and HPRT (25).
MLR analysis
A total of 1.25 x 104 sorted BM3 T cells or 3 x 104 CBA CD8+ T cells was cultured with 1 x 105 irradiated (3000 rad) B10 stimulator splenocytes per well in RPMI 1640 (Invitrogen Life Technologies) supplemented with penicillin G (75 U/ml), streptomycin (45 mg/ml), kanamycin sulfate (90 mg/ml), glutamine (2 mM), 5 x 105 M/L 2-ME (Sigma-Aldrich) and 10% heat-inactivated FCS. Cultures were left for the indicated times before being pulsed with 0.5 µCi of [3H]thymidine for the last 18 h before harvesting (Wallac). Incorporated cellular radioactivity was measured in a Betaplate counter (Wallac). Replicate wells were also setup and supernatant harvested for cytokine analysis.
ELISA
ELISA were conducted in Nunc 96-well F96 Maxisorp immunoplates (VWR International) and data analyzed using an Emax precision microplate reader (Molecular Devices) and Softmax software (Molecular Devices). Samples and doubling dilutions of IFN-
standards (BD Pharmingen) were analyzed in triplicate. IFN-
capture mAb (R46A2) was grown and purified in the laboratory. IFN-
was detected using a biotin-labeled anti-IFN-
mAb (XMG1.2; BD Pharmingen) and developed using avidin HRP (Vector Laboratories) followed by ABTS substrate and H2O2.
Immunohistochemistry
Thin frozen sections (7 µm) were cut, air-dried overnight, and fixed in acetone (BDH). After inhibition of endogenous peroxidase activity and blockade of endogenous biotin sections were incubated with an anti-CD8-biotin mAb (BD Biosciences) for 1 h at room temperature. Slides were developed following incubation with ABC complex (Vector Laboratories) and addition of diaminobenzidine substrate (Sigma-Aldrich). Finally, sections were counterstained with Gills hematoxylin (BDH) and prepared for permanent mounting in DPX (BDH).
Statistical analysis
Statistical analysis was performed using Students t test. Graft survival data were analyzed by the log-rank test. Values for p < 0.05 were considered statistically significant.
| Results |
|---|
|
|
|---|
A total of 1 x 105 purified BM3 CD8+ T cells was adoptively transferred into CBA RAG/ mice i.v. Such mice received either a B10 (H2Kb+; allogeneic) or CBA (H2k; syngeneic) skin allograft 1 day later and graft survival was monitored daily. We found that CBA RAG/ recipients reconstituted by adoptively transferred BM3 CD8+ T cells rejected B10 skin allografts acutely (BM3+B10 skin transplantation (Tx); median survival time = 26 days; n = 5) (Fig. 1). As expected, BM3 T cells failed to mediate rejection of syngeneic skin grafts (median survival time >100 days; n = 6) and CBA RAG/ mice that did not receive BM3 CD8+ T cells did not reject B10 skin allografts (skin Tx only; median survival time >100 days; n = 4) (Fig. 1). Taken together, these data demonstrate that the rejection of B10 (H2Kb+) skin grafts was mediated by the BM3 CD8+ T cells.
|
We next sought to determine the location and kinetics of the priming of BM3 T cells following skin grafting. To this end, 1 x 105 purified CFSE-labeled BM3 CD8+ T cells were adoptive transfer into CBA RAG/ recipients and the following day, mice were transplanted with either B10 (BM3+B10 skin Tx) or CBA (BM3+CBA skin Tx) skin allografts. Spleen, MLN, cLN, and dLN were harvested 5 and 10 days after skin grafting for analysis.
We found that priming of BM3 CD8+ T cells (as judged by the dilution of CFSE and an increase in cell number compared with the dLN of mice that had received a syngeneic skin graft) began as early as 5 days after transplantation of an allogeneic B10 skin graft (Fig. 2A). Some 59% of mice (19 of 32 mice analyzed) showed priming at this time. By 10 days after transplantation all mice studied contained large numbers of primed (CFSE) effector/memory BM3 CD8+ T cells. The majority of these cells had up-regulated CD44 expression indicating prior Ag experience in the dLN but not in the cLN (Fig. 2, A and B; data not shown). T cell priming was never seen following syngeneic skin transplantation (Fig. 2B). We also analyzed the appearance of CFSE putative effector/memory T cells in other lymphoid tissues. Although small numbers of CFSE BM3 T cells were detected in lymphoid tissues not draining the allogeneic B10 skin graft, the vast majority were found in the dLN (Fig. 2B). Importantly, BM3 T cells that had diluted levels of (but had not completely lost; intermediate) CFSE were only found in the dLN, confirming that the BM3 CD8+ T cells initially became activated and underwent expansion exclusively in the dLN before a degree of redistribution of effector/memory CFSE T cells to nondraining lymphoid tissue (Fig. 2C).
|
Next, we sought to correlate the kinetics of peripheral T cell priming with the acquisition of the ability of BM3 CD8+ T cells to infiltrate skin grafts. B10 skin grafts were analyzed for the presence of CD8+ T cells either by immunohistochemistry or by real-time RT-PCR for CD3 expression (as a surrogate marker of T cell infiltration) (Fig. 3). Immunohistochemical staining for CD8 revealed that CD8+ T cells were found only rarely in the graft 5 days after skin transplantation, despite evidence that BM3 CD8+ T cells were being primed in the dLN at this time (Figs. 3A and 2, A and C). However, by 10 days after transplantation CD8+ T cells were found to have infiltrated the skin grafts (Fig. 3A). The BM3 T cells were found to form a focal infiltrate 10 days after skin grafting that was largely localized around vessels and hair follicles, but by 15 days posttransplant BM3 T cells were found throughout the skin penetrating all layers including epidermis (data not shown). Importantly, no staining for CD8 was detectable in skin allografts from recipients that had not received BM3 CD8+ T cells at any of the time points studied, confirming that the CD8 staining observed was specific for infiltrating BM3 CD8+ T cells.
|
Five days after transplantation (before infiltration of BM3 CD8+ T cells) (Fig. 3), real-time RT-PCR analysis of skin allografts revealed that the expression of a number of proinflammatory chemokines (such as CCL5/RANTES (21-fold), CXCL10/IP-10 (13-fold), and CXCL9/MIG (45-fold)) was up-regulated to a similar extent in mice that had or had not received BM3 T cells, i.e., as a result of the inflammatory processes associated with transplantation (Fig. 4). In contrast, minimal IFN-
(17-fold increase but low level expression), perforin (2-fold), and XCL1/lymphotactin (not increased) was expressed in either sets of grafts compared with expression found in untransplanted donor skin (Fig. 4). However, infiltration of BM3 T cells by day 10 coincided with a dramatic up-regulation of IFN-
(499-fold), perforin (366-fold), and XCL1 (102-fold) mRNA levels and further increased expression of CCL5 (26-fold), CXCL10 (39-fold), and CXCL9 (228-fold) compared with expression in skin grafts taken from mice that had not received adoptive transfer of BM3 T cells. These data suggest that infiltrating BM3 CD8+ T cells mediate graft rejection through a predominantly cytotoxic T cell type 1-driven response and set up a positive chemotactic feedback loop to facilitate the ongoing recruitment of immune cells into the graft.
|
Given the finding that in response to alloantigen stimulation CD8+ T cells could mount a vigorous effector response in the absence of CD4+ T cells that ultimately culminates in skin allograft rejection, we next determined whether such a response could lead to the generation of memory BM3 CD8+ T cells. We found that 25 days after transplantation large numbers of CD44+ putative memory BM3 CD8+ T cells were present in all lymphoid tissues studied (Fig. 5). These cells were not generated simply by homeostatic expansion because mice that had received BM3 CD8+ T cells and a syngeneic CBA skin graft harbored very few CD44+ T cells. Interestingly, unlike early analyses (days 5 and 10) when viable tissue within the skin graft was still present, following rejection, putative memory T cells showed no preferential sequestration in the dLN compared with the cLN or spleen, although the number of cells remained low in the MLN at this time (but not at 100 days posttransplantation; data not shown) (Fig. 5).
|
7080 days after rejection). At this time the phenotype of BM3 CD8+ T cells in spleen of mice that had received a B10 skin graft was 92% CD44+, 51% CD45RBlow, and 80% CD62Llow compared with BM3 CD8+ T cells in mice that did not receive a skin graft (27% CD44+, 6% CD45RBlow, and 24% CD62Llow) (data not shown). A similar phenotype was also observed in the MLN, cLN, and dLN (data not shown).
Finally, the function of putative memory BM3 CD8+ T cells was tested, both in vitro and in vivo. CD44+ BM3 T cells were purified from RAG/ mice that had received BM3 T cells and a B10 skin graft 100 days previously. Their response to alloantigen compared with that of CD44 BM3 CD8+ T cells purified from naive BM3 mice. Upon restimulation with irradiated B10 (H2Kb+) splenocytes in vitro, CD44+ BM3 CD8+ T cells were found to rapidly secrete copious amounts of IFN-
, whereas naive CD44 BM3 CD8+ T cells produced IFN-
at much lower levels with a slower kinetic (Fig. 6A). In contrast, CD44+ BM3 CD8+ T cells showed defective proliferation to alloantigen, whereas naive CD44 BM3 CD8+ T cells proliferated throughout the course of the assay (Fig. 6B). Additionally, we found that the presence of polyclonal CD4+ T cells during skin allograft rejection was unable to restore the proliferative response of CD44+ BM3 T cells in vitro despite secretion of IFN-
(Fig. 6). Similar numbers of CD44+ BM3 T cells were also generated in the presence (83,850/mouse; n = 8) or absence (78,540/mouse; n = 8) of CD4+ T cells. Therefore, it appeared from in vitro analyses that putative CD44+ BM3 CD8+ memory T cells (in the presence or absence of CD4+ T cells) had acquired some of the properties of memory cells (memory phenotype and rapid secretion of effector cytokine) but not others (enhanced proliferation and expansion).
|
Finally, we assessed whether the generation of putative memory CD8+ T cells in the absence of CD4+ T cells was restricted to the use of TCR-transgenic T cells or was a more generalized phenomenon. To this end, syngeneic polyclonal CD8+ T cells were purified and transferred to RAG/ mice the day before B10 skin transplantation. All skin grafts were rejected between 20 and 30 days after transplantation (data not shown). Purified CD8+ T cells isolated over 40 days after rejection failed to proliferate but rapidly produced IFN-
. In contrast, naive CD8+ T cells proliferated but failed to produce IFN-
within the time frame of the experiment. Therefore, polyclonal CD8+ T cells that had elicited the rejection of a donor-type skin graft responded to restimulation with alloantigen in vitro in an identical fashion to CD44+ memory BM3 T cells.
| Discussion |
|---|
|
|
|---|
Importantly, we found that the activation of CD8+ T cells was restricted to the dLN (Fig. 2) and that peripheral activation and expansion always preceded the infiltration of CD8+ T cells into the skin graft (Fig. 3). These data are consistent with the hypothesis (26) that the initial activation of T cells following skin grafting is due to the recognition of alloantigen presented by donor APC that have migrated to the dLN following activation triggered by the inflammation, hypoxia, and surgical trauma associated with transplantation. Indeed, we have previously reported similar findings following the transplantation of vascularized grafts (e.g., heart) (27, 28), although priming in this situation was systemic rather than confined to local lymph nodes.
Recently, this route of activation of T cells reactive to alloantigen by the direct pathway has been called into question (29). Baratin et al. (29) postulated that CD4+ T cells that recognize alloantigen via the direct pathway were initially activated within the skin graft itself as they found little evidence of peripheral T cell priming. This result is in clear contrast to the data presented in this study. Of course the difference may lie in the different ways in which alloreactive CD4+ and CD8+ T cells become activated following transplantation. However, we feel that perhaps a more likely explanation for this difference may lie in the fact that these studies were performed by skin grafting the native TCR-transgenic mice themselves rather than using an adoptive transfer model as reported. In the former situation, the recipient would have a pool of alloreactive T cells far in excess of that present in a normal mouse, and therefore in circumstances in which donor APC are limited and only a small number of T cells are activated, it may be difficult to distinguish primed T cells from the vast numbers of unactivated cells. Indeed, we have previously reported that following adoptive transfer of 6 x 106 BM3 T cells into thymectomized T cell-depleted recipients, we were unable to find activated cells in the dLN following skin grafting (30). Increasing the ratio of donor APC to alloreactive T cell by the adoptive transfer of far lower numbers of BM3 T cells (1 x 105; as we reported) enabled us to visualize the peripheral priming of T cells to a skin graft clearly. Whether there is a true dichotomy in the location of primary activation of CD4+ and CD8+ T cells following transplantation remains to be determined, but performing adoptive transfer studies using physiological numbers of alloreactive CD4+ T cells would be a major advance in answering this question.
Analysis of BM3 CD8+ T cells in recipients that had received a B10 skin graft 100 days earlier revealed that >90% of cells had up-regulated CD44 indicative of memory/effector T cells. Such cells were found to mediate rejection of a B10 skin graft upon transfer to second recipients far quicker than their naive counterparts, suggesting that these cells do behave like memory T cells in vivo. This result is related to a different functional capacity of the CD44+ T cells compared with that of naive T cells because the same number of TCR-transgenic BM3 T cells (i.e., reactive to the same alloantigen with the same TCR affinity) was adoptively transferred in both cases. However, in vitro analyses (again using the same number of CD44+ or naive BM3 T cells) revealed that although putative memory T cells rapidly produced effector cytokine (IFN-
), surprisingly, these cells proliferated poorly when compared with naive BM3 T cells (Fig. 6). So, although CD44+ BM3 CD8+ T cells were found to be functionally distinct from naive T cells they only appeared to have acquired some characteristics of memory T cells but not others (rapid clonal expansion).
The cause of this apparent paradox remains unclear. It appears not to be related to the BM3 T cells themselves as we found that heterogeneous CBA CD8+ T cells can also reject B10 skin allografts in the absence of CD4+ T cells upon transfer to syngeneic RAG/ mice. Furthermore, such cells when isolated over 40 days after rejection also produced large amounts of IFN-
rapidly but proliferated poorly when compared with naive CD8+ T cells (Fig. 7). We are currently investigating whether the defective proliferation of CD44+ BM3 CD8+ T cells upon restimulation is an in vitro artifact or whether these cells are able to mediate skin graft rejection with secondary kinetics without proliferation due to enhanced homing to the graft and effector function. Interestingly, Bachmann et al. (31) have demonstrated recently that in the absence of CD4+ T cell help, CD8+ T cells could be generated while defective in proliferation-displayed effector function and homing properties consistent with memory T cells upon reactivation. Bourgeois et al. (32) have also reported that in the absence of CD4+ T cells, CD8+ T cells could differentiate into memory cells with partial effector function but defective proliferation in vitro, a phenomenon they have termed CD8+ T cell lethargy.
|
Whatever the reason for the defective proliferation of CD44+ BM3 CD8+ T cells in vitro, it is clear that CD44+ BM3 CD8+ T cells are functionally distinct from their naive counterparts and are able to elicit graft rejection more vigorously. Furthermore, the generation and function of these cells was not enhanced even when a 10-fold excess of syngeneic, polyclonal CD4+ T cells were cotransferred together with BM3 T cells the day before skin grafting (Fig. 6). Indeed, thus far, we have been unable to demonstrate a role for CD4+ T cells in the generation of memory alloreactive CD8+ T cells following skin grafting, which raises the important question as to why CD4+ T cells are dispensable for the generation of alloreactive memory CD8+ T cells during graft rejection.
Certainly one possibility is that the activation signals received by donor APC are sufficient to "license" these cells to induce a productive primary CTL response and generate memory CD8+ T cells. Pattern recognition receptors are one of the key components in the maturation of immature dendritic cells (DC) into mature DC, which enables them to become capable of stimulating an immune response. These pattern recognition receptors not only recognize certain viral and bacterial products (11) but can also recognize self-proteins that are produced by stressed or necrotic cells. Given the degree of surgical trauma, hypoxia, inflammation, and cell death that occurs after transplantation, resident donor DC may be induced to mature DC via a different set of activation signals from those triggered following pathogen infection. In particular, TLR4 can be triggered by Hsp70, polysaccharide fragments of heparan sulfate, and fibrinogen in addition to LPS (34).
Another possibility is that the longevity and dose of Ag exposure overrides the necessity for CD4+ T cells for memory CD8+ T cell generation/survival. Indeed, Williams and Bevan (35) have shown that even in the presence of CD4+ T cells, shortening the time of exposure to Listeria monocytogenes resulted in reduced numbers of memory CD8+ T cells despite a similar primary CTL response to that seen with longer exposures. In the model presented in this study, grafts are not rejected until
2025 days after transplantation and can therefore provide a constant source of alloantigen for the continued activation of effector/memory T cells. As BM3 T cells can only recognize alloantigen via the direct pathway of allorecognition, this result would mean that donor DC migrate continuously from the transplant until the graft is rejected, that recipient DC acquire whole MHC molecules from the graft (semidirect pathway (36)), or that a proportion of effector cells that had infiltrated the graft develop into memory T cells in situ before trafficking back out of the graft to form the peripheral memory T cell pool. We would favor the later hypothesis as we found a dramatic increase in the number of peripheral effector/memory T cells shortly after rejection (day 25) (Fig. 5) compared with before rejection (day 15) (data not shown).
Finally, as these experiments were conducted in lymphopenic mice the potential role of homeostatic proliferation needs to be considered. We have found that BM3 T cells undergo slow homeostatic proliferation and expansion upon transfer to RAG/ mice. However, cells responding to the allograft were always distinguishable from those undergoing homeostatic proliferation due to the rapid division kinetic of such cells (Fig. 2). We have previously shown that homeostatic proliferation of BM3 T cells is not required for skin graft rejection as such cells reject skin allografts even in the absence of homeostatic proliferation i.e., following adoptive transfer into CBA mice treated previously with depleting anti-CD4 and anti-CD8 (30). Furthermore, 25 days after transplantation there was little expansion and up-regulation of CD44 by BM3 CD8+ T cells in the absence of an H2Kb+ skin allograft (Fig. 5). Therefore, homeostatic proliferation appears to have little or no role in T cell priming, graft rejection, and memory T cell generation, although more subtle effects cannot be entirely excluded. However, the absence of other memory T cell clones in these experiments may have contributed to the survival of memory BM3 T cells, as Johansen et al. (17) have suggested that the presence of CD4+ T cells during CD8+ T cell priming enhances the competitive fitness of memory CD8+ T cells.
Taken together we feel these data expand current knowledge of the role of CD4+ T cells in the generation and survival of effector and memory CD8+ T cells and provide support for the concept that under certain conditions, memory CD8+ T cells can develop in the absence of CD4+ T cell help (20). These data also confirm and extend previous data suggesting that alloreactive CD8+ as well as CD4+ T cell responses to foreign organ transplants need to be manipulated to achieve a robust form of tolerance.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by Kidney Research U.K., The Wellcome Trust, and the Fundação para a Ciência e Tecnologia (Portugal) Scholarship Praxis XXI/BD/18478/98. N.D.J. is a Kidney Research U.K. Senior Research Fellow. M.O.B. is a Wellcome Trust Prize Student. K.J.W. holds a Royal Society Wolfson Research Merit Award. ![]()
2 N.D.J. and M.C.-G. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Nick D. Jones, Nuffield Department of Surgery, John Radcliffe Hospital, Oxford OX3 9DU, U.K. E-mail address: nicholas.jones{at}nds.ox.ac.uk ![]()
4 Current address: Department of Pathology, School of Medicine, Universite de Bourgogne, Bat Gabriel, F-21000 Dijon, France. ![]()
5 Abbreviations used in this paper: MLN, mesenteric lymph node; DC dendritic cell; cLN, contralateral axillary lymph node; dLN, draining axillary lymph node; HPRT, hypoxanthine phosphoribosyltransferase; Tx, transplantation. ![]()
Received for publication August 8, 2005. Accepted for publication November 23, 2005.
| References |
|---|
|
|
|---|
-globin gene promoters. Int. Immunol. 6: 277-287. 
CT method. Methods 25: 402-408. [Medline]This article has been cited by other articles:
![]() |
F.-M. Mbitikon-Kobo, M. Vocanson, M.-C. Michallet, M. Tomkowiak, A. Cottalorda, G. S. Angelov, C.-A. Coupet, S. Djebali, A. Marcais, B. Dubois, et al. Characterization of a CD44/CD122int Memory CD8 T Cell Subset Generated under Sterile Inflammatory Conditions J. Immunol., March 15, 2009; 182(6): 3846 - 3854. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Assudani, H.-I. Cho, N. DeVito, N. Bradley, and E. Celis In vivo Expansion, Persistence, and Function of Peptide Vaccine-Induced CD8 T Cells Occur Independently of CD4 T Cells Cancer Res., December 1, 2008; 68(23): 9892 - 9899. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Carvalho-Gaspar, N. D. Jones, S. Luo, L. Martin, M. O. Brook, and K. J. Wood Location and Time-Dependent Control of Rejection by Regulatory T Cells Culminates in a Failure to Generate Memory T Cells J. Immunol., May 15, 2008; 180(10): 6640 - 6648. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Gelman, M. Okazaki, J. Lai, C. G. Kornfeld, F. H. Kreisel, S. B. Richardson, S. Sugimoto, J. R. Tietjens, G. A. Patterson, A. S. Krupnick, et al. CD4+ T Lymphocytes Are Not Necessary for the Acute Rejection of Vascularized Mouse Lung Transplants J. Immunol., April 1, 2008; 180(7): 4754 - 4762. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Wang, H. Dai, N. Wan, Y. Moore, and Z. Dai The Role for Monocyte Chemoattractant Protein-1 in the Generation and Function of Memory CD8+ T Cells J. Immunol., March 1, 2008; 180(5): 2886 - 2893. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Wan, H. Dai, T. Wang, Y. Moore, X. X. Zheng, and Z. Dai Bystander Central Memory but Not Effector Memory CD8+ T Cells Suppress Allograft Rejection J. Immunol., January 1, 2008; 180(1): 113 - 121. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yang, M. O. Brook, M. Carvalho-Gaspar, J. Zhang, H. E. Ramon, M. H. Sayegh, K. J. Wood, L. A. Turka, and N. D. Jones Allograft rejection mediated by memory T cells is resistant to regulation PNAS, December 11, 2007; 104(50): 19954 - 19959. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Reich-Zeliger, E. Bachar-Lustig, A. Bar-Ilan, and Y. Reisner Tolerance Induction in Presensitized Bone Marrow Recipients by Veto CTLs: Effective Deletion of Host Anti-Donor Memory Effector Cells J. Immunol., November 15, 2007; 179(10): 6389 - 6394. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhai, Y. Wang, Z. Wu, and J. W. Kupiec-Weglinski Defective Alloreactive CD8 T Cell Function and Memory Response in Allograft Recipients in the Absence of CD4 Help J. Immunol., October 1, 2007; 179(7): 4529 - 4534. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Liu, H. Dai, N. Wan, T. Wang, S. Bertera, M. Trucco, and Z. Dai Suppression of Memory CD8 T Cell Generation and Function by Tryptophan Catabolism J. Immunol., April 1, 2007; 178(7): 4260 - 4266. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |